ID: 1060980423

View in Genome Browser
Species Human (GRCh38)
Location 9:127788530-127788552
Sequence GCTCTTCTTCCCAGGGGAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 589}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060980413_1060980423 6 Left 1060980413 9:127788501-127788523 CCCTCGGGCTCAAGGGGCCCTCC 0: 1
1: 0
2: 3
3: 43
4: 552
Right 1060980423 9:127788530-127788552 GCTCTTCTTCCCAGGGGAGCGGG 0: 1
1: 0
2: 2
3: 48
4: 589
1060980414_1060980423 5 Left 1060980414 9:127788502-127788524 CCTCGGGCTCAAGGGGCCCTCCT 0: 1
1: 0
2: 9
3: 135
4: 1238
Right 1060980423 9:127788530-127788552 GCTCTTCTTCCCAGGGGAGCGGG 0: 1
1: 0
2: 2
3: 48
4: 589
1060980409_1060980423 16 Left 1060980409 9:127788491-127788513 CCTCAGGAGGCCCTCGGGCTCAA 0: 1
1: 0
2: 2
3: 10
4: 135
Right 1060980423 9:127788530-127788552 GCTCTTCTTCCCAGGGGAGCGGG 0: 1
1: 0
2: 2
3: 48
4: 589
1060980405_1060980423 30 Left 1060980405 9:127788477-127788499 CCTGGGGCATTGAGCCTCAGGAG 0: 1
1: 0
2: 2
3: 17
4: 162
Right 1060980423 9:127788530-127788552 GCTCTTCTTCCCAGGGGAGCGGG 0: 1
1: 0
2: 2
3: 48
4: 589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060980423 Original CRISPR GCTCTTCTTCCCAGGGGAGC GGG Exonic
900096147 1:940911-940933 GCTCTTCCCCGAAGGGGAGCCGG - Intronic
900203424 1:1421123-1421145 GCTCTGTTACCCAAGGGAGCTGG + Exonic
900910526 1:5594087-5594109 GCTCTTCTTCCCAGGAGTGTGGG + Intergenic
901818922 1:11813096-11813118 ACTCTTCTTCACAGGGGAAGGGG - Intronic
901907459 1:12426256-12426278 GCTCTGCTTCCCAGGCCAGGCGG - Intronic
902421772 1:16286385-16286407 CACCTTCTTCCCAGGGCAGCAGG + Intronic
903627800 1:24744137-24744159 TCTCTTTTTCCCAGAGGATCTGG + Intergenic
904407287 1:30300651-30300673 GCACCTCTTCACAGGGCAGCAGG + Intergenic
906148881 1:43576253-43576275 GCTCTTCTGTCTAGGGAAGCCGG - Intronic
906540231 1:46579730-46579752 GCTCTTCTTCCATGTGGAGAGGG + Intronic
906692896 1:47804406-47804428 GCTCTCCTTCCCTGGGGGCCTGG + Intronic
906715657 1:47966503-47966525 ACTCCTCTTCCCAGGTGGGCTGG - Intronic
906864424 1:49401186-49401208 GCACCTCTTCACAGGGCAGCAGG + Intronic
907135640 1:52137114-52137136 GCACCTCTTCACAGGGCAGCAGG - Intergenic
907161130 1:52370164-52370186 GCACCTCTTCACAGGGCAGCAGG - Intergenic
907785717 1:57610658-57610680 GCACCTCTTCACAGGGCAGCAGG + Intronic
908155290 1:61346871-61346893 GCACCTCTTCACAGGGCAGCAGG + Intronic
909129467 1:71716100-71716122 GCACCTCTTCACAGGGCAGCAGG + Intronic
909259802 1:73472906-73472928 GCACTTCTTCACAGGTTAGCAGG + Intergenic
909559853 1:76998029-76998051 GCACCTCTTCGCAGGGCAGCAGG - Intronic
909756919 1:79238996-79239018 GCACCTCTTCACAGGGCAGCAGG + Intergenic
910327408 1:86026516-86026538 GCACTTCTTCACAGGGTGGCAGG - Intronic
910752146 1:90643563-90643585 GTCCTTCTTCACAGGGCAGCAGG + Intergenic
910916609 1:92296403-92296425 GCACCTCTTCACAGGGCAGCAGG + Intronic
910962786 1:92780187-92780209 GCACCTCTTCACAGGGGAACAGG - Intronic
911205397 1:95087124-95087146 ACTCTTCTTCCTAGGGGAAGAGG - Intergenic
911824935 1:102470805-102470827 GCACCTCTTCACAGGGCAGCAGG + Intergenic
911968450 1:104398179-104398201 GCACTTCTTCACAGAGAAGCAGG - Intergenic
912815018 1:112822032-112822054 GCTCTACTTCCAAAGGAAGCTGG - Intergenic
913059597 1:115192845-115192867 GCACCTCTTCACAGGGCAGCAGG - Intergenic
913094349 1:115502395-115502417 GCACCTCTTCACAGGGTAGCAGG - Intergenic
914671983 1:149877818-149877840 TCTCATCTGCCCAGAGGAGCTGG + Intronic
915280102 1:154816617-154816639 GCACTTCCTCCCAGGGGTACTGG + Intronic
915697526 1:157759172-157759194 GTCCTTCTTCACAGGGTAGCAGG - Intronic
915818252 1:158992976-158992998 GCACCTCTTCACAGGGCAGCAGG - Intergenic
916233038 1:162559245-162559267 GCACCTCTTCACAGGGCAGCAGG - Intergenic
916749774 1:167713798-167713820 GCTCTTCTGCTCAGAGGAGCGGG - Intergenic
917240551 1:172943412-172943434 GCACCTCTTCACAGGGCAGCAGG - Intergenic
917569971 1:176255046-176255068 ACTCTTCTTCATAGGGGAGGGGG + Intergenic
917867577 1:179212078-179212100 GCACCTCTTCACAGGGCAGCAGG + Intronic
917908734 1:179617317-179617339 GCGCTGCTTGCCAGAGGAGCAGG + Intronic
918362100 1:183770271-183770293 GCTGTTCTTCCTAGGTGATCAGG + Intronic
918686487 1:187422165-187422187 GCACTTTTTCACAGGGCAGCAGG + Intergenic
919034152 1:192284305-192284327 ACATTTCTTCCCAGGAGAGCAGG + Intergenic
919388882 1:196955950-196955972 GCACTTCTTCACAAGGCAGCAGG + Intronic
919473648 1:198009359-198009381 GCACTTCTTCACAAGGCAGCAGG + Intergenic
920447469 1:206029655-206029677 GCTCCTGCTCACAGGGGAGCCGG + Intergenic
920687664 1:208121584-208121606 GCACCTCTTCACAGGGCAGCAGG - Intronic
921574225 1:216815551-216815573 GGTCTTTTTCCCAGGGCAGGTGG - Intronic
922015029 1:221636549-221636571 GATCTTCTTCTCATGGCAGCAGG + Intergenic
922056704 1:222049181-222049203 TCTCTGCTTCTCAGAGGAGCAGG + Intergenic
922098331 1:222461368-222461390 GCTCCACTTCCCAGGTGAACAGG + Intergenic
922124766 1:222711937-222711959 GCCCTTCTTTCCTGGGGCGCAGG - Intronic
922513127 1:226186381-226186403 GCGCTTCTTCAAAGGTGAGCCGG - Exonic
922823054 1:228497500-228497522 CCTCTTCTGCCCAGGAGACCTGG + Intergenic
924115464 1:240741784-240741806 GCTCTTCTTCCCAGAGAAAGAGG + Intergenic
1063136853 10:3224768-3224790 CCTCTTCTTCACAAGGTAGCAGG - Intergenic
1063280784 10:4627487-4627509 GCCCTTCTTCACAAGGCAGCAGG + Intergenic
1063488275 10:6440105-6440127 GCACCTCTTCACAGGGCAGCAGG - Intronic
1066446829 10:35491432-35491454 GCTCCTCTTGCCAGGGGTCCTGG - Intronic
1067835555 10:49637566-49637588 GACCTTCTTCCCATGGCAGCAGG - Intronic
1068799760 10:61126892-61126914 GCACTGCTTCACAGGGCAGCAGG - Intergenic
1069782249 10:70964310-70964332 GCTCCTGTTCCCAGGGAAGGGGG - Intergenic
1070068921 10:73066830-73066852 GCACTTCTTCACAGGGTGGCAGG - Intronic
1070445001 10:76489877-76489899 GCACCTCTTCACAGGGCAGCAGG - Intronic
1071069185 10:81671410-81671432 GCTCTGCTGCCCAGGGTGGCAGG - Intergenic
1071126303 10:82339391-82339413 GCACCTCTTCACAGGGCAGCAGG + Intronic
1071163365 10:82778024-82778046 GCTCTTTTTCCCTGGGGGGAAGG + Intronic
1071273839 10:84034712-84034734 GGTCTTCTTTCCAGGGGACCTGG - Intergenic
1072172735 10:92881881-92881903 GTTCTTCTTCACATGGCAGCAGG - Intronic
1073929133 10:108554513-108554535 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1074734790 10:116418681-116418703 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1075670588 10:124261563-124261585 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1076078862 10:127559764-127559786 GTCCTTCTTCACAGGGCAGCAGG + Intergenic
1076531975 10:131150900-131150922 GCACCTCTTCACAGGGCAGCAGG + Intronic
1078134512 11:8640823-8640845 GCTCTTTCTCCCTGGGCAGCAGG + Exonic
1078446332 11:11407790-11407812 GCTCGTAATCCCAGGGGATCTGG - Intronic
1078553964 11:12302999-12303021 GCACCTCTTCACAGGGCAGCAGG + Intronic
1080228867 11:29993652-29993674 GGGCTGCTTCCCAGGGCAGCTGG - Intergenic
1080245618 11:30176694-30176716 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1080262918 11:30369360-30369382 GATCTTCTTCACAAGGCAGCAGG - Intergenic
1081583924 11:44371282-44371304 GCACCTCTTCACAGGGAAGCAGG - Intergenic
1083226332 11:61287234-61287256 GCTCTTTTTTCCTGGGGTGCAGG - Intronic
1083688203 11:64390403-64390425 GTCCTTCTTCACAGGGCAGCAGG + Intergenic
1084358271 11:68653418-68653440 GCTCTGCTTCCCAGGGGGGCAGG + Intergenic
1086837009 11:91637449-91637471 GCACCTCTTCCCAGGGCAGCAGG - Intergenic
1087696199 11:101378956-101378978 GCTCTTTTTCCAGGGGTAGCAGG - Intergenic
1088756795 11:112891658-112891680 GCTCTTCTTCCCATGCTTGCTGG - Intergenic
1089082126 11:115785337-115785359 GCTCTCCTTCCCTGGGAAGCAGG - Intergenic
1089085494 11:115813619-115813641 GCTCCTCTTCACAGGGCAGCAGG + Intergenic
1089103255 11:115981912-115981934 TCCTTTCTTCCCAGGGGAGTGGG + Intergenic
1089711375 11:120317238-120317260 GCTGTTGTTCCCAGGGGAACAGG - Exonic
1089923959 11:122237895-122237917 GCACTTCTTCACAGGGCAGCAGG - Intergenic
1090238811 11:125167280-125167302 GCTCTCCCTGCCAGGGGTGCAGG - Intronic
1090344861 11:126062231-126062253 GCGCGTTTTCCCAAGGGAGCCGG - Intronic
1090462173 11:126901376-126901398 TCCCTTCTTCCTTGGGGAGCAGG + Intronic
1090503010 11:127280075-127280097 GTTCTGCTCCTCAGGGGAGCAGG + Intergenic
1091550676 12:1532634-1532656 GATCTGCCTGCCAGGGGAGCAGG + Intronic
1091797641 12:3306359-3306381 TTCCTTCTTCCCTGGGGAGCGGG - Intergenic
1091914598 12:4261467-4261489 GACCTTCTTCCCATGGCAGCAGG - Intergenic
1092051064 12:5470577-5470599 CCTCTTCTTCCCATGGCTGCAGG + Intronic
1092253803 12:6915629-6915651 TCTCCTCTTCCCAGGGGGGAGGG + Exonic
1092567233 12:9680202-9680224 GTTCTTCTTCACATGGCAGCAGG - Intronic
1093123517 12:15300914-15300936 GCACTTCTTCACAGGGTGGCAGG + Intronic
1093969446 12:25361558-25361580 GCCCTGCTTCCCAGGGAACCAGG - Intergenic
1094599334 12:31894722-31894744 GTTCTTCTTCACAGGGCAGCAGG + Intergenic
1094620503 12:32076056-32076078 TCTTTTCTTCCCAGTGGAGTTGG + Intergenic
1094679781 12:32657939-32657961 ACTGTTCTTCCCAGCAGAGCAGG - Intergenic
1095492819 12:42753092-42753114 GCTCCTCTTCACAGGGCGGCAGG - Intergenic
1096580853 12:52584111-52584133 GCTCTTTTTCCCAGGGAAGGTGG + Intergenic
1096783192 12:54002457-54002479 GCGCTTCTTCCTCGTGGAGCGGG - Exonic
1097965070 12:65570488-65570510 GTCCTTCTTCACAGGGCAGCAGG + Intergenic
1098083454 12:66814839-66814861 GACCTTCTTCACAGGGCAGCAGG + Intergenic
1098730115 12:74025155-74025177 GCACTTCTTCACAGGGCAGTAGG - Intergenic
1099084080 12:78223462-78223484 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1099492948 12:83308237-83308259 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1100127948 12:91453313-91453335 GCCCTTCTTCACAAGGCAGCAGG + Intergenic
1100567203 12:95808161-95808183 GACCTTCTTCTCAGGGCAGCAGG + Intronic
1100791456 12:98134630-98134652 GCACTTCTTCACAGGGTGGCAGG - Intergenic
1100933537 12:99638075-99638097 GTTCTTCTTCACATGGCAGCAGG - Intronic
1101231649 12:102747604-102747626 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1101411253 12:104470329-104470351 GCACCTCTTCACAGGGCAGCAGG + Intronic
1103005758 12:117418809-117418831 GTCCTTCTTCACAGGGCAGCAGG - Intronic
1103038156 12:117673064-117673086 GTTCTTCTTGCCAGAGGATCTGG - Intronic
1103685837 12:122731244-122731266 GCTCTGCTTCCCAGCAGAGGGGG - Intergenic
1103726368 12:122999262-122999284 TCTCTTCTTCCCAGGGGCCAGGG + Intronic
1103844654 12:123892995-123893017 GGTCATCCTCCCAGGCGAGCTGG + Intronic
1104094754 12:125546946-125546968 GCACCTCTTCACAGGGCAGCAGG + Intronic
1104741916 12:131183930-131183952 GCACCTCTTCACAGGGAAGCAGG + Intergenic
1104742143 12:131185418-131185440 GCACCTCTTCACAGGGTAGCAGG + Intergenic
1106496740 13:30285472-30285494 GCACCTCTTCACAGGGCAGCAGG - Intronic
1106864311 13:33947317-33947339 GCACCTCTTCACAGGGCAGCAGG - Intronic
1106907522 13:34424066-34424088 GCACTTCTTCACAGGGCAGCCGG + Intergenic
1107268506 13:38586293-38586315 GCACTTCTTCACAGGGCAGCAGG + Intergenic
1108642704 13:52397395-52397417 GGTCCTCTTCCCAGGGTATCTGG + Exonic
1108875263 13:55039809-55039831 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1109584046 13:64374579-64374601 GCCCTTCTTCACAAGGCAGCAGG + Intergenic
1110169143 13:72479635-72479657 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1111019807 13:82434772-82434794 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1111107603 13:83667885-83667907 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1111510700 13:89258165-89258187 GTTCTTCTTCACAGGGCAGCAGG - Intergenic
1111800355 13:92973712-92973734 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1112694753 13:101935589-101935611 GCACCTCTTCACAGGGCAGCAGG - Intronic
1113092845 13:106633113-106633135 GCGCCTCTTCACAGGGCAGCAGG - Intergenic
1113458307 13:110464515-110464537 GCTTTTTTTCACAGGGGAGGGGG - Intronic
1113547023 13:111160817-111160839 GCACCTCTTCACAGGGCAGCAGG - Intronic
1114147302 14:19992950-19992972 GCACTTCTTCACAGGGCAGAAGG + Intergenic
1114180041 14:20358592-20358614 GCCCTTCTTCACAGGGTGGCAGG - Intergenic
1115301008 14:31885201-31885223 GCTCCTCTTCACAGGGCAACAGG - Intergenic
1115807010 14:37063015-37063037 GTACTTCTTCACAGGGCAGCAGG + Intronic
1116617566 14:47157847-47157869 GCACTTCTTCACAGGGCAGCAGG - Intronic
1117085361 14:52195395-52195417 GTTCTTCTTCACATGGTAGCAGG - Intergenic
1118867812 14:69717265-69717287 GCTCCTCTTCACAGGGTAGCAGG + Intergenic
1119007245 14:70942998-70943020 GCACCTCTTCACAGGGCAGCAGG - Intronic
1120316714 14:82903631-82903653 GCTCCTCTTCACAGGGCAGCAGG - Intergenic
1121176905 14:91897277-91897299 GCACAGCCTCCCAGGGGAGCTGG + Intronic
1121274659 14:92659389-92659411 GATCTTCTTCTCAGGTGAGTAGG - Exonic
1121514098 14:94537654-94537676 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1122003572 14:98684246-98684268 GCTCTCCCTCCCAGGGGGGCAGG + Intergenic
1122165825 14:99823056-99823078 GGTCTTCTTCCCGGAGGAGATGG - Intronic
1122837623 14:104437822-104437844 GCTGTTCTTCCAAGGGCAGGAGG + Intergenic
1122858204 14:104570129-104570151 TCTCTTCTTCCCACTGGAGTTGG - Intronic
1202889666 14_KI270722v1_random:144145-144167 GCACCTCTTCACAGGGGGGCAGG + Intergenic
1123464721 15:20506531-20506553 GTTCTCATACCCAGGGGAGCTGG - Intergenic
1123653397 15:22494498-22494520 GTTCTCATACCCAGGGGAGCTGG + Intergenic
1123743816 15:23303361-23303383 GTTCTCATACCCAGGGGAGCTGG + Intergenic
1124275444 15:28322510-28322532 GTTCTCATACCCAGGGGAGCTGG - Intergenic
1124307258 15:28589091-28589113 GTTCTCATACCCAGGGGAGCTGG + Intergenic
1124946392 15:34270927-34270949 GCCCCTCTTCACAGGGCAGCAGG + Intronic
1125114998 15:36080298-36080320 ACCCTTCTTCATAGGGGAGCAGG + Intergenic
1125153492 15:36561016-36561038 ACACCTCTTCCCAGGGCAGCAGG - Intergenic
1125549443 15:40534437-40534459 GTTCTTCTTCACAGGGCAGCAGG + Intronic
1125832241 15:42725218-42725240 GCTATTCTTGCTACGGGAGCTGG - Exonic
1127294626 15:57598331-57598353 GCTATCCTTCCCAGGGGGGTTGG + Intronic
1127856120 15:62955122-62955144 GCACCTCCTCCCAGGGCAGCAGG + Intergenic
1128154955 15:65386241-65386263 GCTCTTCTTCCCTTGGCTGCAGG + Intronic
1128509291 15:68303662-68303684 GTTCTCCTCTCCAGGGGAGCTGG - Intronic
1129733812 15:77948191-77948213 ACACCTCTTCCCAGGGCAGCAGG - Intergenic
1129841772 15:78747812-78747834 ACTCCTCTTGCCAGGGCAGCAGG + Intergenic
1130168823 15:81491050-81491072 GTTCTTCTTCACAGGGCGGCAGG + Intergenic
1131398491 15:92105736-92105758 GCACTACTTCCCAGGGAAGCTGG + Intronic
1131455580 15:92580172-92580194 GCTCTGCTTCACAGGGTTGCTGG - Intergenic
1132041121 15:98525263-98525285 GCTCTTCTTCCTGGGGAAACAGG - Intergenic
1136021696 16:27444654-27444676 GCTCCTCCTACCAGGGGACCTGG + Exonic
1136175350 16:28512777-28512799 GCTCTCCTTCCCAGGGTTGTTGG - Intergenic
1137309015 16:47234958-47234980 GCACCTCTTCACAGGGCAGCAGG - Intronic
1137932484 16:52602183-52602205 GATCTTCTTCACAAGGCAGCAGG - Intergenic
1138276074 16:55736037-55736059 GGTATTCTTCCCTGGGGAACAGG + Intergenic
1138385368 16:56632615-56632637 GCTTTTCTACTCAGGGGAGGGGG - Exonic
1138527413 16:57617075-57617097 CCCCTTCATCCCAGGGGTGCTGG + Intronic
1139559014 16:67729969-67729991 GCGCTTCTACCCAGGGCTGCTGG - Exonic
1140532565 16:75679386-75679408 GCTATTCTTCCCAGGCAATCGGG - Intronic
1141034261 16:80614219-80614241 CCTCTTCTTCCCAGGTCTGCTGG + Intronic
1141519263 16:84566782-84566804 GGTCCTCTCCCCCGGGGAGCAGG + Exonic
1141579427 16:84987034-84987056 GCCCTTCTTCCCTGGGCAGCAGG + Intronic
1142067463 16:88071138-88071160 GCTCCTCTTCCCAGGGCCACCGG + Intronic
1142189220 16:88709995-88710017 GCTCATCTTTCCAGGCGAGAAGG + Exonic
1142194641 16:88733789-88733811 CCTCTTCCTCACAGGGGACCCGG - Intronic
1142251844 16:88995580-88995602 CCTCTTCTTCCCAGGGGCTGGGG - Intergenic
1142258169 16:89025723-89025745 TCTCATCCTCCCAGGGAAGCAGG - Intergenic
1142651221 17:1353646-1353668 CCTCAGCTTCCCAGGGTAGCTGG - Intronic
1142894482 17:2965047-2965069 GCACCTCCACCCAGGGGAGCTGG - Intronic
1142967093 17:3588439-3588461 GCTCTGCTTCCCAGCCCAGCTGG + Intronic
1143452470 17:7043834-7043856 TCTCTGCTTCCCAGGCGGGCGGG + Exonic
1143573269 17:7774745-7774767 GCTCTTCTTCCCAGGCCTCCTGG + Exonic
1144087523 17:11824041-11824063 GCTCATCTTCCCTTGGGAGTTGG + Intronic
1144932883 17:18874521-18874543 ACTCCTCTTCCCAGGAGAGATGG - Intronic
1146180986 17:30697991-30698013 CCTCTTCTTCCCAGGTGCTCAGG - Intergenic
1146805657 17:35863247-35863269 GCTCATCTTCCCAGGATACCAGG + Intronic
1147141571 17:38463435-38463457 TCTCTGCCTCCCAGGGGAGCCGG - Intronic
1147927222 17:43953408-43953430 GCTCGTCTGCCTAGGGGCGCTGG - Exonic
1148054669 17:44787008-44787030 GCACTTCTTCCATGTGGAGCTGG + Intergenic
1148218889 17:45848937-45848959 GCACTTCTTCCCTGGCAAGCGGG - Intergenic
1148491815 17:48028269-48028291 GCTCTCCAACTCAGGGGAGCTGG - Intronic
1148494543 17:48045469-48045491 GCTTTTCCTACCAGGGAAGCTGG + Intergenic
1148689875 17:49520953-49520975 GCTCATCTTCCCAGAGGTGGTGG - Intergenic
1149392978 17:56210752-56210774 GCACCTCTTCACAGGGTAGCAGG + Intronic
1149689711 17:58565090-58565112 TCCCCTCTTCCCAGGAGAGCAGG + Intronic
1149999964 17:61428131-61428153 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1150905330 17:69330061-69330083 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1150946199 17:69748731-69748753 GTCCTTCTTCACAGGGCAGCAGG + Intergenic
1151575443 17:74950683-74950705 GCTCTTGTCTTCAGGGGAGCTGG - Intergenic
1152490700 17:80631246-80631268 GCTTTGCTTCCTAGGGGAGGAGG + Intronic
1153285096 18:3449780-3449802 GCTTTTCTTCCCGGGGGTGGAGG + Intronic
1153987520 18:10366855-10366877 GAGCTTCTTCCTAAGGGAGCAGG - Intergenic
1154132776 18:11751028-11751050 GGTCTTCTTCACTGCGGAGCTGG - Intronic
1154383174 18:13870547-13870569 GCTCTGCTTCCCAAGGGAGATGG + Intergenic
1155414417 18:25581787-25581809 ACTCTGCTTCTCAGGGGACCAGG - Intergenic
1156045765 18:32875403-32875425 GTTCTTCTTCGCATGGCAGCAGG + Intergenic
1156995254 18:43458005-43458027 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1157296636 18:46449711-46449733 GCACCTCTTCACAGGGCAGCAGG - Intronic
1157442027 18:47718862-47718884 GGTCTTTTTCACTGGGGAGCAGG + Intergenic
1157528938 18:48406064-48406086 TCTCTTCTTCCCAGGAGGGGAGG + Intronic
1157847541 18:51017724-51017746 GCTGTACCACCCAGGGGAGCCGG - Intronic
1158124214 18:54083701-54083723 GCACCTCTTCCCAGGGCTGCAGG - Intergenic
1158963191 18:62603166-62603188 GATCTGGTGCCCAGGGGAGCAGG + Intergenic
1159196340 18:65121477-65121499 GCACCTCTTCACAGAGGAGCAGG - Intergenic
1159325631 18:66912697-66912719 GCACTTCTTCACAGGGCGGCAGG + Intergenic
1159461319 18:68725027-68725049 GCACCTCTTCACAGGGCAGCAGG + Intronic
1159790532 18:72773682-72773704 GCACCTCTTCACAGGGCAGCAGG - Intronic
1159839154 18:73376572-73376594 GTCCTTCTTCACAGGGCAGCAGG + Intergenic
1160253075 18:77221061-77221083 GCTGTTCTTGCCAGAGGAACTGG - Intergenic
1160365808 18:78325025-78325047 GCTCTCTTTCCCAGCGGAGATGG + Intergenic
1160395146 18:78565036-78565058 GCTCTTCATCCCAGGGCTTCAGG - Intergenic
1160533308 18:79577780-79577802 TCTCTCCTTGACAGGGGAGCTGG - Intergenic
1163582671 19:18147652-18147674 GCCCTTGCTCCCAGGGTAGCCGG - Intronic
1163739754 19:19004238-19004260 GATCCTCTTCCGAGGGAAGCAGG + Exonic
1164402036 19:27909490-27909512 GCTCTTTTGCCCAGGGGCTCTGG + Intergenic
1164531782 19:29053983-29054005 CATCATCTTCCCAGGAGAGCAGG - Intergenic
1164589285 19:29497457-29497479 GCTGACTTTCCCAGGGGAGCAGG + Intergenic
1164721792 19:30437976-30437998 GTTTTTCTGCCCAGGTGAGCTGG + Intronic
1165712770 19:38023997-38024019 GCCCTTCTTCCTTGGGGAGGGGG + Intronic
1165880755 19:39041333-39041355 GCCCCTCTTCACAGGGCAGCAGG + Intergenic
1166795667 19:45423930-45423952 GCTCTACTCTCCTGGGGAGCGGG - Intronic
1166856102 19:45783282-45783304 GCTCTTCTTTCCAGGGTGGACGG + Exonic
1167793184 19:51692940-51692962 GCTCTTCCTCCCAGGGTCCCTGG - Intergenic
1168023738 19:53628620-53628642 GCTCTTCTTGCCCGGGCAGGAGG + Intergenic
1202665068 1_KI270708v1_random:110912-110934 GCACCTCTTCACAGGGGGGCAGG + Intergenic
925245726 2:2380691-2380713 GCACCTCTTCACAGGGCAGCAGG - Intergenic
925310275 2:2876817-2876839 GCTCTTCCGGCCAGGGGAGCAGG - Intergenic
925864658 2:8216557-8216579 GCTTTTTTTGGCAGGGGAGCAGG - Intergenic
925925384 2:8666399-8666421 TCTCATCTTCCGAGGGGGGCAGG + Intergenic
926349445 2:11982035-11982057 GCTCTTCTGCACTGGGGTGCAGG + Intergenic
926392094 2:12403794-12403816 GCACCTCTTCACAGGGCAGCAGG - Intergenic
926615312 2:14991443-14991465 ACTCTTCTTCCCAGTGTTGCAGG + Intergenic
927147085 2:20173329-20173351 TCTCCTCTTCCCAAGGGACCTGG - Intergenic
927178543 2:20427406-20427428 GCACCTCTTCACAGGGCAGCAGG - Intergenic
927441883 2:23124670-23124692 GGTCTCCTTCCCAGAGCAGCTGG + Intergenic
928836870 2:35558106-35558128 ACACTTCTTCCCAGGGTGGCAGG - Intergenic
929507450 2:42539338-42539360 GTCCTTCTTCACAGGGCAGCAGG + Intronic
929671435 2:43878964-43878986 GCTCCTCTTCACAGGGTAGCGGG - Intergenic
929911056 2:46089727-46089749 GCTTTTCTGCCCAGAGGAGATGG + Intronic
930021922 2:47006793-47006815 GCTTTTCTGGCCAGGGGAGTGGG + Intronic
930108538 2:47658592-47658614 TACCTTCTTCCCAGGGGAGAGGG + Intergenic
930480735 2:51944790-51944812 GCACCTCTTCCCAGGGTGGCAGG - Intergenic
930594053 2:53364234-53364256 GCCCTTCTTCACATGGCAGCAGG + Intergenic
930602655 2:53459733-53459755 GCACCTCTTCACAGGGCAGCAGG + Intergenic
930781041 2:55224968-55224990 GCACTGCAGCCCAGGGGAGCTGG + Intronic
931176849 2:59862675-59862697 GTTCTTCTTCACAGGGCAGCAGG + Intergenic
931493960 2:62782586-62782608 GCACCTCTTCACAGGGTAGCAGG + Intronic
932915585 2:75854869-75854891 GCACTTCTTCATAGGGCAGCAGG - Intergenic
933132712 2:78692502-78692524 GCACCTCTTCACAGGGAAGCAGG + Intergenic
934660021 2:96138373-96138395 GCTCTCCTTGCCAGGTAAGCTGG - Exonic
935452210 2:103222794-103222816 GTTCTTCTTCACATGGCAGCAGG - Intergenic
935800423 2:106690165-106690187 GCACCTCTTCACAGGGCAGCAGG + Intergenic
936635359 2:114250065-114250087 GCACCTCTTCACAGGGCAGCAGG - Intergenic
937249111 2:120512152-120512174 GCTGTGCTCCCCAGGGGAGAGGG - Intergenic
937549865 2:123074629-123074651 GATATTCTTCCCAGGGGACAAGG - Intergenic
937867971 2:126768172-126768194 GCACCTCTTCCCAGGGTGGCAGG + Intergenic
937981702 2:127619655-127619677 GCTTTTCTTCTTGGGGGAGCTGG + Intronic
937997041 2:127701930-127701952 GCGCTTCTTCGCAGCGCAGCAGG - Exonic
938392826 2:130918377-130918399 TCTCTCCTTCCAAGGGCAGCTGG - Intronic
938483281 2:131679698-131679720 CCTGTTCTTCCCAGGGCATCAGG - Intergenic
938564510 2:132506595-132506617 GCACCTCTTCACAGGGCAGCAGG + Intronic
939052789 2:137328850-137328872 GCACCTCTTCACAGGGAAGCAGG - Intronic
939053384 2:137332811-137332833 GCACCTCTTCACAGGGCAGCAGG - Intronic
939435957 2:142178038-142178060 GCACCTCTTCACAGGGCAGCAGG - Intergenic
939676935 2:145084296-145084318 ATTCTTCTTCTCAGGGGAGGGGG - Intergenic
940149928 2:150588684-150588706 GCTCTTGTCCTCAGGGGGGCTGG - Intergenic
940343414 2:152604496-152604518 GGTCTGCTTCTCAGGAGAGCTGG + Intronic
940596037 2:155794792-155794814 GCACCTCTTCACAGGGAAGCAGG + Intergenic
941524958 2:166596260-166596282 GCACCTCTTCACAGGGCAGCAGG + Intergenic
942102692 2:172601542-172601564 GCACCTCTTCACAGGGCAGCAGG - Intronic
942511754 2:176709908-176709930 GCTGCTATTCCCAGGGGAGGCGG - Intergenic
942785560 2:179697416-179697438 CATCTTCTTCCCAAGGCAGCAGG - Intronic
942812651 2:180017122-180017144 CCTCTGCTTCCCAGGGGCCCAGG - Intergenic
943321046 2:186443301-186443323 GCACCTCTTCACAGGGTAGCAGG - Intergenic
944631676 2:201632634-201632656 ACCCTTCTTCACAGGGCAGCAGG - Intronic
945031527 2:205668887-205668909 GCACCTCTTCACAGGGCAGCAGG + Intergenic
945552174 2:211233900-211233922 TCTCTTCTTCACAGGGCAGCAGG + Intergenic
945675426 2:212850364-212850386 TCTCTTCTTCCCAGAGGTTCGGG - Intergenic
945785080 2:214224127-214224149 GCTCTTCTTCCCAGGGGCAATGG + Intronic
946874638 2:224115256-224115278 GCACCTCTTCACAGGGCAGCAGG - Intergenic
947011354 2:225570501-225570523 GCACCTCTTCACAGGGCAGCAGG + Intronic
947031616 2:225802279-225802301 GCACATCTTCACAGGGCAGCAGG - Intergenic
947154715 2:227150673-227150695 GCACCTCTTCACAGGGCAGCAGG + Intronic
947155565 2:227159721-227159743 GCACCTCTTCACAGGGCAGCAGG - Intronic
947913572 2:233818150-233818172 TCTCTCCCTCCCAGAGGAGCTGG - Intronic
948325451 2:237116135-237116157 GCTGTTCTTCCCATGGTAGAAGG - Intergenic
948705642 2:239790590-239790612 GCCCTTCTCCCCTGGGGAGTGGG - Intronic
1168804471 20:664294-664316 GCGCTACTTCCGAGGGGAGGCGG - Exonic
1169139914 20:3221930-3221952 GCTTTTCTTCCCTGGGGTGTGGG + Intronic
1169592982 20:7165046-7165068 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1169725638 20:8726523-8726545 GCACCTCTTCACAGGGCAGCAGG + Intronic
1170308768 20:14970129-14970151 GCACCTCTTCACAGGGCAGCAGG + Intronic
1170364046 20:15580791-15580813 GCTCTTCTTCTTAGGGGAAAGGG + Intronic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1170696458 20:18663775-18663797 GCACCTCTTCACAGGGCAGCAGG + Intronic
1170813508 20:19693921-19693943 GCTGTTCTTCCCACTGGAGCAGG - Intronic
1172331235 20:34077356-34077378 TCTCTCCTTCCCAGGGGTTCTGG + Intronic
1173009668 20:39170394-39170416 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1173056862 20:39622989-39623011 CCTCTTCTTCACAGGGTAGCAGG - Intergenic
1174891970 20:54404968-54404990 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1175146379 20:56899562-56899584 GCACATCTTCCCATGGCAGCAGG + Intergenic
1175470621 20:59224363-59224385 GCTCTTCTGCCCTAGGGTGCAGG - Intronic
1175485828 20:59345470-59345492 GTTCTTCTTCACATGGCAGCAGG + Intergenic
1175572633 20:60035816-60035838 GCTCTTCTTCACAAGGTGGCAGG - Intergenic
1175597698 20:60248395-60248417 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1176206291 20:63890175-63890197 GCTGTCCTTCCTAGGGGTGCAGG + Exonic
1176366407 21:6035581-6035603 GCTCGTCTTCCCAGGGATGCGGG - Intergenic
1177624534 21:23643638-23643660 GATCTTCTTCACATGGTAGCAGG + Intergenic
1177741681 21:25161817-25161839 GTTCTTCTTCTCATGGCAGCAGG - Intergenic
1178110368 21:29363944-29363966 GCACCTCTTCTCAGGGCAGCAGG - Intronic
1178148115 21:29763255-29763277 CATCTTCTTCACAGGGGAGCAGG - Intronic
1179272077 21:39859383-39859405 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1179757110 21:43502964-43502986 GCTCGTCTTCCCAGGGATGCGGG + Intergenic
1180116329 21:45707929-45707951 GCTGGTCTTCCCAGGTGAGGAGG + Intronic
1180201982 21:46229525-46229547 GCTCAGCTTCCCAGGGACGCCGG - Intergenic
1181179482 22:21056759-21056781 CCTTTCCCTCCCAGGGGAGCTGG + Intronic
1181419100 22:22785625-22785647 GCTCTTCTTGACAGGTGGGCAGG - Intronic
1182519308 22:30876411-30876433 GCTCTCCTTTCCAGGGCAGTGGG - Intronic
1182787189 22:32917743-32917765 GCTCTCTCTCCCAGGGGAGTTGG + Intronic
1182815806 22:33162309-33162331 GCACCTCTTCACAGGGCAGCAGG + Intronic
1182843415 22:33410534-33410556 GATCTTCTTCACATGGCAGCAGG - Intronic
1183264255 22:36815916-36815938 GTTCTTGTGCCCAGGGGAGGGGG + Intronic
1183293976 22:37019325-37019347 GCTATCCTTCCCCGGGCAGCAGG + Exonic
1183360995 22:37383464-37383486 GCTCTGGGTCCCGGGGGAGCTGG + Intronic
1183831495 22:40420568-40420590 CCTTTTCTTCCCAGGTCAGCAGG - Exonic
1184269579 22:43371381-43371403 GCCCATCTGCCCAGGGAAGCTGG + Intergenic
1184309667 22:43633119-43633141 GCTCCACCTCCCAGGCGAGCCGG - Intronic
1184590698 22:45480947-45480969 GCACATCTTCACAAGGGAGCAGG - Intergenic
1184644862 22:45890161-45890183 GCGCTGGTTCCCAGGGGAGAGGG - Intergenic
1184710137 22:46244947-46244969 GCACTGCAGCCCAGGGGAGCTGG - Exonic
1184745422 22:46452996-46453018 GGTCTTCCACCCAGGGGAGAGGG + Intronic
1184839374 22:47043600-47043622 GTTCATCTTTCCAGGGGAGGAGG + Intronic
1185266282 22:49906018-49906040 GCTCTTGCTCCCAGGGTGGCCGG + Intronic
949845070 3:8361601-8361623 GTCCTTCTTCACAGGGCAGCAGG + Intergenic
949935683 3:9113802-9113824 GCACCTCTTCACAGGGCAGCAGG - Intronic
949945621 3:9187540-9187562 GCTATTCTTCCCGGGGGAAGAGG - Intronic
950071519 3:10156609-10156631 GCACCTCTTCACAGGGCAGCAGG + Intergenic
950453349 3:13078178-13078200 GGTTCTCTCCCCAGGGGAGCAGG - Intergenic
950505069 3:13389434-13389456 GCTCTGTTTCCCAGGGCAGGAGG + Intronic
950856118 3:16106956-16106978 GCACCTCTTCACAGGGCAGCAGG + Intergenic
951354542 3:21648281-21648303 GATCTTCTTCACATGGCAGCAGG - Intronic
951674426 3:25220644-25220666 CATCTTCTTCACAGGGCAGCAGG - Intronic
951989278 3:28657904-28657926 GCTCAGCTTCCCAGAGTAGCTGG + Intergenic
952297232 3:32072243-32072265 GCTTTACTTCCCAAGGAAGCTGG + Intronic
952871009 3:37901336-37901358 GCTGTTCTTCCCAGGGGGACAGG + Intronic
953784243 3:45898509-45898531 GCTCTTCAGGCCAGGGCAGCTGG - Intronic
953847070 3:46436117-46436139 GCTCTTCTCCCCAGGTGTGTTGG - Exonic
954464423 3:50646181-50646203 CCTCTTCATCCCCGGGGAGATGG - Exonic
954555871 3:51517367-51517389 CCTCTTCTTCCCAGGGGGGCTGG + Intergenic
954911961 3:54118033-54118055 GCACCTCTTCACAGGGCAGCAGG - Intergenic
956023901 3:64961703-64961725 GCTCATGTTCTCAGGAGAGCTGG + Intergenic
956698445 3:71938192-71938214 GCACCTCTTCACAGGGTAGCAGG + Intergenic
957279710 3:78134728-78134750 GCACCTCTTCACAGGGCAGCAGG - Intergenic
957496964 3:81005537-81005559 GCACTTCTTCACATGGCAGCAGG - Intergenic
958023346 3:88022375-88022397 GCACCTCTTCACAGGGCAGCAGG + Intergenic
959304997 3:104651360-104651382 GCACCTCTTCCCAGGGTGGCAGG - Intergenic
959810529 3:110613794-110613816 GCACCTCTTCACAGGGCAGCAGG - Intergenic
959949817 3:112166481-112166503 GCACCTCTTCACAGGGCAGCAGG + Intronic
960284182 3:115809083-115809105 GCTCATTTTCACAGTGGAGCAGG + Exonic
960359093 3:116689081-116689103 GCACCTCTTCACAGGGCAGCAGG + Intronic
960400603 3:117193094-117193116 GCACCTCTTCACAGGGTAGCAGG + Intergenic
960495489 3:118368617-118368639 GCACCTCTTCACAGGGTAGCAGG + Intergenic
961782225 3:129326953-129326975 GCTCTGTTTCCCAGGGCAGGAGG + Intergenic
961983466 3:131105587-131105609 GCACTTCTTCACAGGGCAGCAGG + Intronic
962265697 3:133942886-133942908 GGTCTGGTTCCCAGGGAAGCTGG + Intronic
962407278 3:135110955-135110977 CCTGATCTTCCCAGGGAAGCAGG + Intronic
962430426 3:135313703-135313725 GCCCCTCTCCCCAGGAGAGCTGG + Intergenic
962924115 3:139976187-139976209 GCTCTACTACCCTGGGGATCGGG + Intronic
963392812 3:144690044-144690066 GCACCTCTTCACAGGGCAGCAGG - Intergenic
963644498 3:147896475-147896497 ACTCTCCTTCACAGGGGAGGGGG - Intergenic
964169663 3:153754683-153754705 GCACCTCTTCACAGGGCAGCAGG - Intergenic
964673300 3:159250584-159250606 GCACCTCTTCACAGGGCAGCAGG + Intronic
964687462 3:159413037-159413059 GTCCTTCTTCCCATGGCAGCAGG + Intronic
964870055 3:161303645-161303667 GCACCTCTTCACAGGGCAGCAGG - Intergenic
964945318 3:162216481-162216503 GCACGTCTTCACAGGGCAGCAGG + Intergenic
965410056 3:168319243-168319265 GCACTTCTTCACAGAGCAGCAGG + Intergenic
966138960 3:176733170-176733192 GCACCTCTTCACAGGGCAGCAGG + Intergenic
967607763 3:191467870-191467892 GCACCTCTTCACAGGGCAGCAGG + Intergenic
968622367 4:1609585-1609607 GCGCCTCTTCACAGGGCAGCAGG - Intergenic
968901508 4:3434172-3434194 GCACCTCTTCACAGGGCAGCAGG + Intronic
968907772 4:3462632-3462654 GCTCCTCTGCCCATCGGAGCCGG + Intergenic
968975218 4:3818686-3818708 GCACCTCTTCACAGGGCAGCAGG - Intergenic
970655785 4:18228888-18228910 GTTCTTCTTCACATGGCAGCAGG + Intergenic
970758310 4:19452276-19452298 GTTCTTCTTCACAGGGCAGCAGG + Intergenic
970987064 4:22171171-22171193 CATCTTCTTCACAGGGCAGCAGG + Intergenic
971071695 4:23101504-23101526 GCACTTCTTAACAGGGCAGCAGG - Intergenic
971440256 4:26677816-26677838 GCACCTCTTCACAGGGCAGCAGG - Intronic
971451412 4:26805048-26805070 GCTCCTCTTCCCACGGATGCTGG + Intergenic
972007757 4:34132452-34132474 GCACCTCTTCACAGGGTAGCAGG - Intergenic
973151423 4:46892974-46892996 GCACCTCTTCACAGGGCAGCAGG - Intronic
973908861 4:55558419-55558441 GTTCTTCTTCACATGGCAGCAGG - Intronic
974513222 4:62873193-62873215 GCACCTCTTCACAGGGCAGCAGG - Intergenic
974658495 4:64855773-64855795 GCACCTCTTCACAGGGCAGCAGG - Intergenic
976040334 4:80876428-80876450 GCACCTCTTCCCAGGAAAGCAGG - Intronic
976427895 4:84927725-84927747 GCACATCTTCACAGGGCAGCAGG - Intronic
976947708 4:90791079-90791101 GCACCTCTTCACAGGGCAGCAGG + Intronic
977006191 4:91571506-91571528 GCACCTCTTCACAGGGCAGCAGG + Intronic
977046337 4:92072558-92072580 GCACCTCTTCACAGGGCAGCAGG + Intergenic
977429969 4:96919793-96919815 GCACCTCTTCACAGGGCAGCAGG + Intergenic
977719258 4:100220724-100220746 CATCTTCTTCACAGGGCAGCAGG + Intergenic
978561593 4:110039511-110039533 GACCTTCTTCACAGGGCAGCAGG + Intergenic
979700142 4:123657740-123657762 GCACCTCTTCACAGGGTAGCAGG + Intergenic
979848277 4:125544639-125544661 CATCTTCTTCACAGGGCAGCAGG - Intergenic
980282836 4:130742617-130742639 GCACCTCTTCACAGGGCAGCAGG - Intergenic
981230177 4:142344144-142344166 GCTCTTCTTCACAAAAGAGCAGG - Intronic
981305760 4:143245440-143245462 CCTCTTCTTGCCTGGGGACCAGG + Intergenic
981912827 4:150001569-150001591 GCACCTCTTCACAGGGCAGCAGG + Intergenic
982331312 4:154184844-154184866 GCACATCTTCCCATGGCAGCAGG + Intergenic
982467083 4:155744773-155744795 GCACCTCTTCACAGGGCAGCAGG - Intergenic
983019376 4:162656227-162656249 GCCCTTCTTCAGAGGGGAGGGGG - Intergenic
983506610 4:168559799-168559821 GCTCAACTTCCCTGGGTAGCCGG - Intronic
984131122 4:175877507-175877529 GCACCTCTTCACAGGGCAGCAGG + Intronic
984865413 4:184276404-184276426 GCACCTCTTCACAGGGCAGCAGG - Intergenic
985069149 4:186151077-186151099 GCTGTGATTCTCAGGGGAGCCGG + Intronic
986222084 5:5776837-5776859 GCACCTGGTCCCAGGGGAGCAGG - Intergenic
986251381 5:6061501-6061523 TCTCTTCTTTTCAGGGGTGCAGG - Intergenic
986713063 5:10501814-10501836 TCACTTCTTCCCAGGGTCGCTGG + Intergenic
987165572 5:15194534-15194556 GCACCTCTTCACAGGGCAGCAGG - Intergenic
987263506 5:16227769-16227791 GCACCTCTTCACAGGGCAGCAGG - Intergenic
987304508 5:16624979-16625001 TCTCCTCTCCCCAGGGGACCTGG + Intergenic
987736993 5:21859300-21859322 CACCTTCTTCACAGGGGAGCAGG + Intronic
988432469 5:31135368-31135390 GATCTTCTTCACATGGCAGCAGG + Intergenic
988735228 5:34013907-34013929 GCACTTCTTCACAAGGCAGCAGG + Intronic
989155539 5:38341322-38341344 GCACCTCTTCACAGGGCAGCAGG + Intronic
990143251 5:52730150-52730172 CATCTTCTTCACAGGGCAGCAGG - Intergenic
990186467 5:53215241-53215263 GCACGTCTTCACAGGGCAGCAGG - Intergenic
990706051 5:58531035-58531057 GCACCTCTTCTCAGGGCAGCAGG + Intergenic
990786335 5:59424547-59424569 CATCTTCTTCACAGGGCAGCAGG + Intronic
990794390 5:59523899-59523921 GTTCTTCTTCACATGGCAGCAGG - Intronic
991075968 5:62538544-62538566 CATCTTCTTCACAGGGCAGCAGG - Intronic
991409262 5:66330572-66330594 GCACTTCTTCACAGGAGAGCAGG - Intergenic
991409843 5:66334993-66335015 CCTCTCCTGCCCTGGGGAGCTGG + Intergenic
991552337 5:67853858-67853880 GTTCTTCTTCACATGGCAGCAGG + Intergenic
992311091 5:75499478-75499500 GCACTTCTTCCCAGGGCGGCAGG - Intronic
992912292 5:81407908-81407930 GCTCCTCTTCACAGGGTGGCAGG + Intergenic
993061029 5:83039388-83039410 TCTCTTCTTGCCAGGGAAACTGG - Intergenic
993333584 5:86629706-86629728 TCTCTTCTTCCCAGGTCATCAGG - Intergenic
993517411 5:88855723-88855745 GCACCTCTTCACAGGGCAGCAGG - Intronic
995907508 5:117143121-117143143 AGCCTTCTTCCCAGGGGAGAGGG - Intergenic
996917014 5:128724005-128724027 GCACCTCTTCACAGGGCAGCAGG - Intronic
997157662 5:131576527-131576549 GCTCTACTGCCCAAGGAAGCCGG + Intronic
998377836 5:141702735-141702757 GGTCATCTGCCCAGGGCAGCGGG - Intergenic
998746857 5:145270990-145271012 GATCTTCTTCACATGGCAGCAGG + Intergenic
999265164 5:150262201-150262223 GCTCTGCTCCCCAGGGGTCCAGG - Intronic
1000581176 5:163036562-163036584 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1001419156 5:171573828-171573850 GCTCTTCCTTCCAGGGCAGGAGG - Intergenic
1001758995 5:174192279-174192301 GCAATTCTTCCCAGAGCAGCCGG + Intronic
1001905572 5:175470032-175470054 GTGCTCCTGCCCAGGGGAGCAGG + Intergenic
1002283432 5:178146713-178146735 GCTCTCCCTCCCAGGGTTGCTGG - Intronic
1002290604 5:178198206-178198228 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1002432150 5:179209893-179209915 ACTCTTCCTCCCTGGGGAACAGG + Intronic
1002550690 5:179989104-179989126 GCACCTCTTCACAGGGCAGCAGG + Intronic
1002553774 5:180018400-180018422 GCACCTCTTCACAGGGCAGCAGG + Intronic
1003189567 6:3862185-3862207 TCTCTTCTACCCCGAGGAGCTGG + Intergenic
1003227333 6:4218200-4218222 GTTCTTCTTCACATGGTAGCAGG + Intergenic
1003422109 6:5967935-5967957 TCTCCTCTTCCCAGTGGTGCTGG - Intergenic
1003720022 6:8691835-8691857 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1004378364 6:15110953-15110975 GTTTTTCTTCCCAGATGAGCAGG - Intergenic
1004427050 6:15513673-15513695 GTCCTTCCTCCCTGGGGAGCAGG + Intronic
1004700548 6:18075431-18075453 GCCCTTCTTCACATGGCAGCAGG + Intergenic
1004897864 6:20166399-20166421 ACTCTCCTTCCCAGGGAAGGAGG + Intronic
1004956718 6:20735377-20735399 GCACCTCTTTACAGGGGAGCAGG + Intronic
1005694656 6:28340492-28340514 GTTCTTCTTCACATGGCAGCAGG - Intronic
1005826236 6:29633040-29633062 TCTCTTCTTCCCCGGGGCGGCGG + Exonic
1006150311 6:31983501-31983523 AGTCCTCTTCCCAGGGAAGCAGG + Intronic
1006156612 6:32016239-32016261 AGTCCTCTTCCCAGGGAAGCAGG + Intronic
1007000339 6:38306101-38306123 GTTTTTCTTCCCAGAGGAACTGG + Intronic
1007282750 6:40724310-40724332 GCTCTGCTACCCAGCGGGGCAGG - Intergenic
1007402983 6:41615095-41615117 GCTTTTGTTCCCAGGTGAGGTGG - Intergenic
1007965505 6:46000652-46000674 GCACCTCTTCACAGGGCAGCAGG + Intronic
1009284830 6:61803749-61803771 GCACTTCTTCACAGGGTGGCAGG + Intronic
1009285091 6:61805659-61805681 GCACCTCTTCACAGGGGAGCAGG + Intronic
1009528348 6:64777008-64777030 GCACCTCTTCACAGGAGAGCAGG + Intronic
1010055272 6:71557244-71557266 TCACCTCTTCACAGGGGAGCAGG - Intergenic
1011378766 6:86719938-86719960 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1011934132 6:92754008-92754030 GCTCTGTTTCCCAGGGATGCAGG + Intergenic
1012638824 6:101582459-101582481 GCACCTCTTCACAGGGCAGCAGG - Intronic
1014139627 6:117926289-117926311 GCACCTCTTCACAGGGCAGCAGG - Intronic
1014734410 6:125075451-125075473 GCACATCTTCACAGGGCAGCAGG + Intronic
1014901374 6:126969861-126969883 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1015039724 6:128702707-128702729 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1015105619 6:129532966-129532988 GCACCTCTTCCCAGGGCAGCAGG + Intergenic
1015208194 6:130666050-130666072 GCTCTTCTTCCCAGGACACTGGG + Intergenic
1015522640 6:134147017-134147039 GCTGTTCTTCACATGGCAGCAGG + Intergenic
1015755178 6:136599217-136599239 CCTCTCCTTCCTAGGAGAGCAGG - Intronic
1016127524 6:140423997-140424019 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1016414474 6:143818656-143818678 GCACCTCTTCACAGGGCAGCAGG + Intronic
1018035596 6:159878616-159878638 TCTCTGCTTCCCGGGGGAGGTGG - Intergenic
1018514442 6:164562951-164562973 GTTCTTCTTCACATGGTAGCAGG - Intergenic
1019405909 7:883955-883977 TCCCTTCTTCCCTGGGCAGCTGG - Intronic
1019738911 7:2663285-2663307 GCTCTTCCTCCCAGAGCAGCCGG + Exonic
1021401084 7:20209961-20209983 GCACCTCTTCACAGGGCAGCAGG - Intronic
1021660888 7:22917013-22917035 GCTTTACTTCCCAAGGAAGCTGG + Intergenic
1021830487 7:24602940-24602962 GCACCTCTTCACAGGGCAGCAGG - Intronic
1021928993 7:25561261-25561283 GCTTGTCATGCCAGGGGAGCGGG - Intergenic
1022008923 7:26292146-26292168 GCCCTTCTTTCCAGAGGCGCGGG + Intronic
1022024015 7:26428884-26428906 TCTCTTCTTCACAAGGCAGCAGG - Intergenic
1022289682 7:28988980-28989002 GTTTCTCTTCCCAGGGGAGATGG + Intergenic
1022588228 7:31636026-31636048 GCACTTTTTCACAGGGCAGCAGG + Intronic
1022982608 7:35618544-35618566 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1023782663 7:43671864-43671886 GCACTTCTTCACAGGGCAGCAGG - Intronic
1026584513 7:71645444-71645466 GCACTTCTTCACAAGGCAGCAGG - Intronic
1027151747 7:75738596-75738618 GCCCTTCTCCCCAGGCCAGCTGG + Intronic
1028404748 7:90463322-90463344 GTTCTTCTTCACATGGCAGCAGG - Intronic
1031278680 7:119766514-119766536 GCACTTCTTCACATGGCAGCAGG - Intergenic
1031489692 7:122371388-122371410 CATCTTCTTCACAGGGCAGCAGG + Intronic
1031505530 7:122577117-122577139 GCACTTCTTCACAGGGTGGCAGG - Intronic
1032335801 7:131023294-131023316 GCTCCTCTTCACAGGGCGGCAGG - Intergenic
1032387274 7:131533487-131533509 CCTCTCCTGCCCAGGGAAGCAGG - Intronic
1032413708 7:131720008-131720030 GCACTTCTTCGCAGGGCAGCAGG + Intergenic
1032509739 7:132463220-132463242 ATTGTTCTTCCCAGGGGAGGAGG + Intronic
1033085001 7:138333156-138333178 GCTTTACTTCCAAAGGGAGCTGG + Intergenic
1033280970 7:140006099-140006121 CCTCTTTTTCCCAGAGCAGCAGG - Intronic
1033392340 7:140940015-140940037 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1033491887 7:141852489-141852511 GCACCTCTTCTCAGGGCAGCAGG + Intergenic
1033878956 7:145857999-145858021 GCACATCTTCACAGGGCAGCAGG + Intergenic
1034016281 7:147590467-147590489 GCACCTCTTCACAGGGCAGCAGG - Intronic
1034391802 7:150793027-150793049 GCTCTTTTTTCCCAGGGAGCTGG - Intronic
1034742731 7:153493874-153493896 ATTCTTCTTCACAGGGCAGCAGG - Intergenic
1034821655 7:154221721-154221743 TCTCTTCATTCCAGGGAAGCTGG + Intronic
1035073146 7:156159378-156159400 GCTCTTCTTCCCAGGTGTGTGGG + Intergenic
1035121563 7:156572805-156572827 CCTCCTCCTCCCAAGGGAGCGGG + Intergenic
1035340523 7:158157780-158157802 GCACTCTCTCCCAGGGGAGCAGG - Intronic
1035766010 8:2105960-2105982 GCACTTCTTCACAGGGCGGCAGG + Intronic
1035826032 8:2645072-2645094 GCCCTCTTTCCCAGGGAAGCTGG - Intergenic
1036092842 8:5687243-5687265 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1036630001 8:10505731-10505753 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1037298850 8:17430744-17430766 GATCTTCTTCACATGGCAGCAGG + Intergenic
1038447274 8:27612775-27612797 GCTCTTCCACCCAGGGCAGCTGG - Intronic
1038954397 8:32451454-32451476 GCCCTTTTTCCCCGGGGAGGGGG + Intronic
1039842161 8:41301877-41301899 CATCTTCTTCCCACGGCAGCAGG - Intronic
1040449864 8:47534122-47534144 GCACCTCTTCACAGGGCAGCAGG - Intronic
1040504786 8:48037369-48037391 CCTCTTCTCCCCAGGGCAGTGGG + Intronic
1041341039 8:56845638-56845660 GCACTTCTTCACAGGGCAGCAGG + Intergenic
1041921483 8:63187077-63187099 GCTCCTCGTAACAGGGGAGCAGG + Exonic
1042601587 8:70504083-70504105 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1043144402 8:76634259-76634281 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1044016988 8:87057280-87057302 GTTCTTCTTCACATGGCAGCAGG + Intronic
1044164128 8:88959500-88959522 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1044254078 8:90039364-90039386 GCACCTCTTCACAGGGCAGCAGG + Intronic
1044275680 8:90297008-90297030 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1044925778 8:97207690-97207712 GCTCAGCTAACCAGGGGAGCTGG - Intergenic
1045076324 8:98573358-98573380 GCACCTCTTCACAGGGCAGCAGG + Intronic
1045326121 8:101119006-101119028 GCTCATCTCCCCAGGGAGGCTGG + Intergenic
1046599401 8:116298553-116298575 GCCCTCCTTCCCAGGGGTTCGGG - Intergenic
1047875447 8:129132228-129132250 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1047939461 8:129815155-129815177 GCCCTTCTTCACATGGCAGCAGG - Intergenic
1048588898 8:135802841-135802863 GCTCTGCAACCCAGGGAAGCAGG + Intergenic
1049249369 8:141580000-141580022 GCTCTCTTTTCCAGGGGAGAGGG - Intergenic
1049516960 8:143064934-143064956 GCTCGTCTGCCCAGGTGAGATGG + Intergenic
1049601445 8:143509613-143509635 GCTCTGCGTCCCAGAGCAGCAGG - Intronic
1049981949 9:912111-912133 TCTCTTCTTCACAAGGCAGCAGG + Intronic
1050385621 9:5087251-5087273 GCACCTCTTCACAGGGCAGCAGG + Intronic
1051618860 9:19032193-19032215 TATCTGCTTCCCAGGGCAGCTGG - Intronic
1052256662 9:26465449-26465471 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1052282403 9:26748227-26748249 GTCCTTCTTCACAGGGCAGCAGG - Intergenic
1052502399 9:29308305-29308327 CATCTTCTTCACAGGGCAGCAGG + Intergenic
1052603528 9:30670944-30670966 GCTCTTCTTAACAGGCGGGCAGG - Intergenic
1053045798 9:34916029-34916051 GCACCTCTTCACAGGGAAGCAGG - Intergenic
1053201004 9:36151589-36151611 TCCCCTCTTCCCAGGGGAGAGGG + Intronic
1055017951 9:71639345-71639367 ACTATTCATCCCAGAGGAGCTGG + Intergenic
1055331889 9:75193191-75193213 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1055561827 9:77528945-77528967 GCTCTTGTTCCCTGGGGTGTGGG - Intronic
1055850423 9:80621651-80621673 ACACCTCTTCCCAGGGCAGCAGG - Intergenic
1056005172 9:82261780-82261802 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1056743102 9:89276998-89277020 GCACCTCTTCACAGGGTAGCAGG + Intergenic
1056847340 9:90052122-90052144 TCTTTTCTTCCCAGAGGGGCTGG + Intergenic
1056880725 9:90390881-90390903 GCCCCTCTTCACAGGGCAGCAGG + Intergenic
1056943976 9:90978027-90978049 GCTCTTCTCCCAAGGAGAGCTGG - Intergenic
1057642090 9:96834311-96834333 GCACCTCTTCACAGGGCAGCAGG - Intronic
1060735331 9:126063204-126063226 GCTATTAATCCCAGGAGAGCTGG + Intergenic
1060928188 9:127470298-127470320 GCACCTCTTCACAGGGCAGCAGG + Intronic
1060980423 9:127788530-127788552 GCTCTTCTTCCCAGGGGAGCGGG + Exonic
1062385889 9:136311389-136311411 CCTCCCCTACCCAGGGGAGCTGG + Intergenic
1185880565 X:3736268-3736290 GCTCTTCTGCGCAGAGGAGGGGG - Intergenic
1186002294 X:5026375-5026397 GTACTTCTTCACAGGGCAGCAGG - Intergenic
1186433759 X:9526498-9526520 GCTCTGCTTCCCAGGGACCCCGG - Intronic
1186679155 X:11854097-11854119 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1188062347 X:25617291-25617313 GCACCTCTTCACAGGGGGGCAGG + Intergenic
1188753998 X:33937609-33937631 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1189413470 X:40793668-40793690 GGTTTTCCTCCCATGGGAGCTGG - Intergenic
1189877835 X:45455184-45455206 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1190528205 X:51349158-51349180 GCTCTTGTTCACAGGGCATCTGG - Intergenic
1192284792 X:69723870-69723892 CCTATTCTTCCCAGAGGAGGGGG - Intronic
1192378988 X:70594825-70594847 GCACCTCTTCACAGGGTAGCAGG - Intronic
1193222800 X:78946502-78946524 GCTGTGCTTTCCAGGGGAGTAGG + Intronic
1193471168 X:81906444-81906466 GCACTTCTTCACAGGGTGGCAGG + Intergenic
1193482890 X:82048891-82048913 GCACTTCTTCACAGGGCAACAGG - Intergenic
1193787775 X:85781424-85781446 GCACCACTTCCCAGGGGAGAAGG - Intergenic
1193897848 X:87135332-87135354 GCCCCTCTTCACAGGGCAGCAGG + Intergenic
1194249957 X:91562649-91562671 CCTCTTCATCTCAGGGGACCTGG - Intergenic
1194522605 X:94936744-94936766 GCACCTCTTCACAGGGTAGCAGG - Intergenic
1194582715 X:95696617-95696639 GCACCTCTTCACAGGGTAGCAGG - Intergenic
1194892632 X:99398776-99398798 GCGCTTCAGCCCAGGGGGGCGGG + Intergenic
1195152347 X:102084787-102084809 GCTCTTCTTACCAGGACACCAGG + Intergenic
1195428710 X:104763653-104763675 GCTCTTCTTCACATGGCAGCAGG + Intronic
1195820992 X:108944882-108944904 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1196543499 X:116936739-116936761 GCACCTCTTCCCAGGGCAGCAGG + Intergenic
1197645338 X:129011038-129011060 GCTTTCCTTTCCTGGGGAGCTGG - Intergenic
1198780885 X:140234259-140234281 GCACCTCTTCACAGGGCAGCAGG - Intergenic
1198880432 X:141274805-141274827 GCACCTCTTCACAGGGCAGCAGG + Intergenic
1199070266 X:143468176-143468198 GTTCTTCTTCGCAGGGTGGCAGG + Intergenic
1200013654 X:153140975-153140997 GCTCTTCTTTCCATGTGACCTGG - Intergenic
1200025947 X:153258943-153258965 GCTCTTCTTTCCATGTGACCTGG + Intergenic
1200210549 X:154345045-154345067 GCTGTTCTTCCCGCGGGATCGGG - Intergenic
1200220303 X:154387047-154387069 GCTGTTCTTCCCGCGGGATCGGG + Intergenic
1202062733 Y:20904512-20904534 GCTTTACTTCCAAGGGAAGCTGG - Intergenic