ID: 1060979945

View in Genome Browser
Species Human (GRCh38)
Location 9:127786065-127786087
Sequence GCCTGGAGTGCGGCGGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060979933_1060979945 10 Left 1060979933 9:127786032-127786054 CCGTGGAGGCGGAAGTGGCGCGG 0: 1
1: 0
2: 0
3: 22
4: 694
Right 1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG 0: 1
1: 0
2: 1
3: 38
4: 349
1060979931_1060979945 20 Left 1060979931 9:127786022-127786044 CCGGAAGTGGCCGTGGAGGCGGA 0: 1
1: 0
2: 0
3: 15
4: 126
Right 1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG 0: 1
1: 0
2: 1
3: 38
4: 349
1060979927_1060979945 28 Left 1060979927 9:127786014-127786036 CCGCGAGGCCGGAAGTGGCCGTG 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG 0: 1
1: 0
2: 1
3: 38
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060979945 Original CRISPR GCCTGGAGTGCGGCGGCGGC GGG Exonic
900072055 1:778873-778895 GGCTTATGTGCGGCGGCGGCCGG - Intergenic
900113895 1:1020580-1020602 GCGAGGAGGGAGGCGGCGGCGGG - Intronic
900117678 1:1035419-1035441 GTCTGGAGTGAGGAGGAGGCTGG + Intronic
900591458 1:3462085-3462107 GGCAGGAGTGTGGCGGGGGCGGG + Intronic
900939300 1:5787472-5787494 GACTGGAGTGCTGAGGGGGCTGG + Intergenic
901109773 1:6785440-6785462 GGCGGGTGCGCGGCGGCGGCGGG + Exonic
901433922 1:9234815-9234837 GCCTGGGGCGGGGTGGCGGCCGG + Exonic
901458257 1:9376313-9376335 GCCTCGAGTGCAGCGGAGGGGGG + Intergenic
902823255 1:18956264-18956286 GCCCGCCGGGCGGCGGCGGCGGG - Exonic
903132768 1:21290327-21290349 GCCTGGAGGGCGGGGGCGGGAGG - Intronic
903325604 1:22567076-22567098 GCCTGGAGAGCGGTGTCTGCAGG + Intronic
903335309 1:22620511-22620533 GCCTGGTGTGCAGCAGGGGCAGG + Intergenic
903387492 1:22936970-22936992 GACTGGAGTGAGGTGGAGGCAGG - Intergenic
903750177 1:25616686-25616708 GGCTGCGGCGCGGCGGCGGCGGG + Intergenic
903839117 1:26225653-26225675 GCCTGGAGCGCGGCGGCAGCTGG + Intergenic
903907536 1:26696951-26696973 CGCTGCAGAGCGGCGGCGGCGGG + Exonic
904414131 1:30345432-30345454 GGCTGGAGTGCAGTGGTGGCAGG - Intergenic
905104665 1:35557377-35557399 CCCTGGACAGCGACGGCGGCCGG + Exonic
906260117 1:44380615-44380637 GCCTGGAGGGCAGTGGGGGCGGG - Intergenic
907451405 1:54547983-54548005 GCCTGGAGTTTGGCTGGGGCTGG + Intronic
909585222 1:77281891-77281913 GCCGGGTCTGCGGCGGCTGCCGG - Intergenic
911696560 1:100895992-100896014 GCGTGGCTTGCGGCGGGGGCGGG - Exonic
911825717 1:102482488-102482510 GCCTGTTGTGCGGTGGGGGCAGG + Intergenic
912927820 1:113929379-113929401 GTCTGCAGTGCGGAGGGGGCGGG + Intronic
913406444 1:118497380-118497402 GCCTGTAGTGGGGTGGGGGCAGG + Intergenic
913659192 1:120991651-120991673 GGCTGGAGTGCGGCGGTGCAAGG + Intergenic
914010556 1:143774775-143774797 GGCTGGAGTGCGGTGGCGCAAGG + Intergenic
914167267 1:145186340-145186362 GGCTGGAGTGCGGCGGCGCAAGG - Intergenic
914649177 1:149683432-149683454 GGCTGGAGTGCGGCGGCGCAAGG + Intergenic
914793129 1:150897273-150897295 GCCTGGAGTACAGAGGTGGCTGG + Intergenic
915320041 1:155051477-155051499 GCCTGGAGTGGGTCGGGGGGCGG + Intronic
916496978 1:165355636-165355658 CCCAGGAGTGCGGTGGCTGCTGG - Intronic
916751011 1:167722463-167722485 TCCTGGAGTGCGGAGGAGGAGGG + Intronic
917837702 1:178953995-178954017 GCCTGGAGTGTGACGGGGCCAGG - Intergenic
918533581 1:185550047-185550069 GTCTGGAGTGAGGGGGCTGCAGG - Intergenic
919811916 1:201414224-201414246 GCATGGAGTGGGGAGGCGGCCGG - Intronic
919892040 1:201982705-201982727 GCGCGGAGTGCAGCGGCCGCCGG - Exonic
920351837 1:205343058-205343080 GGCTGGGGTGTGGCGGCGGGAGG + Intronic
921068940 1:211643043-211643065 GCCTGGAGGGTGGCAGTGGCTGG + Intergenic
921087731 1:211811715-211811737 GGCTGGAGTGCAGTGGCGGGTGG - Intronic
921229186 1:213051331-213051353 ACCTGGACCGCGGCGGCGCCGGG + Exonic
921472674 1:215567569-215567591 GCCAGCGGGGCGGCGGCGGCCGG - Exonic
922416486 1:225427624-225427646 GGCTGTGGAGCGGCGGCGGCAGG - Intronic
1064208983 10:13347835-13347857 GCCTGGAGAGGGGCAGCGCCGGG - Intronic
1066464217 10:35639480-35639502 GGCCGGGGGGCGGCGGCGGCGGG - Exonic
1067416354 10:46106239-46106261 GCCAGGAGAGCGGAGGCGGCGGG + Intergenic
1067436988 10:46285087-46285109 GCCTGGGGAGCGAAGGCGGCGGG - Intergenic
1071997485 10:91162730-91162752 GCCTGGCGGGCGGCGGCGAGAGG + Intergenic
1072336553 10:94403074-94403096 GGCTGGCGCGCGCCGGCGGCCGG + Exonic
1072719465 10:97771814-97771836 GCCATGCGGGCGGCGGCGGCGGG - Exonic
1072757376 10:98030227-98030249 GCTGGGGGTGAGGCGGCGGCCGG - Intronic
1074182579 10:111077295-111077317 TCCGGGACGGCGGCGGCGGCGGG - Exonic
1074618589 10:115093818-115093840 GGCCGGCGGGCGGCGGCGGCGGG + Exonic
1076648531 10:131971139-131971161 GCCGGGAGTGCGGCGCGGCCCGG - Intronic
1076655273 10:132019594-132019616 GCCTGGAGGGTGGGGGCCGCAGG + Intergenic
1076733099 10:132447905-132447927 CACTGGAGTGCGGAGGCCGCGGG - Exonic
1076830761 10:132993022-132993044 GCCTGGAGTCCGCCGGGGGCGGG - Intergenic
1077247711 11:1547455-1547477 GCCGGGAGGACGGCGGCTGCAGG - Intergenic
1077285572 11:1763852-1763874 GGCTGCATGGCGGCGGCGGCCGG + Exonic
1077289790 11:1783708-1783730 GCCTGGAGGGCAGGTGCGGCTGG - Intergenic
1078091676 11:8268200-8268222 GCCCGGGCTTCGGCGGCGGCGGG - Intronic
1080628604 11:34052490-34052512 TCCGGGAGTGAGGCGGCCGCGGG + Exonic
1081545192 11:44066609-44066631 GCCTGGGGTAGGGGGGCGGCGGG - Exonic
1081547142 11:44079510-44079532 GCCTGGAGTGAGGCAGGGGTGGG - Exonic
1081574372 11:44310063-44310085 GCCTGGCTTGCGCAGGCGGCGGG + Exonic
1082002364 11:47400246-47400268 GCCGGGCCTGCGGCGGGGGCTGG - Intergenic
1083033472 11:59615459-59615481 GCCGGGGGAGTGGCGGCGGCTGG - Exonic
1083451275 11:62747079-62747101 GGCTGGAGTGCAGCGGTGGCTGG - Intergenic
1083644747 11:64165786-64165808 GCGTGGGGGGCGGCGGCGGTGGG - Exonic
1083842850 11:65314757-65314779 GCCCGGAGTGGGGCGGGGCCTGG + Intergenic
1083952011 11:65961820-65961842 GCCGGGACGACGGCGGCGGCCGG + Exonic
1084086482 11:66857396-66857418 GCGGGGAGTGGGGAGGCGGCTGG + Intronic
1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG + Exonic
1084399584 11:68935955-68935977 GCCTGGGGTGTGGCTGCAGCTGG - Intronic
1084403014 11:68955998-68956020 GGCTGGGGTGGGGCGGGGGCAGG + Intergenic
1085197941 11:74683556-74683578 GCCTGGGCCGCGGGGGCGGCGGG - Intergenic
1085507114 11:77066952-77066974 GACTGGCCTGCGGCGGGGGCTGG - Exonic
1086993447 11:93330654-93330676 GGCGGGAGCGCGGCGGCGGGTGG + Intronic
1089622356 11:119729126-119729148 CCCGGCAGAGCGGCGGCGGCTGG - Intergenic
1089630193 11:119779622-119779644 GGATGGAGTGCGGCGGGGGCTGG - Intergenic
1089861923 11:121597502-121597524 GGCTGGAGTGCAGGGGCGGGTGG + Intronic
1090068980 11:123527175-123527197 GCGTGGGGTGGGGTGGCGGCAGG + Intronic
1090662215 11:128890663-128890685 CCCCGGCGTGCGGCGGCGGCTGG - Intergenic
1093465030 12:19440070-19440092 GCCTGGTGGGCAGCAGCGGCGGG + Exonic
1093466403 12:19453838-19453860 GGCTGGAGTGCGGTGGAGGCGGG + Intronic
1094624171 12:32107010-32107032 GCCCGGGCTGCGGCGGCCGCGGG - Intronic
1096024825 12:48351138-48351160 GCTTGGAGGGCGGCGGGCGCCGG + Intronic
1096134590 12:49188800-49188822 ACCCGCACTGCGGCGGCGGCGGG + Intronic
1096191589 12:49623495-49623517 GCCGGGAGGGCGGGGCCGGCGGG - Exonic
1096309176 12:50505191-50505213 GCCTGAAGTGCGGGCGCAGCTGG + Exonic
1098328474 12:69327210-69327232 GCCTGGAGTGCAGTGGCGCTTGG - Intergenic
1101680055 12:106955969-106955991 GCCTGGGCGGCAGCGGCGGCCGG - Exonic
1102251223 12:111388832-111388854 GGCTGGAGTGTGGTGGTGGCAGG - Intergenic
1102768311 12:115451999-115452021 GCCGGGCGGGTGGCGGCGGCAGG - Intergenic
1102933884 12:116881375-116881397 GGCTGGAGCGCGGCGGCAGCGGG - Exonic
1102997452 12:117361215-117361237 ACCCGGAGCGCGGCGGCCGCGGG - Intronic
1103716839 12:122950012-122950034 CCCTGGAGTGGGGCTGCGGTGGG - Intronic
1103915961 12:124375889-124375911 GCCTGCAGTGCCGCTGGGGCTGG + Intronic
1104983384 12:132583611-132583633 GCGCCGAGGGCGGCGGCGGCGGG - Exonic
1105011932 12:132761886-132761908 GCCTCGAGCGCGGCGCCGTCAGG - Exonic
1105295677 13:19086345-19086367 GCTTGGACTGGGGCGGGGGCGGG - Intergenic
1105409702 13:20161304-20161326 CCCCGGAGTGCGTAGGCGGCAGG - Intergenic
1106176671 13:27337843-27337865 GACTGGAGTGTGGCGACTGCAGG + Intergenic
1106735835 13:32586913-32586935 GCCGGGGCGGCGGCGGCGGCGGG + Intronic
1108201710 13:48050684-48050706 GCCTGGTGTGCGGTGGGGCCTGG - Intergenic
1112337356 13:98526069-98526091 GGCTGGAGTGCGGTGGAGGGAGG + Intronic
1112507149 13:99981963-99981985 GCCTGGAGCCCGGTGGCCGCCGG + Exonic
1114636187 14:24188312-24188334 GCCTGGGGTGGGGCGGGGCCAGG - Intronic
1115399191 14:32938950-32938972 GCATGGACGGCGGCGGCGCCGGG + Intronic
1115754659 14:36519253-36519275 GCATGGAGGGCGGCGGCCTCGGG - Exonic
1116658197 14:47675889-47675911 GCCTGGGGTTCGACGCCGGCCGG + Intergenic
1117156846 14:52950702-52950724 CTCGGGAGGGCGGCGGCGGCCGG + Intronic
1117875929 14:60249723-60249745 GCCTGCGCGGCGGCGGCGGCGGG + Intronic
1118310170 14:64686131-64686153 GCCTGGAGTGCAGCTGGGCCTGG - Intergenic
1119410282 14:74426091-74426113 GCGGGGCGGGCGGCGGCGGCGGG - Exonic
1121109599 14:91303429-91303451 GCCTGGAGAGAGGCGGGGTCTGG - Intronic
1121714726 14:96065464-96065486 TACTGGAGTGAAGCGGCGGCCGG - Intronic
1122364038 14:101183722-101183744 GCCTGGAGTGGGGTTGCTGCCGG - Intergenic
1123019790 14:105392289-105392311 GCCTGGAAGGAGCCGGCGGCTGG - Intronic
1123033982 14:105464315-105464337 GCCTGGCGGGTGGGGGCGGCCGG + Intronic
1202854838 14_GL000225v1_random:43721-43743 GCCTGTGGTGGGGCTGCGGCCGG + Intergenic
1202940288 14_KI270725v1_random:138324-138346 GCCGCGAGGGCGGCGGCGGGGGG + Intergenic
1123464708 15:20506458-20506480 GCCCGGAGCGCCGCGGCGGGTGG + Intergenic
1126163509 15:45634915-45634937 GCCTGGGCTGCGGCGCCGGGCGG + Exonic
1126746375 15:51829931-51829953 GCCTGGAGTCGGGCGGCCGGCGG - Intronic
1128529153 15:68432088-68432110 GTCCGGTGTGCAGCGGCGGCGGG + Exonic
1129227997 15:74180936-74180958 GCCTGGGGTGGGGTGGCGGATGG + Exonic
1129693132 15:77724938-77724960 TCCTGGGGTGGGGCGGTGGCCGG - Intronic
1132572683 16:650883-650905 CCCTGGGGTGGGGCGGTGGCTGG + Intronic
1132678367 16:1129989-1130011 GCCTGGAGGAAGGCGGGGGCAGG - Intergenic
1132779458 16:1614611-1614633 GCCGGGAGAGGGGAGGCGGCCGG - Intronic
1132893235 16:2214787-2214809 GGCCGGCGGGCGGCGGCGGCCGG - Exonic
1135964612 16:27025290-27025312 GGCTGGAGTGCAGTGGCGGCGGG - Intergenic
1136187656 16:28597521-28597543 GCCTGGAGTGCATGGGCTGCTGG - Intergenic
1136190134 16:28610501-28610523 GCCTGGAGTGCATGGGCTGCTGG - Intronic
1136540312 16:30924671-30924693 GCCTGGAGGGCGGCGACTGCAGG - Exonic
1136666763 16:31819473-31819495 CCCAGGAGCCCGGCGGCGGCGGG + Intergenic
1138185233 16:54971711-54971733 GCCTGGTGTGGGGCTGCAGCTGG + Intergenic
1139475885 16:67202376-67202398 GCCTGGAGTGGGGGGGCAGGAGG - Exonic
1139477292 16:67209014-67209036 GCCTGGACTGTGGCTGGGGCAGG + Intronic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141764991 16:86052269-86052291 GCCTGGAGTGCGCCAAAGGCAGG - Intergenic
1142206266 16:88784677-88784699 GCTGGAAGGGCGGCGGCGGCTGG - Intronic
1142636408 17:1260322-1260344 TCCAGGAGTGGGGCGGGGGCGGG - Intergenic
1144035186 17:11358708-11358730 GGCTGGAGTGCAGTGGCGGCGGG + Intronic
1144626512 17:16846863-16846885 GCCTGGAGTGGGGAGGGGGCTGG - Intergenic
1144879920 17:18425848-18425870 GCCTGGAGTGGGGAGGGGGCTGG + Intergenic
1145152313 17:20518536-20518558 GCCTGGAGTGGGGAGGGGGCTGG - Intergenic
1145305756 17:21674269-21674291 GCGGGGACTGGGGCGGCGGCGGG + Intergenic
1145327704 17:21844354-21844376 GCCCTCAGAGCGGCGGCGGCGGG - Intergenic
1145694523 17:26775729-26775751 GCCCTCAGTGCCGCGGCGGCGGG - Intergenic
1145950372 17:28812447-28812469 GGCTGGCTTCCGGCGGCGGCTGG - Intronic
1145962915 17:28897723-28897745 GCCGGAAGTGTGGCGGCGGAGGG + Intergenic
1146163659 17:30572739-30572761 GCCTGGAGTGGGGAGGGGACTGG - Intergenic
1146199508 17:30844173-30844195 GGCTGGAGTGCAGCGCCGGCGGG + Intronic
1146716213 17:35089104-35089126 GCCGGGAGGGCGGCCGCAGCAGG - Exonic
1147162979 17:38578703-38578725 CCCTGGGGGGCGGGGGCGGCGGG - Exonic
1147168660 17:38605854-38605876 GCTGGGAGGGCGCCGGCGGCCGG + Exonic
1147580653 17:41625550-41625572 GCCTGGAGTGGGAAGGGGGCTGG - Intergenic
1147738205 17:42654333-42654355 GGCTGGAGTGCAGTGGCAGCGGG + Intergenic
1147786305 17:42980825-42980847 GCGGGCAGAGCGGCGGCGGCTGG + Exonic
1148057761 17:44811433-44811455 GGCTGGAGTGCAGCGGCACCTGG + Intronic
1148782514 17:50129892-50129914 GCCTGGCGGGCGGCAGGGGCGGG - Intergenic
1150168408 17:62966388-62966410 GCGCGGAGGGCGGTGGCGGCGGG - Intergenic
1150323583 17:64237307-64237329 GACAGGAGTGCGGCAGGGGCTGG + Intronic
1150488889 17:65561299-65561321 GCCTGGAGGGGGGCGCGGGCGGG - Intronic
1150562059 17:66302778-66302800 GCCGGGTGGGCGGGGGCGGCGGG - Intronic
1150643449 17:66964574-66964596 ACCCGGAGCGCGGCGGCGGCGGG + Intergenic
1151670750 17:75570504-75570526 GCCTGAGGTGAGGCTGCGGCCGG + Intronic
1152231386 17:79115625-79115647 GCGTGGGGTGCGGTGGGGGCGGG + Exonic
1152303765 17:79509691-79509713 GCCTGGGGTGCGACGGCTGATGG - Intronic
1152321627 17:79611231-79611253 GGCTGGAGCGAGGCGGCAGCAGG + Intergenic
1152477487 17:80527509-80527531 GCCTGGAGTTCAGCAGCGTCAGG + Intergenic
1152617839 17:81346039-81346061 CCCCGGAGGGCGGCGGCCGCGGG - Intergenic
1152716267 17:81902242-81902264 GACTGGTGGGCGGCGGCGTCCGG - Exonic
1153051288 18:905462-905484 AACCGGAGTCCGGCGGCGGCAGG - Exonic
1153201971 18:2656024-2656046 GCCCTGAGCCCGGCGGCGGCAGG + Exonic
1155474802 18:26226955-26226977 GCCGGGGGAGCGGCGCCGGCGGG - Exonic
1157274045 18:46297750-46297772 GCCTGGGGTGGGGAGGGGGCGGG - Intergenic
1160674753 19:384068-384090 CCCTTGACTGCGGCGGCAGCTGG - Intergenic
1160730613 19:640160-640182 GCCTGGGGTGGGGAGGCGGCGGG + Intronic
1160810112 19:1009592-1009614 GCCAGGAATGAGGCGGCAGCCGG + Exonic
1160930463 19:1567638-1567660 GCCGGGGCGGCGGCGGCGGCGGG + Exonic
1161356062 19:3820180-3820202 ACCTGGAGTGGGGCGCTGGCGGG + Exonic
1161387832 19:4006251-4006273 GGCTGGAGTGCAGTGGCGCCAGG - Intergenic
1161420354 19:4173213-4173235 CCTTGGAGAGCGGCGGCGGGCGG + Intergenic
1161495359 19:4583438-4583460 GCCTGGGATGCTGGGGCGGCCGG - Intergenic
1162481391 19:10928894-10928916 GCCGGGAGTGTGGGCGCGGCTGG + Exonic
1162496784 19:11027763-11027785 GCCTGGAGTGTGGAGGAGGCAGG - Exonic
1163715491 19:18870183-18870205 GCCTGGAGCAGGGCGGCGGCTGG + Exonic
1163782508 19:19257865-19257887 GCTGGGCGGGCGGCGGCGGCTGG - Exonic
1164449096 19:28344482-28344504 GTCTGGAGTGAGGCGGCTCCGGG - Intergenic
1164639307 19:29812499-29812521 GCGCGGGGTGAGGCGGCGGCGGG - Intronic
1165420037 19:35718013-35718035 GCCAAGATGGCGGCGGCGGCGGG + Exonic
1165469986 19:35997668-35997690 GCCAGGAGTGAGGGGGTGGCAGG - Intergenic
1165941740 19:39417901-39417923 GCAGGAAGTGCAGCGGCGGCTGG + Exonic
1166219133 19:41353903-41353925 GCGCGAAGGGCGGCGGCGGCGGG + Exonic
1167081355 19:47278206-47278228 GGCTGGAGTGCAGTGGCGGTGGG + Intergenic
1167377497 19:49119698-49119720 GCCTGGTCCGCGGCGGCTGCGGG - Exonic
1167738686 19:51311715-51311737 GCCCGGGGGGCGGCGGGGGCGGG - Intergenic
1167741629 19:51327553-51327575 GCCTGGAGGGGGGCGGCGGTGGG + Intronic
1168311936 19:55464863-55464885 ACCTGGCGTGCGTCGGCGGGGGG + Intergenic
927714371 2:25342333-25342355 GCCGGGAGCGCGGCCGAGGCGGG - Intronic
927893586 2:26767467-26767489 GCCTGCTGTGCTGGGGCGGCAGG + Intronic
929049808 2:37826457-37826479 GACTGGAGTGAGGCTGCTGCAGG - Intergenic
929537491 2:42792716-42792738 GCCTGGAGTGGCGCGGAGGGCGG - Intergenic
929552713 2:42904576-42904598 GCTTGGAGTGGGGCAGGGGCAGG + Intergenic
929604692 2:43226638-43226660 CCCGGGAGTGCGGCTGCGGCGGG + Intergenic
929665615 2:43831784-43831806 GCCGGGATTGCCGCGGCGGATGG + Exonic
932780603 2:74556327-74556349 GCCTGAGGGGCAGCGGCGGCCGG - Exonic
934620353 2:95799723-95799745 GGCTGGAGTGGGGCGGAGGGTGG - Intergenic
934640539 2:96024842-96024864 GGCTGGAGTGGGGCGGGGGGTGG + Exonic
934933133 2:98444856-98444878 GCGTCTAGAGCGGCGGCGGCTGG + Exonic
935653132 2:105399002-105399024 GGCTGGAGGGCGCGGGCGGCTGG + Intronic
935820293 2:106886933-106886955 GGCTGGATGGAGGCGGCGGCCGG - Intronic
940828418 2:158439468-158439490 GCCTGTCGTGGGGTGGCGGCAGG + Intronic
941951495 2:171160834-171160856 GCCCGGGAGGCGGCGGCGGCGGG + Intronic
942278736 2:174340969-174340991 GCCTGGAGGTCGGTGGGGGCGGG + Intergenic
942454738 2:176130063-176130085 GCCGGGAGGGCGGCGGCGCGCGG + Exonic
944221687 2:197310302-197310324 TGCGGGAGTGCGGCGGCCGCGGG - Intronic
944423281 2:199553778-199553800 GGCTGGAGTGCAGTGGCGCCAGG - Intergenic
946250047 2:218406276-218406298 TCCTGGAATGCGGCGGGGGAGGG + Intergenic
946327792 2:218993622-218993644 GCCTGGGCTGCGGCGGGCGCGGG - Intergenic
946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG + Exonic
947636099 2:231681341-231681363 GCCCGGAGTGCGCCCGGGGCGGG - Intergenic
947719847 2:232363695-232363717 GCCTGGAGTGAGGCAGCTGCAGG - Intergenic
948154570 2:235771055-235771077 CCCAGGAGTGCGGCCGCCGCAGG + Intronic
948755890 2:240159403-240159425 GCATGGGGTGGGGCGGCAGCAGG - Intergenic
948783702 2:240340217-240340239 GCATGGAGTGGGGAGGGGGCCGG - Intergenic
1171123420 20:22583684-22583706 GTGCGGAGTGCGGGGGCGGCTGG + Intronic
1171123604 20:22584522-22584544 CCCGTGAGCGCGGCGGCGGCGGG - Intronic
1171175464 20:23048681-23048703 GCCTGCAGGGCGGCGCCGGCTGG + Exonic
1171531011 20:25853736-25853758 GCGGGGACTGGGGCGGCGGCGGG + Intronic
1173576520 20:44115858-44115880 GCCTGCAGCGGGGCGGTGGCCGG + Exonic
1173799300 20:45884966-45884988 GGCTGGAGTGCAGTGGCAGCAGG - Exonic
1174246926 20:49188394-49188416 GCCTGGAGGCGGGCGGGGGCCGG - Intergenic
1175248861 20:57597096-57597118 GCCTGGTGAGCGGCGGCCGGCGG + Intergenic
1175429526 20:58891679-58891701 GGCCGGGCTGCGGCGGCGGCGGG - Intronic
1175583680 20:60120500-60120522 GGCTGGAGTGCGGTGGCGTGCGG - Intergenic
1176099932 20:63360343-63360365 GGCTGGGGTGCGGAGGGGGCTGG - Intronic
1176179368 20:63742224-63742246 ACCTGGGGTGCGGCGGGGCCTGG + Exonic
1176194364 20:63830730-63830752 GGAGGGAGCGCGGCGGCGGCGGG + Intronic
1176582859 21:8548620-8548642 GCCGCGAGGGCGGCGGCGGGGGG - Intergenic
1177431696 21:20998284-20998306 GCGGGGAGGGCGGCGGGGGCGGG - Intergenic
1178314769 21:31558891-31558913 GCCTGGGGTGCGCGGGCGTCCGG - Intronic
1178487340 21:33027457-33027479 GCCGGGTGCGCGGTGGCGGCGGG - Exonic
1179522291 21:41953474-41953496 GCCTGGAGAGGGGCCGCGCCCGG - Exonic
1179525979 21:41976076-41976098 CCCTGGAGAGCGGCGGCTGGAGG - Intergenic
1180265690 22:10525667-10525689 GCCGCGAGGGCGGCGGCGGGGGG - Intergenic
1180985392 22:19901191-19901213 GCCTGGATTGGAGCGGGGGCAGG + Intronic
1181130544 22:20729082-20729104 GCCTGGGGTGCTGCAGCAGCTGG - Intronic
1181831672 22:25564961-25564983 GCGCGGCGGGCGGCGGCGGCGGG + Exonic
1182577196 22:31280958-31280980 GGCTGGAGTGCGGCAGGGGTTGG - Intergenic
1182623506 22:31630444-31630466 GCCTGCAGTGAGGCGGCTGCAGG - Intronic
1183493146 22:38127407-38127429 GCCTGGGGTGCGGCGTCAGATGG - Intronic
1184160311 22:42693721-42693743 GCCTGGAGTGGGGCCGTGGGAGG + Exonic
1184276608 22:43412340-43412362 GCCTAGCGGGCGGCGGCGGGAGG + Intronic
1184557391 22:45240744-45240766 GGCTCGGGGGCGGCGGCGGCGGG + Intronic
1184714166 22:46271285-46271307 GGCTGGAGTGCAGTGGCGCCTGG + Intronic
1184737246 22:46406539-46406561 GGTTGGAGTGTGGCGGGGGCAGG - Intronic
950099084 3:10346252-10346274 GCCTGGATGGAGGGGGCGGCTGG - Intronic
952223454 3:31349244-31349266 GGCTGGAGTGCAGTGGCAGCTGG - Intergenic
952451858 3:33440334-33440356 GCCGGCAGAGCGGCGTCGGCGGG - Exonic
953518765 3:43621908-43621930 ACGTGGAGCGCTGCGGCGGCTGG - Exonic
954194897 3:48990621-48990643 GCCTGGAGCGCGGCGGGGCAGGG - Intronic
954217789 3:49133905-49133927 GCCGGGACTGTGGAGGCGGCAGG - Intergenic
955387685 3:58492284-58492306 TCCTGGAACGGGGCGGCGGCGGG + Intronic
959864488 3:111250768-111250790 GCCGGGAGTGAGGGGGAGGCAGG - Intronic
960364012 3:116748829-116748851 GCCTGTCGTGCGGTGGTGGCAGG + Intronic
961827508 3:129606697-129606719 GCCGGGAGCCCGGAGGCGGCGGG + Exonic
961827607 3:129606938-129606960 TCCTGGAGGGCGCGGGCGGCGGG - Intergenic
962804153 3:138915363-138915385 GCTGGGAGTGCAGCGGCGGGCGG + Intergenic
962808880 3:138945722-138945744 GCCGGGGGCGCGGCGGTGGCTGG + Exonic
968010410 3:195270774-195270796 GCTTGGAGGGCGGCGGTGCCGGG - Exonic
968323508 3:197791717-197791739 GCCTGGGGAGAGGCGGCGGGCGG + Intronic
968659641 4:1793710-1793732 CCCTGGGCGGCGGCGGCGGCGGG + Intronic
968724860 4:2242082-2242104 GCACGGAGGGCGGTGGCGGCGGG - Exonic
968850262 4:3073931-3073953 GCCTGGAGCGGGGCGACAGCCGG - Intergenic
969413121 4:7042668-7042690 GCCTGGAGAGCCGGGGAGGCCGG - Exonic
971279992 4:25234577-25234599 GCCCGCGGTGCGGCTGCGGCTGG - Intronic
973551283 4:52038269-52038291 GCGGGGAGCTCGGCGGCGGCGGG - Exonic
973684379 4:53354413-53354435 GCCTGCACTGCGGCGCTGGCAGG - Intronic
976102902 4:81584335-81584357 GACTGGAGTGAGGCGGCGTTGGG - Intronic
976390017 4:84497706-84497728 GCCCGGGCGGCGGCGGCGGCGGG + Exonic
978351520 4:107825024-107825046 GCCTCGGGGGCGGCGGCCGCGGG + Intronic
980043629 4:127965543-127965565 GCCTGGAGAGCGGCGGTGCTGGG + Exonic
981057037 4:140373789-140373811 GCCTGGAGGGCGGGGCGGGCTGG + Intronic
985495642 5:203472-203494 CCCTTGAGCGCGGCGGAGGCGGG - Exonic
992515976 5:77492442-77492464 GCTTGGGGTGCGGCGGCCGACGG + Exonic
994072731 5:95620469-95620491 GCCGCCTGTGCGGCGGCGGCGGG + Exonic
994508665 5:100675153-100675175 GCCTGGAAGGCGGAGGCTGCAGG - Intergenic
996121240 5:119674762-119674784 GCCTGTTGTGGGGTGGCGGCAGG - Intergenic
997345744 5:133190755-133190777 TACTGGAGTGCGGGGGCGGGCGG - Intergenic
997975459 5:138439238-138439260 GGTGTGAGTGCGGCGGCGGCGGG + Exonic
998157560 5:139795473-139795495 GCCTGGAGGGCGGAGGTGGTTGG + Intergenic
998203942 5:140146064-140146086 GGCTGGTCTGCGGCGGCGGAGGG - Intergenic
998814609 5:146000237-146000259 CCCTGCAGAGCGGGGGCGGCTGG - Exonic
1001850373 5:174958788-174958810 GCCTGTAGTGGGGCGGGGGCTGG + Intergenic
1002099229 5:176849082-176849104 GGCTGGAGTGTGGCGGCAGCGGG + Intronic
1002187199 5:177459882-177459904 GGCTGGTGTGAGGCTGCGGCTGG - Intronic
1002897944 6:1389999-1390021 GCCTGGAGCGCGCCGGGGACCGG - Exonic
1003929223 6:10907311-10907333 CCCTGGAGTGCAGTGGTGGCTGG - Intronic
1004193741 6:13486659-13486681 GTCTGGTGAGGGGCGGCGGCAGG + Exonic
1004561989 6:16760629-16760651 GCCGGGTGTGCGGCTGCGGGCGG - Intronic
1006396037 6:33788498-33788520 GCCTGAGGTGGGGCGCCGGCTGG - Exonic
1006634415 6:35452134-35452156 GCCTGGAGCGGGGCGGGGGCGGG - Intergenic
1013231736 6:108166673-108166695 AGCTGGAGAGCGGCGGCGCCCGG + Intronic
1013272686 6:108558635-108558657 GCCCGGAGCCCGGAGGCGGCTGG + Intergenic
1014724951 6:124962561-124962583 GCACGGTGAGCGGCGGCGGCGGG + Exonic
1014798065 6:125748430-125748452 GCCGGGAGACTGGCGGCGGCTGG - Intronic
1015965716 6:138693479-138693501 GCCGGGAGGGCGGAGGCGCCAGG + Intergenic
1017103166 6:150865960-150865982 GCTTGGACAGCGGCGGCCGCAGG + Exonic
1018613054 6:165662157-165662179 GCCGGGGCGGCGGCGGCGGCCGG + Intronic
1018876655 6:167827300-167827322 GGCTGGCGGGCGGCGGCGGGGGG - Intronic
1019455133 7:1123006-1123028 GCCTGGAGTGCTGGGGAGGTGGG - Intronic
1019531302 7:1504699-1504721 TCCCGGAGAGCGGGGGCGGCCGG + Intergenic
1019875159 7:3803792-3803814 GGCTGGAGTGCAGTGGTGGCTGG + Intronic
1021452774 7:20798054-20798076 GCCCGGGCTGCGGCGGCCGCGGG + Intergenic
1022989590 7:35694820-35694842 GCGCGGAGGGCGGCGGTGGCGGG - Exonic
1023000314 7:35801414-35801436 GCCCGGGGCGCGGCAGCGGCGGG + Intronic
1023260692 7:38355030-38355052 GCCTGTAGTGGGGTGGGGGCAGG + Intergenic
1023382757 7:39624170-39624192 GCGGGGACTGCGGCGGCAGCGGG - Intronic
1023638778 7:42237871-42237893 GCGAGGCGGGCGGCGGCGGCTGG + Intergenic
1023879392 7:44309613-44309635 GGCTGGAGTGCGGTGGGGTCGGG + Intronic
1023972287 7:45000230-45000252 GCCGGGAGCGCGGGGGCGGCGGG + Intronic
1024089225 7:45921526-45921548 GCCTGGAGTGCCGGGGTGGCCGG - Intronic
1025089726 7:56052021-56052043 GCCAGGAGCGCGGCGGCGCGCGG - Intronic
1025917040 7:65873705-65873727 GCCAGGCGGGGGGCGGCGGCGGG + Intronic
1026047976 7:66921248-66921270 GCCCGAACTGAGGCGGCGGCGGG + Exonic
1026765056 7:73155089-73155111 GCGCGGGGGGCGGCGGCGGCCGG - Intergenic
1027041529 7:74964844-74964866 GCGCGGGGGGCGGCGGCGGCCGG - Exonic
1027082113 7:75237525-75237547 GCGCGGGGGGCGGCGGCGGCCGG + Intergenic
1029123103 7:98281472-98281494 GTCTAGAGAGCAGCGGCGGCGGG + Intronic
1029390694 7:100272071-100272093 GCGCGGGGGGCGGCGGCGGCCGG + Exonic
1029425920 7:100493927-100493949 GCCTGGACTGGGGAGGGGGCGGG + Exonic
1030598030 7:111562426-111562448 GCCCGGCGTCCGGCGGCGGGTGG - Intronic
1033644197 7:143288314-143288336 GCCTGGTGTGTGGGCGCGGCAGG + Exonic
1034447863 7:151122613-151122635 GCCTGGGGAGCGGCGGCAGCGGG - Intronic
1034448589 7:151125837-151125859 GCTGGGAGGGAGGCGGCGGCGGG + Intronic
1034659938 7:152760061-152760083 GCTTGGAGGGAAGCGGCGGCCGG - Intronic
1034891928 7:154847821-154847843 GGCTGAAGTGAGGGGGCGGCAGG - Intronic
1034895880 7:154876041-154876063 GCACGAAGTGAGGCGGCGGCTGG + Exonic
1035724606 8:1816839-1816861 GCCGCGAGTGCGTGGGCGGCAGG - Intergenic
1036661766 8:10713882-10713904 GCCTGGTGTGAGGCTGCTGCTGG - Intergenic
1036802736 8:11804648-11804670 GGCTGGAGTGCAGTGGTGGCGGG + Intronic
1038241727 8:25815616-25815638 GCCTGTAGTGAGGCTGAGGCAGG + Intergenic
1038319595 8:26514556-26514578 GCCGCGAGTACGGCGGCTGCGGG - Intronic
1038429054 8:27485241-27485263 GCCAGGCGTGCGGTGGGGGCAGG + Intergenic
1038644031 8:29348848-29348870 GCGCGGAATGCGGCGGCGGGAGG + Intronic
1039066762 8:33615482-33615504 GGCTGGAGTGCAGTGGAGGCAGG - Intergenic
1039542304 8:38382246-38382268 GCTTTGTGCGCGGCGGCGGCGGG - Exonic
1039921480 8:41896832-41896854 GCTCGTACTGCGGCGGCGGCGGG + Intergenic
1040305354 8:46209082-46209104 GCCTGGCGTGGGTGGGCGGCAGG + Intergenic
1041906440 8:63038578-63038600 AGCTGGAGCGCGGCGGCGGGAGG + Intronic
1042040219 8:64581386-64581408 GCCTGGGCGGCGGCGGCGGCGGG + Exonic
1042190046 8:66177315-66177337 GCTCGGACTGCGGCGGCGGCTGG + Exonic
1044340416 8:91040745-91040767 GCCATGACTGCGGCAGCGGCGGG + Exonic
1045336109 8:101205597-101205619 GGCGGGCGCGCGGCGGCGGCGGG - Intronic
1045489072 8:102655696-102655718 GCGCTGAGCGCGGCGGCGGCGGG - Exonic
1046547432 8:115669110-115669132 TCCCGGCGGGCGGCGGCGGCGGG - Intronic
1048364422 8:133725996-133726018 GGCTGGAGTGCAGTGGCAGCAGG - Intergenic
1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG + Exonic
1049606554 8:143532305-143532327 GGCTGAAGTGCGGCGGGGGAGGG + Intronic
1049654024 8:143789874-143789896 GCCTGGCATGGGGCGCCGGCTGG + Intergenic
1057605703 9:96496636-96496658 GCCTGGATTGCGGGGTCAGCCGG - Intronic
1057995589 9:99819902-99819924 GCCGGGAGTGCGGAGGGGGCGGG - Intergenic
1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG + Exonic
1061265185 9:129500690-129500712 GCCTGGGGTGCGGCTGGGGAGGG - Intergenic
1061275792 9:129568902-129568924 GCCTGGGGGGCGGCGGGGGCGGG - Intergenic
1061883492 9:133579339-133579361 GGTTGGAGTGCAGCGGGGGCAGG + Exonic
1062169417 9:135126707-135126729 GCATGGAGTAGGGCGGCGGAGGG + Intergenic
1062272222 9:135714759-135714781 TCCGGGCGTGCGGCGGCGCCGGG - Intronic
1062289910 9:135789822-135789844 GCCTGGGGTGGGGCAGGGGCTGG - Intronic
1062306148 9:135907906-135907928 GGGTGGAGTGGGTCGGCGGCGGG + Intergenic
1062571760 9:137189009-137189031 GGCAGGAGCGCGGCGGCGGAGGG - Intronic
1062718142 9:138021449-138021471 GCCTGGGGTGGGCCGGCTGCAGG + Intronic
1203788378 EBV:140766-140788 CCCTGGAGCTCGGGGGCGGCCGG + Intergenic
1186857805 X:13642477-13642499 GCCTGTCGTGGGGCGGGGGCAGG + Intergenic
1190108321 X:47574173-47574195 GCCTGGCGTGTGGGGCCGGCTGG + Exonic
1190789387 X:53684797-53684819 GCCTGCAGTGCGGCGAGGGAAGG - Intronic
1190881687 X:54496129-54496151 GCCTGGGTCTCGGCGGCGGCGGG + Exonic
1191840280 X:65508847-65508869 GCCTGGAGTGCGGTGGAGGGTGG - Intergenic
1192146138 X:68684239-68684261 GCCTGGAGTGGGGAGGTGGTGGG + Intronic
1194226056 X:91259321-91259343 GGCTGGAGTGCAGTGGTGGCAGG + Intergenic
1195306215 X:103586090-103586112 GGCTGGGGTGCGGCGGAGGTAGG + Exonic
1195704683 X:107730324-107730346 GCCTGGAGTGCAGCTGGGCCTGG - Intronic
1196732891 X:118958884-118958906 GGCTGGAGTGCTGCAGTGGCAGG - Intergenic
1198886189 X:141340910-141340932 GCCTGGCATGGGGCGGCAGCAGG + Intergenic
1199772731 X:150984354-150984376 GACGGGCGGGCGGCGGCGGCGGG + Intronic