ID: 1060981647

View in Genome Browser
Species Human (GRCh38)
Location 9:127795827-127795849
Sequence TCGAACTGCTGTGTGACCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 241}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060981647_1060981657 18 Left 1060981647 9:127795827-127795849 CCCATGGTCACACAGCAGTTCGA 0: 1
1: 0
2: 4
3: 27
4: 241
Right 1060981657 9:127795868-127795890 TGACCAGACAGGTGGTGGTAAGG No data
1060981647_1060981651 -6 Left 1060981647 9:127795827-127795849 CCCATGGTCACACAGCAGTTCGA 0: 1
1: 0
2: 4
3: 27
4: 241
Right 1060981651 9:127795844-127795866 GTTCGACAGCAGAGAGGGCCAGG No data
1060981647_1060981652 -5 Left 1060981647 9:127795827-127795849 CCCATGGTCACACAGCAGTTCGA 0: 1
1: 0
2: 4
3: 27
4: 241
Right 1060981652 9:127795845-127795867 TTCGACAGCAGAGAGGGCCAGGG No data
1060981647_1060981653 7 Left 1060981647 9:127795827-127795849 CCCATGGTCACACAGCAGTTCGA 0: 1
1: 0
2: 4
3: 27
4: 241
Right 1060981653 9:127795857-127795879 GAGGGCCAGGGTGACCAGACAGG No data
1060981647_1060981654 10 Left 1060981647 9:127795827-127795849 CCCATGGTCACACAGCAGTTCGA 0: 1
1: 0
2: 4
3: 27
4: 241
Right 1060981654 9:127795860-127795882 GGCCAGGGTGACCAGACAGGTGG No data
1060981647_1060981659 25 Left 1060981647 9:127795827-127795849 CCCATGGTCACACAGCAGTTCGA 0: 1
1: 0
2: 4
3: 27
4: 241
Right 1060981659 9:127795875-127795897 ACAGGTGGTGGTAAGGTGCAAGG No data
1060981647_1060981656 13 Left 1060981647 9:127795827-127795849 CCCATGGTCACACAGCAGTTCGA 0: 1
1: 0
2: 4
3: 27
4: 241
Right 1060981656 9:127795863-127795885 CAGGGTGACCAGACAGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060981647 Original CRISPR TCGAACTGCTGTGTGACCAT GGG (reversed) Intronic
900854017 1:5166157-5166179 TCGACCAGCTGTGTGTCCTTGGG - Intergenic
901932177 1:12602759-12602781 GTGACCTGCTGTGTGACCTTGGG - Intronic
902382113 1:16057661-16057683 TTGACCAGCTGTGTGAGCATTGG + Intergenic
902566348 1:17314159-17314181 TCCACCTGCTGTGTGCCCCTCGG + Intronic
902696868 1:18146026-18146048 TGGCTCTGCTGTGTGACCTTTGG + Intronic
902761084 1:18581202-18581224 TTAAACAGCTGTGTGACCTTGGG - Intergenic
902897362 1:19488080-19488102 TCTCTCTGCTGTGTGACCTTGGG - Intergenic
903035263 1:20488767-20488789 CAGAACTTCTGTGTGACCCTGGG - Intergenic
903064270 1:20689963-20689985 TTTACCAGCTGTGTGACCATGGG + Intronic
903070562 1:20725030-20725052 AGGAGCTGCTGTGTGACCCTGGG + Intronic
903292159 1:22321138-22321160 TTGACCTACTGTGTGACCTTGGG - Intergenic
903326104 1:22569474-22569496 ACTAACTGCTGTGTGCCCTTGGG - Intronic
903460044 1:23514450-23514472 TCAACTTGCTGTGTGACCTTAGG + Intronic
903734755 1:25523045-25523067 TCCAGCAGCTGTGTGACCTTGGG + Intergenic
903860648 1:26362520-26362542 TCAACTTGCTGTGTGACCTTTGG - Intronic
904256050 1:29255462-29255484 CCCACCTGCTGTGTGACCTTGGG + Intronic
904673331 1:32181869-32181891 ACTACCTGCTGTGTGACCTTGGG + Intronic
904755494 1:32766442-32766464 TCCTACTGCTGGGTGACCTTAGG + Intronic
904904535 1:33885142-33885164 TTACACTGCTGTGTGACCTTTGG - Intronic
905234628 1:36537597-36537619 TCTCATTGCTGTGTGACCTTGGG - Intergenic
905777339 1:40677350-40677372 TCAACCTGCTTTGTGACCTTGGG - Intergenic
905888776 1:41507037-41507059 CCGATCTGCCGTGTGACCAGGGG - Exonic
906285597 1:44585726-44585748 TGGCTCTGCTGTGTGACCTTGGG + Intronic
906551124 1:46667497-46667519 CCAAACAGCTGTGTGACCTTTGG + Intronic
906649497 1:47502822-47502844 TCCCACTGCTGTGTGAACTTGGG - Intergenic
906975790 1:50571378-50571400 TTTAGCAGCTGTGTGACCATGGG + Intronic
907193321 1:52666516-52666538 ACCACCTGCTGTGTGACCTTAGG + Intronic
907251861 1:53144977-53144999 TCAACCAGCTGTGTGACCTTGGG + Intergenic
907304066 1:53504164-53504186 CCGATGTGCTGTGTGACAATGGG + Intergenic
907386706 1:54130209-54130231 TTGATTTGCTGTGTGACCTTGGG + Intergenic
910167892 1:84347113-84347135 CCAAACTGCTATGTGACCCTGGG - Intronic
913140303 1:115934649-115934671 ATTAACTGCTGTGTGACCTTAGG + Intergenic
915272946 1:154768084-154768106 TCATGCTGCTGTGTGACCCTGGG + Intronic
915482552 1:156196976-156196998 TTGACCAGCTGTGTGACCTTGGG + Intronic
915730491 1:158050373-158050395 TTGACCAGCTGTGTGACCTTGGG - Intronic
916205135 1:162308932-162308954 TGCAGCAGCTGTGTGACCATGGG - Intronic
916391453 1:164335321-164335343 TTGACTTGCTGTGTGACCTTGGG + Intergenic
918063698 1:181085091-181085113 TCTCACTGCTGTGTGACCTTTGG - Intergenic
918992403 1:191714565-191714587 TCTCACTGCTGTGTGACGATTGG + Intergenic
919980555 1:202640387-202640409 TAGACTTGCTGTGTGACCTTAGG - Intronic
920309068 1:205037972-205037994 TTGATTGGCTGTGTGACCATAGG - Intergenic
920918422 1:210277368-210277390 TCAAATTGCTCTGTGACCATGGG - Intergenic
921624966 1:217369917-217369939 TAGAAATTCTGTGTGACCTTTGG + Intergenic
1069019348 10:63467801-63467823 ATGATCTGCTTTGTGACCATGGG + Intergenic
1069558628 10:69414156-69414178 CCCAGCTGCTGTGTGACCCTGGG - Intronic
1069856114 10:71442172-71442194 TAGAATTGCTGGGTGACCTTGGG - Intronic
1070658719 10:78289542-78289564 TCCCACAGCTGTGTGACCTTGGG - Intergenic
1072626557 10:97116031-97116053 TTCACCTGCTGTGTGACCTTGGG + Intronic
1073278078 10:102330247-102330269 TCCACTTGCTGTGTGACCTTGGG + Intronic
1073297170 10:102447976-102447998 TGGGTCTGCTGTGTGACCTTGGG - Intergenic
1073473805 10:103739973-103739995 TGGGACTGCTGTGTGCTCATCGG + Intronic
1073641520 10:105257035-105257057 TTGAACTTCTGTTTGACAATGGG + Intronic
1079062742 11:17263755-17263777 TCCAACTGCTGTGTGAAGAATGG + Intronic
1079108819 11:17592013-17592035 ACTGACTGCTGTGTGACCTTGGG - Intronic
1080279763 11:30543354-30543376 TCAATCAGCTGTGTGACCCTGGG + Intronic
1081858463 11:46318411-46318433 GCCACCTGCTGTGTGACCAGGGG + Intronic
1084574655 11:69981271-69981293 ACTTACTGCTGTGTGACCTTGGG + Intergenic
1084577145 11:69996665-69996687 CCAAACTGCTGTGTGACCTGAGG - Intergenic
1084904825 11:72337573-72337595 TTTATCTGCTGTATGACCATGGG - Intronic
1086437378 11:86795643-86795665 TAGAGGTGCTGTGTGACCTTGGG - Intronic
1088697434 11:112380463-112380485 CAGAACTGCAGGGTGACCATAGG + Intergenic
1089330142 11:117683564-117683586 TCCACCAGCTGTGTGACCTTGGG - Intronic
1089341581 11:117761510-117761532 TCTTACTGCTATGTGACCTTGGG + Intronic
1091289031 11:134426875-134426897 TTGGCTTGCTGTGTGACCATTGG + Intergenic
1091643468 12:2255116-2255138 CTGACCTGCTGTGTGACCTTGGG + Intronic
1095593448 12:43932579-43932601 TCAAACTGTTGTGTGACTATTGG + Intronic
1096613198 12:52816468-52816490 ACGTGCTGCTGTGTGACCCTGGG - Intergenic
1096619781 12:52857004-52857026 GGGATCTGCTGTGTGACCTTAGG - Intergenic
1099474090 12:83086482-83086504 ACAAACTGCTGTGTGACCTTGGG + Intronic
1101085011 12:101226846-101226868 TGGAAATGTTGTGTGGCCATAGG - Intergenic
1101838089 12:108309019-108309041 CAGCTCTGCTGTGTGACCATGGG + Intronic
1102200311 12:111053431-111053453 GGGAAATGCTGTGTGTCCATGGG - Intronic
1102252034 12:111394063-111394085 TAGACCTGCTGTGTGACCTTGGG - Intergenic
1102257575 12:111425119-111425141 CCGACCTGCTGTGTGACCGCGGG + Intronic
1102464009 12:113117418-113117440 TCTAGCAGCTGTGTGACCTTGGG - Intronic
1102465976 12:113131056-113131078 TGGACTTGCTGTGTGACCCTGGG - Intronic
1102511540 12:113418755-113418777 TGCTACTGCTGTGTGACCTTGGG + Intronic
1102785814 12:115603832-115603854 TCTAATTGCTGTGTGACTTTGGG + Intergenic
1102998658 12:117368481-117368503 TCCATCTGCTGTGTGACCTTGGG + Intronic
1103198183 12:119064582-119064604 TTAACCTGCTGTGTGACCTTAGG + Intronic
1106255305 13:28017053-28017075 TCCACATGCTGTGTAACCATGGG + Intronic
1106446859 13:29841901-29841923 TGGAGCTGCAGTGTGGCCATAGG - Intronic
1107840588 13:44452659-44452681 GCCAGCTGCTGAGTGACCATGGG + Intronic
1108717276 13:53093317-53093339 TTGAACTGCATTGTGACAATGGG - Intergenic
1113127528 13:106996661-106996683 GCAAACTGCTGCGTGTCCATAGG + Intergenic
1113290897 13:108905164-108905186 TCGAACTGCAGGTTGGCCATCGG + Intronic
1115282835 14:31684135-31684157 TCTAATAGCTGTGTGACCTTGGG + Intronic
1116457572 14:45136464-45136486 TCGATCTGCTGTGTCACCAAGGG - Exonic
1119468073 14:74875388-74875410 TGCAGCTGCTGTGTGACCTTGGG - Intergenic
1120545116 14:85801490-85801512 TTTAACTGCTGTGTGACCTTGGG - Intergenic
1121246097 14:92461894-92461916 CAGAGCTGCTGGGTGACCATGGG - Intronic
1121423276 14:93830830-93830852 TTGACCTGCTGTGTGGCCTTGGG + Intergenic
1121879195 14:97484903-97484925 TCAAAAAGCTGTGTGACCCTGGG - Intergenic
1124496247 15:30189209-30189231 TAGACTTGCTGTGTGACCTTAGG - Intergenic
1124747327 15:32349438-32349460 TAGACTTGCTGTGTGACCTTAGG + Intergenic
1126930263 15:53640165-53640187 TCTAACCTCTGTGTGACCAGAGG + Intronic
1127807240 15:62532758-62532780 TTTACCTGCTGTGTGACCTTGGG + Intronic
1127976278 15:63999455-63999477 CTGAACTGCTTTGTGACCTTGGG - Intronic
1128823683 15:70687774-70687796 TACAGCTGCTTTGTGACCATGGG - Exonic
1129324382 15:74792447-74792469 TCAACTTGCTGTGTGACCTTGGG - Intronic
1129513049 15:76138968-76138990 CTGATCTGCTGTGTGACCCTAGG - Intronic
1129738492 15:77978588-77978610 CCAACCTGCTGTGTGACCGTGGG - Intergenic
1131972150 15:97903727-97903749 TAGAATTGCTGTGTGACCTTGGG + Intergenic
1133035922 16:3034244-3034266 TCGTCCAGCTGTGTGACCCTGGG - Intronic
1133461305 16:5988948-5988970 TGCATCTGCTGTGTGACCTTGGG + Intergenic
1133603090 16:7359152-7359174 TGCAAATGCTGTGTGACCTTTGG + Intronic
1135534383 16:23281819-23281841 TTTAATTGCTGTGTGACCTTGGG + Intronic
1137378272 16:47973772-47973794 TCGGATTGCTGTGTGACCTCGGG + Intergenic
1138289540 16:55835225-55835247 TTGAGTTGCTGTGTGACCTTAGG - Intergenic
1138583447 16:57956215-57956237 TCGATTTGCTCTGTGACCCTGGG + Intronic
1139318658 16:66095128-66095150 ACGATTTGCTGTGTGACCTTGGG - Intergenic
1141482361 16:84315024-84315046 TCTGCCTGCTGTGTGACCTTGGG - Intronic
1141598830 16:85113328-85113350 CCGCTCTGCTGTGTGACCTTGGG + Intergenic
1141691670 16:85600236-85600258 GCAAACTGCTTTGTGACCTTGGG - Intergenic
1143137678 17:4720821-4720843 TCGAACAGCAGTGGGACCAGAGG - Intronic
1143365624 17:6406667-6406689 CGGACCTGCTGTGTGACCTTGGG + Intronic
1144472489 17:15557167-15557189 TCCAAGTGCTGTGGGAACATGGG - Intronic
1144764900 17:17727305-17727327 AGCAACTGCTGTGTGACCTTGGG - Intronic
1144923990 17:18787521-18787543 TCCAAGTGCTGTGGGAACATGGG + Intronic
1145258706 17:21342165-21342187 CCTACCTGCTGTGTGACCTTGGG - Intergenic
1145317923 17:21745839-21745861 CCTACCTGCTGTGTGACCTTGGG + Intergenic
1145907872 17:28526181-28526203 TCGACTTGCTGGGTGACCTTGGG + Intronic
1146124648 17:30221806-30221828 TGGAACTGCTGAGTACCCATTGG + Exonic
1146942192 17:36850992-36851014 TTGACTTGCTGTGTGACCTTGGG + Intergenic
1147004515 17:37391375-37391397 TCTAACAGCTGTGTAACCTTGGG - Intronic
1147041650 17:37723926-37723948 ACTTACTGCTGTGTGACCTTGGG - Intronic
1147339306 17:39744421-39744443 TCTATTTGCTGTGTGACCCTGGG + Intronic
1147911278 17:43857712-43857734 ACCACCTGCTGTGTGACCATGGG - Intronic
1148083999 17:44983445-44983467 TCTAACTGCTGCATGACCTTAGG - Intergenic
1148215615 17:45832720-45832742 GCGAACTGCTGGGTGCCCACTGG + Intronic
1148219591 17:45852072-45852094 TCCCATTGCTGTGTGACCTTGGG - Intergenic
1149580537 17:57747351-57747373 TGGAATTGCTGTGTGACCCTAGG + Intergenic
1150332108 17:64302679-64302701 TCAACCAGCTGTGTGATCATGGG + Intergenic
1151343998 17:73490415-73490437 TCCACTTGCTGTGTGACCTTAGG + Intronic
1151826008 17:76524787-76524809 TCTCACTGCTATGTGACCTTGGG - Intergenic
1156571339 18:38256980-38257002 TATACCTGCTGTGTGACCCTAGG + Intergenic
1157501114 18:48191329-48191351 TCGACCAGCTGTGTGACATTGGG + Intronic
1158366971 18:56747247-56747269 TTGACTTGCTGTGTGACCTTAGG + Intronic
1161484680 19:4528965-4528987 CTGATCTGCTGTGTGACCTTGGG + Exonic
1161994677 19:7704818-7704840 TTGAAGTGCTGTGTGACCTTTGG + Intergenic
1162001668 19:7748126-7748148 TCTACCAGCTGTGTGACCTTGGG - Intergenic
1162015730 19:7845605-7845627 TCAACCAGCTGTGTGACCTTGGG - Intronic
1163467475 19:17476715-17476737 TCAAATTGCTCTGTGACCTTGGG + Intronic
1164521577 19:28983893-28983915 AGGAGCTGCTGTGTGACCTTGGG - Intergenic
1165891108 19:39112722-39112744 ACCAATTCCTGTGTGACCATGGG + Intergenic
1166661293 19:44649010-44649032 GCTTACAGCTGTGTGACCATGGG + Intronic
1168468890 19:56625218-56625240 TCCAGCAGCTGTGTGACCTTGGG - Exonic
926212481 2:10880952-10880974 TGGACCTGCCGTGTGACCTTTGG + Intergenic
928138530 2:28707370-28707392 TCTAGCAGCTGTGTGATCATGGG - Intergenic
928366568 2:30707502-30707524 TTGACTTGCTGTGTGACCTTGGG - Intergenic
929117744 2:38458370-38458392 TCCAGCTTCTGTGTGACCATGGG + Intergenic
931245104 2:60485802-60485824 TGGAATTGCTGTGTGACCTTTGG - Intronic
931268596 2:60682384-60682406 TCTAACTGTTGTGTGCCCTTGGG - Intergenic
932012441 2:67992134-67992156 TCTACCAGCTATGTGACCATGGG + Intergenic
932123562 2:69123361-69123383 ACTCACTGCTGTGTGACCTTAGG - Intronic
934914686 2:98291626-98291648 TCCCACTGCTGTGTGAAGATTGG + Intronic
935528208 2:104198921-104198943 TCAAATTCCTGTGTGACCTTGGG + Intergenic
938086235 2:128403974-128403996 TCCTTCTGCTGTGTGACCTTGGG + Intergenic
939141211 2:138356887-138356909 CTTAACAGCTGTGTGACCATAGG - Intergenic
939263376 2:139838618-139838640 TCAAATTGCTGTGTGACCTTAGG - Intergenic
939717092 2:145597886-145597908 TCTGAATGCTTTGTGACCATTGG + Intergenic
939931364 2:148237870-148237892 TCTACCAGCTGTGTGACCATGGG + Intronic
942993796 2:182236572-182236594 ACTCACTGCTGTGTGACCTTTGG + Intronic
946522370 2:220480662-220480684 TCAAACTTCTGGGTGACTATAGG + Intergenic
946819158 2:223612698-223612720 TGGGTCTGCTGTGTGACCTTAGG + Intergenic
948695359 2:239730428-239730450 TCCAACTGCTGTGTGACCTTGGG + Intergenic
948695373 2:239730520-239730542 TCCAACTGCTGTGTGACCTTGGG + Intergenic
948695388 2:239730612-239730634 TCCAACTGCTGTGTGACCTTGGG + Intergenic
948695404 2:239730711-239730733 TCCAACCGCTGTGTGACCTTGGG + Intergenic
1168805740 20:671449-671471 TGGGTCTGCTGTGTGTCCATGGG + Intronic
1168978478 20:1985635-1985657 TCGAATTGCTATGTGACCTCAGG - Intronic
1170140791 20:13123510-13123532 ACTTACTGCCGTGTGACCATGGG - Intronic
1171279297 20:23882533-23882555 TCCAGCTGCTGGGTGACCTTGGG + Intergenic
1172032255 20:31990395-31990417 CAGACCTGCTGTGTGACCTTGGG - Intronic
1172636652 20:36414565-36414587 TCCACCTGCTGTGTGACCTTGGG + Intronic
1172875311 20:38160562-38160584 CCTACCTGCTGTGTGACCTTAGG - Intronic
1173062029 20:39671682-39671704 TCCACCTACTGTGTGACCTTGGG + Intergenic
1173539385 20:43840115-43840137 CTGAACTGCTGTGTGACCATGGG + Intergenic
1173932384 20:46831612-46831634 TGCCACTGCTGTGTGACCTTGGG - Intergenic
1175393027 20:58639086-58639108 CTGAGCTGCTGTGTGACCTTGGG + Intergenic
1175768302 20:61606387-61606409 TTGACCTGCTGTGTGACTCTGGG - Intronic
1178877589 21:36424734-36424756 GCCAATTGCTGTGTGACCAAGGG + Intergenic
1181457171 22:23066408-23066430 ACCATCTGCTGTGTGACCTTAGG - Intronic
1181822364 22:25486056-25486078 TAGATTTGCTGTGTGACCCTGGG - Intergenic
1181878149 22:25956106-25956128 TCTTACTCCTGTGTGACCCTGGG - Intronic
1182075004 22:27489478-27489500 TCAATTTGCTGTGTGACCTTGGG - Intergenic
1182306840 22:29375690-29375712 ACCAACAGCTGTGTGACCCTGGG + Intronic
1182540887 22:31041099-31041121 TGGAACTGTTGGGTGACCGTTGG + Intergenic
1182662581 22:31935459-31935481 CTAACCTGCTGTGTGACCATGGG + Intronic
1184199805 22:42960440-42960462 TCGTGCTGCTGAGAGACCATGGG - Intronic
1184261012 22:43316255-43316277 TCTATCAGCTGTGTGACCTTTGG - Intronic
1184368913 22:44070215-44070237 CCGATCTGCGGTGTGACCTTGGG - Intronic
1184609397 22:45593043-45593065 TCGACCAGCTGTGTGACCTTGGG - Intronic
1184655120 22:45937186-45937208 CTGAGCTGCTGTGTGACCTTGGG - Intronic
953373547 3:42409713-42409735 TCCAACTGCTGTGTGGGCAGTGG - Intronic
953404880 3:42655121-42655143 ACCAACTCCTGTGTGACCTTGGG + Intronic
954170261 3:48796181-48796203 TGTAACAGCTGTGTGACCAGAGG + Intronic
960373684 3:116872059-116872081 TCACTCTGCTGTGTGACTATGGG + Intronic
961117835 3:124346985-124347007 TCAATCTGCTGTGAGTCCATGGG - Intronic
961660905 3:128468354-128468376 TGGTACTGCTGTGTGACCTTCGG - Intergenic
964673925 3:159256561-159256583 TTTACCTGCTGTGTGACCTTGGG + Intronic
966579182 3:181540452-181540474 TGTAATTGCTGTGTGACCTTGGG - Intergenic
973832579 4:54776468-54776490 CCTAATTGCTGTGTGACCTTTGG - Intergenic
973983006 4:56322512-56322534 ACTAACTGCTGAGTGACCATGGG + Intronic
976812852 4:89115527-89115549 TGCAGCTGCTGTGTGACCATCGG + Intergenic
978660194 4:111117397-111117419 TGTAACTGCTGTGTTACCAAGGG + Intergenic
984943564 4:184954223-184954245 TCGGACTTGTGTGTGACAATGGG + Intergenic
985422281 4:189796118-189796140 TGGTACTGCTGTGGGAGCATTGG - Intergenic
995037460 5:107551194-107551216 ACCTACTGCTGTGTGACCTTGGG - Intronic
997261889 5:132471679-132471701 TGGACCCACTGTGTGACCATGGG + Intronic
997611949 5:135221640-135221662 CCTAACTGTTGTGTGGCCATGGG + Intronic
997836497 5:137197741-137197763 CCTAACAGCTGTTTGACCATGGG + Intronic
999459805 5:151748267-151748289 TTGACTTGCTGGGTGACCATGGG + Intronic
1001070923 5:168584454-168584476 TACAATTGCTGTGTGACCCTGGG + Intergenic
1001090342 5:168735453-168735475 TCTAAGAGCTGTGTGACCCTGGG + Intronic
1001492297 5:172164508-172164530 TGAACCTGCTGTGTGACCTTGGG - Intronic
1001550068 5:172596249-172596271 TCGAATTGCTGAGTCAGCATAGG - Intergenic
1002966841 6:1975066-1975088 TTCATCTGCAGTGTGACCATTGG - Intronic
1006399209 6:33806624-33806646 TTGAATAGCTGTGTGACCTTGGG - Intergenic
1006442764 6:34062350-34062372 ACTTACTGCTGTGTGACCTTAGG + Intronic
1006511509 6:34524015-34524037 CCAACCTGCTGTGTGACCATGGG - Intronic
1007220891 6:40277906-40277928 ACTAACAGCTGTGTGACCTTGGG - Intergenic
1008500779 6:52180253-52180275 TGGAACTGGGGTGTGATCATGGG + Intergenic
1009192504 6:60646355-60646377 TGTAACAGCTGTGTGACCATGGG - Intergenic
1012218092 6:96613477-96613499 CCCCACTGCTGTGTCACCATGGG + Intronic
1016685818 6:146880990-146881012 TGGAACTGCTGTCTTTCCATGGG - Intergenic
1019578730 7:1749784-1749806 TCGAGTTGCTATGTGACCTTGGG - Intergenic
1020134731 7:5580874-5580896 TCGACTTGCTGTGTGCCCTTGGG - Intergenic
1021351167 7:19595828-19595850 ACGGACTGGTGTGTGTCCATAGG + Intergenic
1022003904 7:26249773-26249795 TCTAACTGCTGTCTTAACATAGG + Intergenic
1022205872 7:28163228-28163250 TTGGACTGCTGTGTGACCTTGGG - Intronic
1022826656 7:34021533-34021555 TTTAATTGTTGTGTGACCATAGG - Intronic
1024760496 7:52591052-52591074 TGAAACTGCTCTGTGACCGTGGG + Intergenic
1026318272 7:69246351-69246373 TCTTACTGATGTTTGACCATTGG + Intergenic
1026970641 7:74465448-74465470 CTGAGCTGCTGTGTGACCACAGG + Intronic
1029357365 7:100062144-100062166 TTCAACTGCTGTGGGAACATGGG + Intronic
1029987977 7:104939213-104939235 TCTACCAGCTGTGTGACCTTGGG - Intergenic
1034497096 7:151429578-151429600 CCTGACTGCTGTGTGACCCTGGG + Intronic
1036700865 8:11013060-11013082 CCAACCTGCTGTGTGACCTTGGG - Intronic
1038414582 8:27385066-27385088 TCGACTTGCTGTGTGGCCTTTGG + Intronic
1040423677 8:47263129-47263151 CTTAACTGCTGTGTGACCTTAGG - Intronic
1041256671 8:55984687-55984709 TCTGACTGCTGTGTGACCACTGG - Intronic
1045424044 8:102045304-102045326 TCTACCAGCTGTGTGACCTTGGG + Intronic
1046597991 8:116284049-116284071 CCCACATGCTGTGTGACCATGGG - Intergenic
1047823785 8:128551030-128551052 GCCACCTGCTCTGTGACCATGGG + Intergenic
1048198086 8:132349199-132349221 TTGACTTGCTGTGTGACCTTGGG - Intronic
1048805577 8:138238093-138238115 CCAACCTGCTGTGTGACCTTGGG - Intronic
1052414985 9:28166979-28167001 TCGAAGTTCTGTGTGACTCTGGG + Intronic
1057691702 9:97291789-97291811 TGGATCTGCTGTGTGACCTGGGG + Intergenic
1057821404 9:98333857-98333879 TTTACCAGCTGTGTGACCATGGG + Intronic
1058730506 9:107845552-107845574 TTTAACAGCTGTGTGACCACAGG + Intergenic
1059362130 9:113753165-113753187 TTAACCTGCTGTGTGACCTTGGG - Intergenic
1059402512 9:114079052-114079074 ACTCACTGCTGTGTGACCTTGGG + Intergenic
1060409635 9:123391469-123391491 TTTAGCTGCTGTGTGACCCTGGG - Intronic
1060932266 9:127496673-127496695 TCACTCTGCTGTGTGACCTTGGG - Intronic
1060981647 9:127795827-127795849 TCGAACTGCTGTGTGACCATGGG - Intronic
1061413143 9:130431742-130431764 TAGCACTGCTGTGTGTCCCTGGG + Intronic
1061669324 9:132179829-132179851 TCGAACTCCTGTGTGACAGAAGG - Intronic
1061780171 9:132991185-132991207 TGAAATTGCTGTGTGACCTTGGG + Exonic
1061912193 9:133731186-133731208 TCTGACTGCTGTGTGACTTTGGG - Intronic
1062068492 9:134541574-134541596 CGGGACTGCTGTGTGACCTTGGG + Intergenic
1062108972 9:134771761-134771783 TCAACCTGCTGTGTGAGCTTGGG - Intronic
1062434334 9:136540039-136540061 TGCCACTGCTGTGTGACCCTGGG + Intronic
1187206492 X:17186727-17186749 TTGACCTGCTTTGTGACCTTGGG - Intergenic
1187457931 X:19459218-19459240 ACCAACTGCTGTGTGACCTCGGG + Intronic
1191682261 X:63853211-63853233 TTTACCAGCTGTGTGACCATGGG - Intergenic
1192129561 X:68536393-68536415 TCAAATTACTGTGTGACCGTGGG - Exonic
1193847072 X:86485946-86485968 ACTACCTGCTGTGTGACCTTGGG + Intronic
1194549153 X:95274375-95274397 GCAAGTTGCTGTGTGACCATAGG - Intergenic
1196030234 X:111088809-111088831 TACAACTGCCGTGTGACCTTGGG + Intronic
1196370998 X:114979765-114979787 TATAACAACTGTGTGACCATGGG - Intergenic
1197156543 X:123276069-123276091 CTGACCTGCTGTGTGACCCTAGG - Intronic
1200153439 X:153962855-153962877 TCTGACTGCTGTGGTACCATTGG - Intronic