ID: 1060979945

View in Genome Browser
Species Human (GRCh38)
Location 9:127786065-127786087
Sequence GCCTGGAGTGCGGCGGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060979927_1060979945 28 Left 1060979927 9:127786014-127786036 CCGCGAGGCCGGAAGTGGCCGTG 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG 0: 1
1: 0
2: 1
3: 38
4: 349
1060979931_1060979945 20 Left 1060979931 9:127786022-127786044 CCGGAAGTGGCCGTGGAGGCGGA 0: 1
1: 0
2: 0
3: 15
4: 126
Right 1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG 0: 1
1: 0
2: 1
3: 38
4: 349
1060979933_1060979945 10 Left 1060979933 9:127786032-127786054 CCGTGGAGGCGGAAGTGGCGCGG 0: 1
1: 0
2: 0
3: 22
4: 694
Right 1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG 0: 1
1: 0
2: 1
3: 38
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060979945 Original CRISPR GCCTGGAGTGCGGCGGCGGC GGG Exonic