ID: 1060981652

View in Genome Browser
Species Human (GRCh38)
Location 9:127795845-127795867
Sequence TTCGACAGCAGAGAGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060981648_1060981652 -6 Left 1060981648 9:127795828-127795850 CCATGGTCACACAGCAGTTCGAC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1060981652 9:127795845-127795867 TTCGACAGCAGAGAGGGCCAGGG No data
1060981647_1060981652 -5 Left 1060981647 9:127795827-127795849 CCCATGGTCACACAGCAGTTCGA 0: 1
1: 0
2: 4
3: 27
4: 241
Right 1060981652 9:127795845-127795867 TTCGACAGCAGAGAGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060981652 Original CRISPR TTCGACAGCAGAGAGGGCCA GGG Intronic
No off target data available for this crispr