ID: 1060981648

View in Genome Browser
Species Human (GRCh38)
Location 9:127795828-127795850
Sequence GTCGAACTGCTGTGTGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060981648_1060981656 12 Left 1060981648 9:127795828-127795850 CCATGGTCACACAGCAGTTCGAC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1060981656 9:127795863-127795885 CAGGGTGACCAGACAGGTGGTGG No data
1060981648_1060981652 -6 Left 1060981648 9:127795828-127795850 CCATGGTCACACAGCAGTTCGAC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1060981652 9:127795845-127795867 TTCGACAGCAGAGAGGGCCAGGG No data
1060981648_1060981653 6 Left 1060981648 9:127795828-127795850 CCATGGTCACACAGCAGTTCGAC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1060981653 9:127795857-127795879 GAGGGCCAGGGTGACCAGACAGG No data
1060981648_1060981659 24 Left 1060981648 9:127795828-127795850 CCATGGTCACACAGCAGTTCGAC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1060981659 9:127795875-127795897 ACAGGTGGTGGTAAGGTGCAAGG No data
1060981648_1060981654 9 Left 1060981648 9:127795828-127795850 CCATGGTCACACAGCAGTTCGAC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1060981654 9:127795860-127795882 GGCCAGGGTGACCAGACAGGTGG No data
1060981648_1060981657 17 Left 1060981648 9:127795828-127795850 CCATGGTCACACAGCAGTTCGAC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1060981657 9:127795868-127795890 TGACCAGACAGGTGGTGGTAAGG No data
1060981648_1060981651 -7 Left 1060981648 9:127795828-127795850 CCATGGTCACACAGCAGTTCGAC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1060981651 9:127795844-127795866 GTTCGACAGCAGAGAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060981648 Original CRISPR GTCGAACTGCTGTGTGACCA TGG (reversed) Intronic
900886372 1:5418340-5418362 ATGGAACTGCCCTGTGACCAAGG - Intergenic
902981180 1:20124532-20124554 GTGTACCTGCTGTGTGACCCTGG - Intergenic
903035264 1:20488768-20488790 GCAGAACTTCTGTGTGACCCTGG - Intergenic
903322451 1:22551205-22551227 TGCTAACTTCTGTGTGACCAAGG - Intergenic
903325823 1:22567974-22567996 CTCTAACTGCTGTGTGTCCTTGG - Intronic
905677878 1:39842246-39842268 GTTTACCTGCTGTGTGACCTTGG - Intronic
905888778 1:41507038-41507060 ACCGATCTGCCGTGTGACCAGGG - Exonic
905919545 1:41710347-41710369 GTCATCCTGCTGTGTGACCCAGG + Intronic
906236004 1:44210646-44210668 GTAGAACTGCTGTGACATCAGGG + Intergenic
906529856 1:46517458-46517480 TTTGAACTGCAGTGTTACCAGGG - Intergenic
907273999 1:53306953-53306975 CTCTGACTGCTGTGTGACCTGGG - Intronic
907388739 1:54142616-54142638 ATGGCACGGCTGTGTGACCAGGG + Intronic
907418102 1:54328408-54328430 GCTGATCTGCTGTGTGACCTTGG + Intronic
915272945 1:154768083-154768105 GTCATGCTGCTGTGTGACCCTGG + Intronic
915730492 1:158050374-158050396 GTTGACCAGCTGTGTGACCTTGG - Intronic
918522061 1:185425385-185425407 CTCCATGTGCTGTGTGACCATGG + Intergenic
920918423 1:210277369-210277391 ATCAAATTGCTCTGTGACCATGG - Intergenic
921558393 1:216626806-216626828 GTCAGACTGCAGTGTGGCCAAGG - Intronic
1064139854 10:12781295-12781317 GCCTACCTGCTGTGTGATCACGG - Intronic
1064396225 10:14984130-14984152 GTCAACACGCTGTGTGACCACGG + Intronic
1069558630 10:69414157-69414179 GCCCAGCTGCTGTGTGACCCTGG - Intronic
1069876642 10:71567240-71567262 GTCGGGCTCCTGGGTGACCATGG - Intronic
1070742230 10:78910719-78910741 GTCGATTTGCTGGGGGACCATGG + Intergenic
1070778520 10:79124175-79124197 TAAGAACTGCTGTGTGACCTTGG + Intronic
1072626556 10:97116030-97116052 GTTCACCTGCTGTGTGACCTTGG + Intronic
1075275120 10:121086269-121086291 GTAGAACAGCTGTGTGCCCAGGG - Intergenic
1076405824 10:130212061-130212083 GCTGAACTGCTGTGTGGGCAAGG + Intergenic
1077415486 11:2422568-2422590 CTTGACCTGCTGTGTGACCTGGG + Intronic
1080266393 11:30406371-30406393 TTTGAATTGCTCTGTGACCATGG + Intronic
1081858462 11:46318410-46318432 TGCCACCTGCTGTGTGACCAGGG + Intronic
1082989416 11:59194662-59194684 ATCTGACTGCTGTGTGACCTTGG - Intronic
1084542800 11:69797905-69797927 GACTAAGTGCTGTGTGACCTGGG + Intergenic
1086344189 11:85879421-85879443 GTCGAACTGATTTTTGACAAAGG - Intronic
1091303454 11:134522720-134522742 GTGGATCTGCTGTGTGCACAGGG + Intergenic
1091594571 12:1868077-1868099 GTAGAACTGCCATGTGACCCAGG + Intronic
1091643467 12:2255115-2255137 GCTGACCTGCTGTGTGACCTTGG + Intronic
1094090896 12:26648061-26648083 GGTGGGCTGCTGTGTGACCAAGG + Intronic
1097647915 12:62259481-62259503 CTCCACCTGCTGTGTGACCTTGG + Intronic
1097832345 12:64238999-64239021 GTCGAACTGCTTTGCTACCATGG - Intergenic
1098171586 12:67752476-67752498 GTCACACTCCTGTGTGACCTTGG + Intergenic
1099474089 12:83086481-83086503 GACAAACTGCTGTGTGACCTTGG + Intronic
1102200312 12:111053432-111053454 GGGGAAATGCTGTGTGTCCATGG - Intronic
1102252035 12:111394064-111394086 ATAGACCTGCTGTGTGACCTTGG - Intergenic
1102257573 12:111425118-111425140 CCCGACCTGCTGTGTGACCGCGG + Intronic
1102998657 12:117368480-117368502 CTCCATCTGCTGTGTGACCTTGG + Intronic
1103998456 12:124844956-124844978 CTCCTGCTGCTGTGTGACCATGG - Intronic
1106255304 13:28017052-28017074 GTCCACATGCTGTGTAACCATGG + Intronic
1106554359 13:30797459-30797481 GTCTCACAGCTGTGTGACCTCGG - Intergenic
1106588075 13:31074288-31074310 GTCAAACTGCTGTTTGAGGAAGG + Intergenic
1106634587 13:31514138-31514160 GTGGCTCTGCTGTGTGACCTTGG + Intergenic
1114584816 14:23801394-23801416 GTAAAACTTCTGTGTGACAAAGG + Intergenic
1116457573 14:45136465-45136487 CTCGATCTGCTGTGTCACCAAGG - Exonic
1120545117 14:85801491-85801513 GTTTAACTGCTGTGTGACCTTGG - Intergenic
1120759039 14:88269992-88270014 GTCACGCTGCTGTGTGACCGTGG - Intronic
1121246098 14:92461895-92461917 GCAGAGCTGCTGGGTGACCATGG - Intronic
1121337579 14:93086682-93086704 GTAGAGCTGCTGTGTGAGCCAGG + Intronic
1128156125 15:65393157-65393179 TTCGATTTGCTGTGTGACCTTGG - Intronic
1128285355 15:66432104-66432126 ATCAACCAGCTGTGTGACCATGG - Intronic
1131972149 15:97903726-97903748 CTAGAATTGCTGTGTGACCTTGG + Intergenic
1133559030 16:6932804-6932826 GTCACACTGTTGTGTAACCATGG + Intronic
1133972307 16:10577118-10577140 GCCAAATTGCTGTGTGACCTGGG + Intronic
1134869508 16:17638989-17639011 GTCTCACTGCTGTGTCACCCAGG + Intergenic
1135127230 16:19821360-19821382 GTCGAATTGCTGGGTGACATGGG - Intronic
1137378271 16:47973771-47973793 CTCGGATTGCTGTGTGACCTCGG + Intergenic
1137539964 16:49355471-49355493 CTCTCACTGCTGTGTGACCTTGG - Intergenic
1141482362 16:84315025-84315047 GTCTGCCTGCTGTGTGACCTTGG - Intronic
1141778194 16:86138376-86138398 GTCCCACTGCTCTGTGAACAAGG - Intergenic
1141827690 16:86492768-86492790 GTGGCAGTGCTGTGTGACCGTGG - Intergenic
1142149226 16:88505410-88505432 GTTGAACGGCTGTGTCCCCAAGG - Intronic
1144472490 17:15557168-15557190 GTCCAAGTGCTGTGGGAACATGG - Intronic
1144923989 17:18787520-18787542 GTCCAAGTGCTGTGGGAACATGG + Intronic
1144948856 17:18983331-18983353 GTTGACCTGCTGTGGGACCTGGG - Intronic
1145258708 17:21342166-21342188 GCCTACCTGCTGTGTGACCTTGG - Intergenic
1145317921 17:21745838-21745860 GCCTACCTGCTGTGTGACCTTGG + Intergenic
1145907871 17:28526180-28526202 GTCGACTTGCTGGGTGACCTTGG + Intronic
1147374693 17:40016576-40016598 GTCCAGCTGCAGTGTGTCCAAGG - Exonic
1147911279 17:43857713-43857735 CACCACCTGCTGTGTGACCATGG - Intronic
1148185815 17:45642965-45642987 GTAGGCCAGCTGTGTGACCATGG + Intergenic
1148219592 17:45852073-45852095 GTCCCATTGCTGTGTGACCTTGG - Intergenic
1148838956 17:50482493-50482515 GGCAGACTGCAGTGTGACCAGGG + Intronic
1149284878 17:55151257-55151279 GTCCCACTACTGTGTGACCTTGG + Intronic
1150332107 17:64302678-64302700 GTCAACCAGCTGTGTGATCATGG + Intergenic
1152082143 17:78194580-78194602 GTCTAACTGCTGTGTGAGTATGG + Intronic
1155369108 18:25079235-25079257 GTCGAACTTGAGTGAGACCAAGG - Intronic
1161075500 19:2283230-2283252 CTCGAGCTGCTGCGTGACCCTGG - Intronic
1161484679 19:4528964-4528986 GCTGATCTGCTGTGTGACCTTGG + Exonic
1162095959 19:8310043-8310065 GTTGAGCTGCAGGGTGACCATGG + Intronic
1163388443 19:17014873-17014895 GTCCACCTGCTGGGTGCCCAGGG - Intronic
1163558696 19:18006721-18006743 GTGGAGGTGCTGTGTGACCTCGG + Intronic
1168116075 19:54221967-54221989 GTGGAGCTGCTGTGAGTCCAGGG + Exonic
1168119057 19:54241715-54241737 GTGGAGCTGCTGTGAGTCCAGGG + Exonic
1168185487 19:54697353-54697375 GTGGAGCTGCTGTGAGTCCAGGG - Intronic
929117743 2:38458369-38458391 CTCCAGCTTCTGTGTGACCATGG + Intergenic
929961829 2:46502862-46502884 CTCCAGCTGCTGTGTGACCCTGG - Intronic
936015008 2:108951386-108951408 GTCGAATTCCTGTATGACCTTGG - Intronic
936320361 2:111461971-111461993 GTCTACCTGCTGTGTGACTTTGG + Intergenic
936351473 2:111716077-111716099 ATTGACCTGCTGGGTGACCATGG - Intergenic
938086234 2:128403973-128403995 GTCCTTCTGCTGTGTGACCTTGG + Intergenic
939931363 2:148237869-148237891 TTCTACCAGCTGTGTGACCATGG + Intronic
940249343 2:151657268-151657290 GTAAAACTGATGGGTGACCAAGG + Intronic
948695358 2:239730427-239730449 CTCCAACTGCTGTGTGACCTTGG + Intergenic
948695372 2:239730519-239730541 CTCCAACTGCTGTGTGACCTTGG + Intergenic
948695387 2:239730611-239730633 CTCCAACTGCTGTGTGACCTTGG + Intergenic
948695403 2:239730710-239730732 CTCCAACCGCTGTGTGACCTTGG + Intergenic
948696179 2:239734054-239734076 ATGGAACTGCTGTGTGACTTTGG + Intergenic
1168907231 20:1416219-1416241 GAAGAAGTGCTGTCTGACCAGGG - Intergenic
1170202179 20:13756711-13756733 GTAGAGTTGCTGTGTGAGCAAGG + Intronic
1170565938 20:17605277-17605299 GTCTAACTGCTGTGTGGCCTTGG + Intronic
1172636651 20:36414564-36414586 CTCCACCTGCTGTGTGACCTTGG + Intronic
1173539384 20:43840114-43840136 GCTGAACTGCTGTGTGACCATGG + Intergenic
1173932385 20:46831613-46831635 GTGCCACTGCTGTGTGACCTTGG - Intergenic
1176241462 20:64077622-64077644 GTGAAACTGCTGTGGAACCAAGG + Intronic
1178877588 21:36424733-36424755 TGCCAATTGCTGTGTGACCAAGG + Intergenic
1181750048 22:24982915-24982937 TTCAACCTGCTGTGTGACCTTGG + Intronic
1182094303 22:27615615-27615637 CTAGAAATGCTGTGTGACCCTGG + Intergenic
1182662580 22:31935458-31935480 GCTAACCTGCTGTGTGACCATGG + Intronic
1183102462 22:35592425-35592447 GCCCAACTGCTCTGTGACCCTGG + Intergenic
1183329381 22:37211377-37211399 GCCAAATTGCTGTGTGACCTCGG + Intronic
1183664155 22:39237761-39237783 GACCAACTGCCGTGTGACCTCGG + Intronic
1184199806 22:42960441-42960463 GTCGTGCTGCTGAGAGACCATGG - Intronic
1184325255 22:43778242-43778264 GCAGACCTGCTCTGTGACCAAGG - Intronic
1184609398 22:45593044-45593066 ATCGACCAGCTGTGTGACCTTGG - Intronic
955923298 3:63980931-63980953 GTCAATCTACTGAGTGACCATGG - Intronic
961117836 3:124346986-124347008 GTCAATCTGCTGTGAGTCCATGG - Intronic
968810193 4:2796289-2796311 CTCGAACTCCTGTCTGACCCAGG - Intronic
969255329 4:5997481-5997503 GTCGACTTACTGTGTGACCTTGG - Intergenic
970564313 4:17316555-17316577 GAGGCACTGCTGTGTGACCATGG - Intergenic
973812596 4:54586304-54586326 CTGGAACTGCAATGTGACCAAGG - Intergenic
973983005 4:56322511-56322533 TACTAACTGCTGAGTGACCATGG + Intronic
975151437 4:71026309-71026331 GTCTTACTGGTGTGTGACCTTGG + Intronic
978660193 4:111117396-111117418 ATGTAACTGCTGTGTTACCAAGG + Intergenic
981499107 4:145428534-145428556 TTAGAACTGCTGTGTGACTGTGG - Intergenic
985814883 5:2119680-2119702 ATGGAACTGCTGTGTGACACTGG + Intergenic
991408056 5:66320752-66320774 GTCGACAAGCTGTGTGACCTTGG + Intergenic
997750197 5:136336940-136336962 TGTGAACTGCTGTGTGACCTTGG - Intronic
1002523306 5:179803106-179803128 GTCGAAGTGCCAAGTGACCAGGG + Intronic
1006283243 6:33073138-33073160 GTTGATCTGCTGTGTAACCTTGG + Intronic
1006511511 6:34524016-34524038 ACCAACCTGCTGTGTGACCATGG - Intronic
1007048609 6:38802597-38802619 TTCCAACTACTGTGTGACCTGGG + Intronic
1007207190 6:40162528-40162550 ATGGAACTACTGTTTGACCAGGG - Intergenic
1008500778 6:52180252-52180274 GTGGAACTGGGGTGTGATCATGG + Intergenic
1009192505 6:60646356-60646378 CTGTAACAGCTGTGTGACCATGG - Intergenic
1011428313 6:87255282-87255304 GTCGTACTATTCTGTGACCAAGG - Exonic
1021724525 7:23536284-23536306 GTGGCACTGGTGTATGACCAGGG - Intergenic
1022205873 7:28163229-28163251 GTTGGACTGCTGTGTGACCTTGG - Intronic
1022413699 7:30160070-30160092 GTCTAACTGGTCTGTGAACAAGG + Exonic
1029357364 7:100062143-100062165 GTTCAACTGCTGTGGGAACATGG + Intronic
1030400077 7:109038735-109038757 GTCTATTAGCTGTGTGACCAAGG + Intergenic
1031532162 7:122887718-122887740 CTAAAACTGCTGTTTGACCATGG - Intergenic
1036886111 8:12555008-12555030 GTCATACTGATGTATGACCATGG + Intergenic
1036964459 8:13280392-13280414 GTGGAGGTGCTGTTTGACCAGGG + Intronic
1037135078 8:15450728-15450750 GTAGAACTTCTGTGTTACTAAGG - Intronic
1040327301 8:46356919-46356941 GTGAAACTGCTTTGTGACCTGGG - Intergenic
1041136459 8:54764247-54764269 GTAGGCCTGCTGTGTGGCCAAGG - Intergenic
1044779148 8:95725276-95725298 ATCTAACAGCTGTGTGACCTCGG + Intergenic
1046760215 8:118012613-118012635 GTCTCACTGCTGTTTGACCTGGG + Intronic
1047823784 8:128551029-128551051 GGCCACCTGCTCTGTGACCATGG + Intergenic
1048198087 8:132349200-132349222 GTTGACTTGCTGTGTGACCTTGG - Intronic
1048805579 8:138238094-138238116 GCCAACCTGCTGTGTGACCTTGG - Intronic
1049114475 8:140674157-140674179 GTGGAACTGCAGTGAGACCCAGG - Intronic
1052692107 9:31828026-31828048 GTCAAAGTGCTTTGGGACCAAGG + Intergenic
1053284044 9:36839143-36839165 GAGGAGCTGCTGTGTGACCTGGG - Exonic
1056903768 9:90626802-90626824 GTAATACTGCTGTGTGAACACGG - Intronic
1057691701 9:97291788-97291810 TTGGATCTGCTGTGTGACCTGGG + Intergenic
1058184710 9:101840832-101840854 GTCCAACCCCTGTGTGACCCTGG - Intergenic
1059362131 9:113753166-113753188 GTTAACCTGCTGTGTGACCTTGG - Intergenic
1060032920 9:120231154-120231176 GCCGACCTGCTATGTGACCTGGG + Intergenic
1060525040 9:124315693-124315715 GTGGCACATCTGTGTGACCAGGG - Intronic
1060981648 9:127795828-127795850 GTCGAACTGCTGTGTGACCATGG - Intronic
1061988666 9:134145447-134145469 GTGGGCCTGCTGTGTGAGCAAGG + Intronic
1062068491 9:134541573-134541595 GCGGGACTGCTGTGTGACCTTGG + Intergenic
1187457930 X:19459217-19459239 AACCAACTGCTGTGTGACCTCGG + Intronic
1187606270 X:20886477-20886499 GTCGAAGTGCTGTGGAACAATGG + Intergenic
1192014029 X:67309166-67309188 GTAGAACTACTGTTTGATCAAGG - Intergenic
1193199320 X:78669407-78669429 CTCAAATTTCTGTGTGACCATGG + Intergenic
1196370999 X:114979766-114979788 GTATAACAACTGTGTGACCATGG - Intergenic
1200145653 X:153925321-153925343 GTTGCAGTGCTGTATGACCACGG + Intronic