ID: 1060980626

View in Genome Browser
Species Human (GRCh38)
Location 9:127789523-127789545
Sequence GAGTTTGAGCGCGTCTTCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060980622_1060980626 -6 Left 1060980622 9:127789506-127789528 CCACCACCAACCAGACGGAGTTT 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1060980626 9:127789523-127789545 GAGTTTGAGCGCGTCTTCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1060980614_1060980626 27 Left 1060980614 9:127789473-127789495 CCCAGCAGTCCACCAACCAGAGT 0: 1
1: 0
2: 0
3: 10
4: 146
Right 1060980626 9:127789523-127789545 GAGTTTGAGCGCGTCTTCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1060980615_1060980626 26 Left 1060980615 9:127789474-127789496 CCAGCAGTCCACCAACCAGAGTC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1060980626 9:127789523-127789545 GAGTTTGAGCGCGTCTTCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1060980620_1060980626 -2 Left 1060980620 9:127789502-127789524 CCCGCCACCACCAACCAGACGGA 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1060980626 9:127789523-127789545 GAGTTTGAGCGCGTCTTCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1060980617_1060980626 15 Left 1060980617 9:127789485-127789507 CCAACCAGAGTCGCAATCCCGCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1060980626 9:127789523-127789545 GAGTTTGAGCGCGTCTTCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1060980623_1060980626 -9 Left 1060980623 9:127789509-127789531 CCACCAACCAGACGGAGTTTGAG 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1060980626 9:127789523-127789545 GAGTTTGAGCGCGTCTTCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1060980618_1060980626 11 Left 1060980618 9:127789489-127789511 CCAGAGTCGCAATCCCGCCACCA 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1060980626 9:127789523-127789545 GAGTTTGAGCGCGTCTTCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1060980616_1060980626 18 Left 1060980616 9:127789482-127789504 CCACCAACCAGAGTCGCAATCCC 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1060980626 9:127789523-127789545 GAGTTTGAGCGCGTCTTCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1060980621_1060980626 -3 Left 1060980621 9:127789503-127789525 CCGCCACCACCAACCAGACGGAG 0: 1
1: 0
2: 1
3: 44
4: 279
Right 1060980626 9:127789523-127789545 GAGTTTGAGCGCGTCTTCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060980626 Original CRISPR GAGTTTGAGCGCGTCTTCTG AGG Exonic
918758576 1:188371224-188371246 GAGTTTGAAAGTGTTTTCTGGGG - Intergenic
921939803 1:220827883-220827905 GAGGTTGATCTCTTCTTCTGGGG + Intergenic
1075618083 10:123905867-123905889 GGGCTTGAGCGTGTCTCCTGAGG - Intronic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1097058166 12:56263053-56263075 AAGTTTGAGCCCATCTTCTCTGG - Intergenic
1098398154 12:70044042-70044064 GAGTTTGATCATGTCTGCTGAGG - Intergenic
1112807572 13:103179899-103179921 GAATTTGAGCGGGACCTCTGTGG + Intergenic
1119999124 14:79282700-79282722 GAGTCTGAGGGCCTTTTCTGGGG - Intronic
1146020150 17:29271152-29271174 GAGTTTGATCATGACTTCTGAGG + Intronic
1148990523 17:51662397-51662419 GAGGTTAAGCACCTCTTCTGAGG + Intronic
1160577068 18:79862828-79862850 GAGTTTGAGCCAGTCTTCCACGG + Intergenic
1161798250 19:6400207-6400229 GAGTTTGAGCGCATCGTGAGTGG + Intergenic
1168092257 19:54093818-54093840 GAGACTGAGCGGGTCTTCCGGGG - Intergenic
926087203 2:10028001-10028023 TAGCTGGAGCGCGTCTCCTGTGG + Intergenic
927978298 2:27356964-27356986 GAGTTCCAGGGCGTCTTCAGCGG + Intronic
928392403 2:30919671-30919693 GCCTTTGAGCGTGTCCTCTGAGG + Intronic
933503209 2:83142927-83142949 GACTTTGAGCACCTGTTCTGAGG - Intergenic
935244762 2:101208400-101208422 GTCTTTGAGCGTGTCTTCTCTGG - Intronic
937236313 2:120433634-120433656 GAGTGTGGGCCTGTCTTCTGGGG - Intergenic
938596009 2:132787905-132787927 GAGGTTGAGCATGTCTTCTTGGG - Intronic
944417278 2:199491435-199491457 GAGTCTGAGCACGCCTTATGGGG + Intergenic
946292349 2:218754798-218754820 GAATTTGAGGGGGTCTTCTGAGG + Exonic
1168883609 20:1226767-1226789 GAGTTTGTGTGCGTATTTTGTGG + Intronic
1173174205 20:40752022-40752044 GACTCTGAGCGCCTCTTCAGTGG - Intergenic
1176002987 20:62842075-62842097 GAATTTGAGAGCGTATTTTGCGG - Exonic
1176743598 21:10630915-10630937 GAGTTTGTCCGGGACTTCTGAGG - Intergenic
1184724303 22:46334693-46334715 CAGTTTGAGCACGTGTTCTCAGG - Intronic
953519258 3:43625609-43625631 GAGTTCGAGAGCATCTTCTCAGG + Intronic
963540660 3:146583402-146583424 GAGTTGGAGCCTGTATTCTGGGG + Intronic
963778507 3:149464067-149464089 GAGGGTGTGCGCGTCTCCTGGGG + Intergenic
966000485 3:174943604-174943626 GAGTTTTTGCTTGTCTTCTGGGG + Intronic
967833497 3:193942153-193942175 GAATTTCAGCGGGTCTTCAGGGG + Intergenic
969562577 4:7959055-7959077 GACTTTCAGTGAGTCTTCTGTGG + Intergenic
970610963 4:17724979-17725001 GAGATTGAGAGCCACTTCTGGGG - Intronic
973609410 4:52620238-52620260 GTGTCTGAGCCCATCTTCTGAGG + Intronic
976721016 4:88168893-88168915 GAGCTTGAGGGAGGCTTCTGTGG - Intronic
987813379 5:22868833-22868855 GAGTTTGAGACTGTCCTCTGAGG - Intergenic
988711254 5:33778189-33778211 GACTATGAGGGGGTCTTCTGAGG - Intronic
997399238 5:133589653-133589675 GAGTTTGAGGTGGTCTTCTGGGG - Intronic
998838596 5:146229003-146229025 GATTCTGAACGAGTCTTCTGGGG - Exonic
1006014507 6:31069096-31069118 GAGATTGAGCGCCACTTCTGAGG + Intergenic
1008622909 6:53289277-53289299 GAGTTAGAGCCATTCTTCTGTGG - Intronic
1009056178 6:58338290-58338312 GAGTTTCAGGTCATCTTCTGTGG + Intergenic
1009235004 6:61112309-61112331 GAGTTTCAGGTCATCTTCTGTGG - Intergenic
1026214889 7:68339736-68339758 GAGTTTCAACACCTCTTCTGGGG + Intergenic
1026311457 7:69188939-69188961 GTGATTGAGGGCGTCTACTGTGG - Intergenic
1060980626 9:127789523-127789545 GAGTTTGAGCGCGTCTTCTGAGG + Exonic
1186884064 X:13895083-13895105 GAATTTGAGAGTGTCTACTGGGG + Intronic