ID: 1060980196

View in Genome Browser
Species Human (GRCh38)
Location 9:127787156-127787178
Sequence AAGTTGTACTAGAGCTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060980196_1060980200 15 Left 1060980196 9:127787156-127787178 CCATCTTAGCTCTAGTACAACTT 0: 1
1: 1
2: 0
3: 9
4: 108
Right 1060980200 9:127787194-127787216 TTGCGTAATGTGCATTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060980196 Original CRISPR AAGTTGTACTAGAGCTAAGA TGG (reversed) Intronic
901963872 1:12850059-12850081 AAGTTGATATAGAGTTAAGAGGG - Intronic
901991505 1:13118167-13118189 AAGTTGGTGTAGAGGTAAGAGGG - Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
909227215 1:73041308-73041330 TAGTTATTCTAGAGCTAGGAAGG - Intergenic
915091002 1:153426141-153426163 AAGGATTACTTGAGCTAAGAAGG + Intergenic
915123013 1:153643770-153643792 AAGATGAAGTAGAGTTAAGAGGG + Intronic
916860532 1:168799651-168799673 AATTTTTACTACAGCCAAGAAGG + Intergenic
918050776 1:180970861-180970883 AAGTTGTCCTTTATCTAAGAAGG + Intergenic
921410277 1:214828846-214828868 AAGTTGTTTTAGATCTTAGATGG - Intergenic
922704322 1:227781010-227781032 AATTTATAGTACAGCTAAGAAGG - Exonic
1067353263 10:45497200-45497222 AAATTTTACTAGAGCTAAAGAGG + Intronic
1074807845 10:117071863-117071885 AAATTGTATTTGAGCTAACAAGG + Intronic
1080824459 11:35836213-35836235 AAGTATTCCTAGAGCTAAAAAGG + Intergenic
1081884168 11:46480542-46480564 ATGTTGATCTAGAGCAAAGAAGG - Intronic
1084585105 11:70055424-70055446 AAATTTTACTAGAGATAAAAAGG - Intergenic
1086770567 11:90759973-90759995 TAGCTATACTAGAGATAAGAAGG + Intergenic
1087284874 11:96254707-96254729 AAGTCGTTCCAGAGCAAAGATGG + Intronic
1093407688 12:18825100-18825122 CATTTTTACTAGAGCTAAGATGG + Intergenic
1093423768 12:19004432-19004454 AAGTGGAACTAGGGCGAAGAGGG - Intergenic
1100958908 12:99940798-99940820 AAGTGGGACCAGAGCTTAGAGGG + Intronic
1101538234 12:105640406-105640428 TTCTTGTGCTAGAGCTAAGAGGG - Intergenic
1103662242 12:122529828-122529850 AAATGGAACTAGAGCTATGATGG - Intronic
1107616950 13:42179714-42179736 AGGTTGTACTAGAGCTAAGATGG + Intronic
1109205265 13:59476271-59476293 AAGTTGTATTTGAACTAAAACGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113875176 13:113589762-113589784 AAGTTGTTCTAGAGCTGGGCTGG + Intronic
1115102438 14:29718788-29718810 AAGTAGTAGTAGGGCTGAGAAGG + Intronic
1116023194 14:39485846-39485868 AAATTATACTAGCACTAAGACGG + Intergenic
1120408101 14:84114979-84115001 AAGTTTTACTAGAGATAAAGAGG + Intergenic
1126269289 15:46794428-46794450 AAGTAGTACTATTGTTAAGATGG + Intergenic
1127311217 15:57753810-57753832 AAGTAGTACTGGAGCTGAGGCGG + Intronic
1129308243 15:74684727-74684749 AAGTCCTACTAGAACTAATAAGG + Intronic
1133690361 16:8208502-8208524 AACTTGTAATAAAGCTATGATGG + Intergenic
1140703549 16:77604992-77605014 AAGCTGCTCTGGAGCTAAGAAGG - Intergenic
1146822249 17:35992877-35992899 AAATTGTCCTAGACCTAAGTAGG - Intronic
1153404840 18:4725978-4726000 AAGTTGTTCTAAAGCAAACAAGG + Intergenic
1157884499 18:51353376-51353398 AAGATGTAATAGATCAAAGATGG - Intergenic
1158077092 18:53543284-53543306 AATTTTTACTAGACCTGAGAAGG - Intergenic
1159535108 18:69705203-69705225 AAGTTGTAGTAGAGATCTGAAGG + Intronic
1161689807 19:5725088-5725110 AAGTGGGAATAGAACTAAGATGG + Intronic
1168261996 19:55200584-55200606 CAGTTGAACAAGAGCTAAGATGG - Intronic
925867314 2:8240147-8240169 AAGTTGTAGTATAGCTGAGATGG - Intergenic
927674273 2:25093046-25093068 AAGTTTTTCTGGAGCTGAGAGGG - Exonic
928653265 2:33423763-33423785 AAGTTATACTAGATTTAAGGTGG - Intergenic
929041835 2:37751798-37751820 AAGTTGTAAAAGTGTTAAGAAGG - Intergenic
929441477 2:41968601-41968623 AATTTGTCCTAGAGGGAAGAGGG - Intergenic
932720348 2:74134292-74134314 CAGTTGTATCAGAGCTGAGAAGG - Intronic
935023565 2:99254986-99255008 AAGTTTTACAAGACATAAGAAGG + Intronic
937941367 2:127288635-127288657 AAGTGGTACCAGAGTTAAGAAGG - Intronic
937980960 2:127615129-127615151 AAGATGGACCAGTGCTAAGATGG + Intronic
938324420 2:130388829-130388851 CATTTGACCTAGAGCTAAGATGG - Intergenic
939070696 2:137537953-137537975 AAGTTGTAGTACAGTTAAGGAGG + Intronic
940405757 2:153300027-153300049 CAGCTGTTCTAGAGCTCAGAAGG + Intergenic
941981157 2:171458779-171458801 AAGTTATAAGAGAGCTAAGATGG - Intronic
942723277 2:178977917-178977939 AAGTCCTCCTAGACCTAAGAAGG - Intronic
943172880 2:184426503-184426525 AAGTTCTACTAGAGCTAAATTGG + Intergenic
946576175 2:221077963-221077985 AAATTGAATTAGGGCTAAGAAGG - Intergenic
946837547 2:223787432-223787454 AAGGTGTTCTTGAGTTAAGAAGG + Intronic
1168736284 20:140522-140544 AAATACTACTAGACCTAAGAGGG + Intergenic
1181093359 22:20489396-20489418 AAGTTGGACTAGAGGTGGGAGGG - Intronic
1183040743 22:35175989-35176011 AAATTTGACAAGAGCTAAGAAGG + Intergenic
1203294048 22_KI270736v1_random:23318-23340 AAGTTGTAAAAGTGTTAAGAAGG - Intergenic
949119262 3:366057-366079 AAGTTGTCCTGGAGTAAAGATGG + Exonic
952078128 3:29723525-29723547 CAGTTTAAATAGAGCTAAGAAGG + Intronic
960157069 3:114306953-114306975 GAGTTGGACTAGAAGTAAGAGGG + Intronic
964950706 3:162288970-162288992 AAGTAGTTCTAGAGATAAAATGG + Intergenic
965152415 3:164995681-164995703 AAGGAATACTAGAGCTGAGATGG - Intronic
967075134 3:185994980-185995002 AAGTTGTACAGGAGTTACGATGG + Intergenic
974690767 4:65294475-65294497 AGCTTATACTAGAGCAAAGAAGG + Intergenic
976437894 4:85039986-85040008 AATTTGGACTAGAGCTGAGAAGG + Intergenic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
978562349 4:110046462-110046484 AAGTTGTTCTAGAAGTTAGATGG - Exonic
981310407 4:143292745-143292767 ATGTAGTATTAGAGCTCAGAGGG + Intergenic
984906682 4:184634078-184634100 AAGCTGTAGTAGATCTAAGGTGG - Intronic
987704393 5:21444679-21444701 AAGTTGTACTAGAGGGGAAAGGG - Intergenic
988898720 5:35707952-35707974 AATTTATACAAGAGTTAAGATGG - Intronic
991468504 5:66941467-66941489 CAATTCTACGAGAGCTAAGAGGG - Intronic
991723180 5:69513100-69513122 AAGTAGTAAGAGAACTAAGAGGG - Intronic
993348510 5:86817224-86817246 AAGTTATATTAAAGTTAAGATGG - Intergenic
995095001 5:108225428-108225450 AAGTTGTACTGGAGTGAAGTGGG + Intronic
996942337 5:129023220-129023242 AAGTTTTAATAGAACTAAAATGG - Intronic
997116482 5:131130822-131130844 AAGTTTCACTAGAGCCCAGAAGG + Intergenic
997931785 5:138078402-138078424 AAGTTGCAGAAGAGCTGAGAGGG - Intergenic
1008004551 6:46396776-46396798 TGGTTGTAATAGAGATAAGAAGG - Intronic
1009931171 6:70179069-70179091 AAGATGTGTTAGAGCTGAGAAGG - Intronic
1010824601 6:80456859-80456881 AAGATGTACTAGTCCTAAGAAGG - Intergenic
1011507389 6:88061349-88061371 AGGTTGTACTAGAGCAGAGTGGG + Intronic
1012533267 6:100264237-100264259 AAGTTGTATTGGAGCCAGGAGGG - Intergenic
1016102363 6:140118288-140118310 GAATTCTACTAGAGGTAAGAAGG + Intergenic
1016109772 6:140208257-140208279 AAATTGTAGTAGAGTTAAAAAGG - Intergenic
1018041955 6:159932607-159932629 AGGTTATTCTTGAGCTAAGAAGG + Intergenic
1018567119 6:165165882-165165904 AAGTTGTTCTAGTGCAAAGTTGG - Intergenic
1020153043 7:5698257-5698279 CAGTTGTACTGGAGCAAGGAGGG + Intronic
1020624854 7:10565438-10565460 AAGTGGTACTAGAGATAAACAGG + Intergenic
1024316495 7:48023787-48023809 AAGATTTACTACTGCTAAGATGG + Intronic
1027861186 7:83584101-83584123 AAGTTCTACTCCAGGTAAGAAGG + Intronic
1029021633 7:97370566-97370588 AGCTTGCAGTAGAGCTAAGATGG + Intergenic
1030031089 7:105370203-105370225 GAGATGTAGTAGAGATAAGATGG - Intronic
1031038780 7:116817061-116817083 GAGTTGAACTAGAGTCAAGAGGG + Intronic
1031102522 7:117499935-117499957 AAGATGAACTAGAGGTGAGAGGG + Intronic
1032232671 7:130088953-130088975 AAGTTTTACTGGAGATAAAAAGG + Intronic
1032369775 7:131336201-131336223 AAGTGTTACTAGAGATAAAAAGG - Intronic
1035108698 7:156462823-156462845 GCGATGAACTAGAGCTAAGATGG - Intergenic
1037772362 8:21810074-21810096 AAGTTCTACTTGAGCTGAGCTGG - Intronic
1040484936 8:47861193-47861215 GAGCTGTACCAGAGCTGAGATGG - Intronic
1046375488 8:113374427-113374449 AATTTTTTCTAGAGATAAGAAGG + Intronic
1047566429 8:126048520-126048542 AAGTTGTACTGTATCAAAGACGG - Intergenic
1050308766 9:4331971-4331993 AAGTTGAAGAAGAGCTAGGAAGG - Intronic
1055130069 9:72765165-72765187 AAGTTGCCCTAGAGGTAAAATGG - Intronic
1057503831 9:95616661-95616683 AAGTTGTAGGAGAGGTGAGAGGG - Intergenic
1060980196 9:127787156-127787178 AAGTTGTACTAGAGCTAAGATGG - Intronic
1061635081 9:131902746-131902768 AAGTTGTTATAGCCCTAAGAGGG + Intronic
1062156478 9:135051616-135051638 CAGTTGTAGTAGAGCTCAGAAGG - Intergenic
1202799263 9_KI270719v1_random:159774-159796 AAATTGTACTGGTGCTAAAAAGG + Intergenic
1193261292 X:79409472-79409494 AAGTTGTACTCTATCTAAAAAGG + Intergenic
1193955819 X:87860763-87860785 AAGTTGTACTATAATGAAGAGGG + Intergenic
1196286701 X:113890247-113890269 AAGGTTTACTAGAGATAAAAGGG - Intergenic
1199162365 X:144628370-144628392 AACTTGTGCTTGAGCAAAGAAGG + Intergenic
1201185542 Y:11398789-11398811 CAGATTTACTAGAACTAAGAGGG + Intergenic