ID: 1060981656 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:127795863-127795885 |
| Sequence | CAGGGTGACCAGACAGGTGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1060981648_1060981656 | 12 | Left | 1060981648 | 9:127795828-127795850 | CCATGGTCACACAGCAGTTCGAC | 0: 1 1: 0 2: 1 3: 12 4: 163 |
||
| Right | 1060981656 | 9:127795863-127795885 | CAGGGTGACCAGACAGGTGGTGG | No data | ||||
| 1060981647_1060981656 | 13 | Left | 1060981647 | 9:127795827-127795849 | CCCATGGTCACACAGCAGTTCGA | 0: 1 1: 0 2: 4 3: 27 4: 241 |
||
| Right | 1060981656 | 9:127795863-127795885 | CAGGGTGACCAGACAGGTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1060981656 | Original CRISPR | CAGGGTGACCAGACAGGTGG TGG | Intronic | ||
| No off target data available for this crispr | |||||