ID: 1060983661

View in Genome Browser
Species Human (GRCh38)
Location 9:127807790-127807812
Sequence GTTTCAATGGGGAAATAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060983661_1060983668 -8 Left 1060983661 9:127807790-127807812 CCAGACTATTTCCCCATTGAAAC 0: 1
1: 0
2: 3
3: 10
4: 159
Right 1060983668 9:127807805-127807827 ATTGAAACGTGAGGGATGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 113
1060983661_1060983671 1 Left 1060983661 9:127807790-127807812 CCAGACTATTTCCCCATTGAAAC 0: 1
1: 0
2: 3
3: 10
4: 159
Right 1060983671 9:127807814-127807836 TGAGGGATGGCTGGGCATGGTGG 0: 1
1: 5
2: 69
3: 528
4: 3052
1060983661_1060983669 -7 Left 1060983661 9:127807790-127807812 CCAGACTATTTCCCCATTGAAAC 0: 1
1: 0
2: 3
3: 10
4: 159
Right 1060983669 9:127807806-127807828 TTGAAACGTGAGGGATGGCTGGG 0: 1
1: 0
2: 3
3: 13
4: 142
1060983661_1060983670 -2 Left 1060983661 9:127807790-127807812 CCAGACTATTTCCCCATTGAAAC 0: 1
1: 0
2: 3
3: 10
4: 159
Right 1060983670 9:127807811-127807833 ACGTGAGGGATGGCTGGGCATGG 0: 1
1: 1
2: 3
3: 51
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060983661 Original CRISPR GTTTCAATGGGGAAATAGTC TGG (reversed) Intronic
902617237 1:17630469-17630491 GTTTCCTTGTGGAAATAGTGAGG + Intronic
906321057 1:44815869-44815891 ATTTAAATGAGGAAATAGGCTGG - Intergenic
906411952 1:45585524-45585546 GAATCAATGGGGAAAGAGGCAGG - Intronic
906464913 1:46069539-46069561 GTTTAAAGGGGGAAAAAGTTTGG + Intronic
908516280 1:64895986-64896008 CTGTCAATGGGGAACTACTCGGG + Intronic
909667862 1:78155492-78155514 GTTTCTATGGGAAATGAGTCTGG - Intergenic
910002459 1:82356347-82356369 GTTTCAGTGGGGAAGTAGGTGGG + Intergenic
910049698 1:82959783-82959805 GTTTCAGTGGGGAAGTAGGTGGG - Intergenic
911237335 1:95425521-95425543 GTTTGAATGGGGAAATTGGCTGG + Intergenic
911395530 1:97303070-97303092 GTTTAAATACGGAAATAGTGAGG - Intronic
911854394 1:102858721-102858743 GTTACAATAGGTAGATAGTCAGG + Intergenic
911984182 1:104600611-104600633 GTTTCAGTGGGGAAGTAGGTGGG - Intergenic
913537918 1:119791871-119791893 TTTTTAATGGTGAAACAGTCTGG + Intergenic
914909343 1:151771488-151771510 GAATAAATGGGGAAATAGTTTGG - Intronic
915853090 1:159349215-159349237 GTTAGAATGGTGAAAAAGTCAGG + Intergenic
918967602 1:191372178-191372200 GTTACAATGGGTAGCTAGTCAGG - Intergenic
919581496 1:199380790-199380812 TTTTCAATGGGTAAATTGTATGG - Intergenic
919869895 1:201812410-201812432 GTGGCAATGGGGACATTGTCAGG - Intronic
1063068752 10:2637533-2637555 ATTTCCATGGGGGAATAGGCAGG + Intergenic
1063263681 10:4421027-4421049 TTTCAAATGTGGAAATAGTCTGG - Intergenic
1064301590 10:14127681-14127703 GGTTCAGTGGGGATATAGTCAGG - Intronic
1067097972 10:43314877-43314899 GGTCCAATGGGGAGACAGTCAGG + Intergenic
1068647805 10:59488007-59488029 GTTTCAATGGGGTAAGAAACTGG - Intergenic
1069977986 10:72231127-72231149 GTTTCAATGGAGAAATGGTCTGG - Intronic
1070247845 10:74748768-74748790 CTTTCAATGGTGCAATTGTCTGG - Intergenic
1070896451 10:79986499-79986521 GTTTCTATGGTGAAATAGGAAGG + Intergenic
1071355224 10:84786781-84786803 CTTTCAATGGGAAATTATTCAGG + Intergenic
1072011024 10:91303012-91303034 GTTTCAGTGGGGAAGTAGGTGGG + Intergenic
1073235319 10:102009741-102009763 GTTTCATTGCAGAGATAGTCTGG + Intronic
1073918660 10:108434016-108434038 GTTTCAATTAGGAGATATTCAGG - Intergenic
1074212753 10:111352519-111352541 GATTCTATGTGGAAATAGTGGGG + Intergenic
1074834088 10:117272528-117272550 GTTTAAATGGGGAAAGAGGAGGG - Intronic
1075216559 10:120541492-120541514 CTTTCAGTGGGGAAATAAACTGG - Intronic
1075733557 10:124650747-124650769 ATTGTACTGGGGAAATAGTCTGG - Intronic
1080393238 11:31867097-31867119 GTTTCTCTGGGGCAAGAGTCTGG + Intronic
1080799984 11:35601279-35601301 GTTTCAATGAGGAAACAATTAGG + Intergenic
1081159845 11:39737476-39737498 GGTAAAATGGGGAAATAGTAAGG - Intergenic
1081356194 11:42117339-42117361 GTTTGAAGGGGGAAAGAGTAGGG - Intergenic
1082018067 11:47507332-47507354 GTTGCTTTGGGGAAATAGTGTGG - Intronic
1087581024 11:100053640-100053662 GGTACAATGGAAAAATAGTCTGG + Intronic
1087750870 11:102005584-102005606 CTATCAATGGGGAAACAGTGTGG + Intergenic
1093231155 12:16543780-16543802 GTTTCAATGGGAAAAATGTAAGG + Intronic
1094800409 12:34026870-34026892 TTTTCAGTGGCCAAATAGTCAGG + Exonic
1095113199 12:38321168-38321190 TTTTCAGTGGCCAAATAGTCAGG + Exonic
1105215868 13:18284855-18284877 GTTTCAATGTGTAAATGCTCAGG - Intergenic
1109405455 13:61892719-61892741 CTTCCAATGGGCAAAAAGTCTGG - Intergenic
1113264161 13:108598625-108598647 GTTTCAATGGTGAAATAGGCAGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118940239 14:70328197-70328219 GATTCTCTGGGGAGATAGTCTGG + Intronic
1122254714 14:100468318-100468340 GTTCCAATGGGCAAGCAGTCTGG - Intronic
1123855555 15:24407238-24407260 GCATCACTGGGGAAAGAGTCAGG + Intergenic
1123864086 15:24499428-24499450 GCATCACTGGGGAAAGAGTCAGG + Intergenic
1127925272 15:63533609-63533631 ATAACAATGGGGAAATATTCTGG - Intronic
1128553380 15:68613417-68613439 GTTGAAATGGGGAAGAAGTCAGG - Intronic
1131411420 15:92211022-92211044 GTTTCAATTGGGGAATACTGGGG - Intergenic
1131523198 15:93132363-93132385 CTTTCAATGGGCAAATTGTATGG - Intergenic
1137805255 16:51298590-51298612 GTTTCAATGGGTAAACATTCTGG + Intergenic
1139585814 16:67902636-67902658 GTTTAAATGAGGACCTAGTCTGG - Intronic
1143455268 17:7063649-7063671 GTTCCACTGGGGAAAGAGACAGG + Intergenic
1146492950 17:33295155-33295177 ATTTCAAGGGGGAAATAGCTAGG - Intronic
1146664407 17:34687875-34687897 GTTTCCATGGGGAATCACTCAGG - Intergenic
1146801364 17:35826242-35826264 GTTTCAGTGGGGGAAAGGTCGGG + Intronic
1146821240 17:35984929-35984951 GGTTCAATGGGGACATGGGCAGG - Intronic
1150887925 17:69109117-69109139 GTTTCATTAGGCAAATACTCAGG - Intronic
1152098328 17:78286022-78286044 CTTTCAATGGGTGAATAGTGTGG + Intergenic
1152223537 17:79082227-79082249 GTTTCAGTGGGGACATAGCTTGG - Intronic
1154099015 18:11451271-11451293 CTTTAAATGGGGAAATAGTATGG - Intergenic
1155728045 18:29114582-29114604 GTTTCAATGGAAAAATATTGAGG - Intergenic
1157158578 18:45291443-45291465 ATCTCAATGGGGAAAAAGTTGGG - Intronic
1158512067 18:58099440-58099462 TTTTTAATGGGAAAATAGGCAGG + Intronic
926396163 2:12444807-12444829 GTTTCACTGGGGAAATACCTGGG + Intergenic
926852246 2:17212039-17212061 GTTTCAACAGTGAAATAATCGGG + Intergenic
927141904 2:20136517-20136539 GTTTCGCTGGGATAATAGTCAGG + Intergenic
928781029 2:34820361-34820383 GTGTCAATGGGAAAATACTTGGG + Intergenic
934298463 2:91761870-91761892 GTTTCAATGTGTAAATGCTCAGG + Intergenic
936911565 2:117598974-117598996 GTTTTGAAGGGGAAAGAGTCAGG - Intergenic
937254881 2:120548026-120548048 GTATCAATGGGGAGAAGGTCTGG + Intergenic
942455461 2:176135551-176135573 TTTTCAATTGGGAAATATTTGGG + Intergenic
943412615 2:187561740-187561762 GTTTCAGTGGGGGAATAGGTGGG + Intronic
947310447 2:228796013-228796035 ATTTCAAAGGGGAAATGGTGAGG + Intergenic
947378195 2:229519045-229519067 GTTAGAAAGGAGAAATAGTCAGG - Intronic
947566602 2:231198269-231198291 GTGTCCGTGGGGAAAGAGTCAGG - Intergenic
948230637 2:236346619-236346641 GTTACAGTGGGGAGCTAGTCGGG + Intronic
1174096291 20:48092327-48092349 GTTTCAATGGGGCAGAAGGCAGG + Intergenic
1174597350 20:51694402-51694424 GATTCAATGGGGAGATAGAACGG + Intronic
1179343359 21:40533417-40533439 GTTTGGATGGGGAAATAGATAGG - Intronic
1182023890 22:27102370-27102392 GATTCAAGTGGGAAATATTCTGG - Intergenic
1183923553 22:41188759-41188781 GTTTCGAGGGGGAAGTAGTTGGG + Intergenic
954441676 3:50525580-50525602 GCTTCTGTGGGGAACTAGTCTGG - Intergenic
954536251 3:51361501-51361523 CTTTCTATGGGGTATTAGTCTGG - Intronic
955588476 3:60508021-60508043 TTTTCAATGGGGATAAAGTAAGG + Intronic
955881477 3:63551043-63551065 GTTTAAATGGGCAAATTGTATGG - Intronic
956370637 3:68556310-68556332 GTTTTAATTTGTAAATAGTCTGG + Intergenic
957746699 3:84352910-84352932 GTTTCAATATGTAAATATTCAGG + Intergenic
958422311 3:93942581-93942603 GTTTCAGTGGGGGAATAGGTGGG - Intronic
959426744 3:106199006-106199028 GTTTCAATTGGGAAACAGAGGGG + Intergenic
959603218 3:108212379-108212401 TTTTCAATGGTGATATAGTTTGG + Intronic
959646865 3:108713090-108713112 TTTTCAATGGGAACATATTCCGG + Intergenic
965109569 3:164402993-164403015 GTTTCTGTGGGGATATAGTCAGG + Intergenic
966471933 3:180299308-180299330 GTAACAATTGTGAAATAGTCTGG + Intergenic
969320327 4:6408522-6408544 GTTTCAATGGGGAGGTAGGATGG + Intronic
969701550 4:8770481-8770503 CTTTCAAAGGCGAAATTGTCTGG - Intergenic
973040983 4:45470774-45470796 GTTTCACTGTGAAAATAATCAGG - Intergenic
976000293 4:80366369-80366391 GCTTCACAGGGGAAAAAGTCTGG + Intronic
976334961 4:83874805-83874827 GAAACAATGGGTAAATAGTCAGG - Intergenic
978148559 4:105407483-105407505 TTTCCAGTGGGGAAATACTCAGG - Intronic
981724370 4:147832204-147832226 GTTTCACTAGGGAAATATTTCGG + Intronic
983276702 4:165626591-165626613 TTTTGAATGGGGATATTGTCAGG + Intergenic
983378559 4:166960981-166961003 GTTTCTAAGGGTAAATAATCTGG + Intronic
983998081 4:174210209-174210231 GTTTACAAGGGGAAATACTCAGG - Intergenic
984079488 4:175227815-175227837 TTTTCAATGGGGATATATCCAGG - Intergenic
984621387 4:181956261-181956283 GTTTCAATGTGGAAATTTTGAGG + Intergenic
985078680 4:186243410-186243432 GTTTCAATGGGGGAGTAGATGGG + Intronic
987006364 5:13714403-13714425 ACTTCAAAGGGGACATAGTCTGG + Exonic
990433494 5:55762647-55762669 GTTAGTATGGGGAAATAGTATGG + Intronic
993610669 5:90050335-90050357 TTTTAACTGGGGAATTAGTCAGG - Intergenic
994260920 5:97657614-97657636 GTGTCAGTGGGCAAATAGTGTGG + Intergenic
995725204 5:115174555-115174577 GTTTCTATGGGAACAAAGTCAGG + Intronic
997029316 5:130105556-130105578 GTTTCATTCTGGAAATAGTTTGG + Intronic
997792576 5:136774101-136774123 ATTTCAATGGGTCAATGGTCAGG + Intergenic
998073336 5:139216401-139216423 ATTTAAATAGGGAAATAGCCTGG + Intronic
1000182549 5:158825848-158825870 ATTTCAATTTGGAAATATTCAGG + Intronic
1000758892 5:165196261-165196283 ATTTCACTAGAGAAATAGTCAGG - Intergenic
1003556121 6:7141581-7141603 GTTTCAATGGGGACTTATTTGGG - Intronic
1003849674 6:10208973-10208995 GTTTCAGTGGGGAGTGAGTCAGG - Intronic
1008823276 6:55659827-55659849 ATTTCAAGGGGGAAATACTTTGG - Intergenic
1009749942 6:67869919-67869941 GTTTCAGTGGGGAAGTAGGTGGG + Intergenic
1010841035 6:80649321-80649343 GTTTCAATGGGGGAGTAGGTGGG + Intergenic
1014903301 6:126995482-126995504 GTTTCAATTGGCAGATAGTAAGG - Intergenic
1016135644 6:140538690-140538712 TTTTCAATGGGGAAAAAGGCAGG - Intergenic
1017101395 6:150852566-150852588 GTTTCAATCGGGGAATACTGGGG - Intergenic
1018414909 6:163592372-163592394 TTTTCAATGGGAACATATTCTGG - Intergenic
1022177861 7:27889281-27889303 GGTTCAATGGGGAAATATGGGGG + Intronic
1022531354 7:31068855-31068877 GGTTCAATGGGGGAAGAGTAAGG - Intronic
1022545927 7:31188900-31188922 TTTTCAAGGGAGAAATAATCAGG - Intergenic
1022982429 7:35617084-35617106 GTTTCAATGGGGCCAGAGCCAGG - Intergenic
1024141060 7:46463925-46463947 ATATCAATGTGGAAAAAGTCGGG - Intergenic
1024726519 7:52203103-52203125 GTTTCCATGTGGACATAGTGTGG + Intergenic
1025789976 7:64680160-64680182 CTCTCAAAGGGGAAATAGTGGGG - Intronic
1028494808 7:91450816-91450838 GTTTCAGTCGGGAAATACTGGGG + Intergenic
1028589523 7:92480662-92480684 GTTTCAATGGGGGAGTAGGTGGG + Intergenic
1034815756 7:154170656-154170678 GTTTCATTGTGGAAATGGTGAGG - Intronic
1040969522 8:53119312-53119334 GTTTAAATGGGTATATAGTCTGG - Intergenic
1042791503 8:72612198-72612220 GTTGGAATGGGGCAATAGTCAGG - Intronic
1042908148 8:73795666-73795688 ATTTCAAGGGGGAAACAGACTGG + Intronic
1043618619 8:82159689-82159711 GTTTGAAAGGGGAAAAAGTAGGG - Intergenic
1044083636 8:87916193-87916215 GTTACGATGGGGAAATTGCCAGG - Intergenic
1044106199 8:88210226-88210248 GTTTGAGTGGTGAAGTAGTCAGG - Intronic
1045873841 8:106956116-106956138 GTTTCAAAGGGGAATCAGTAAGG - Intergenic
1045928919 8:107601236-107601258 GTTTCAGTTGGGAAATACTGGGG + Intergenic
1046584304 8:116132760-116132782 ATTACAATGATGAAATAGTCTGG - Intergenic
1046973137 8:120244976-120244998 GTATGAATGGGGAAATGGCCAGG - Intronic
1047434689 8:124826376-124826398 GTTTCAATGGGGAGAGTGCCTGG - Intergenic
1047947846 8:129900340-129900362 ATTTCAAAGGGGACATAGTTGGG - Intronic
1048049283 8:130802248-130802270 GATACAATGGGGAAGGAGTCAGG - Intronic
1048340367 8:133534043-133534065 GATTCAATGGGGAAAAAAACGGG + Intronic
1050346984 9:4699766-4699788 ATTTCTATGGGTAAATAGTGGGG + Intronic
1052701938 9:31948331-31948353 GTTAGAATGGTGAAAAAGTCAGG - Intergenic
1054831334 9:69628316-69628338 GTTTCCATGGGGCAAGAGTCTGG - Intronic
1056387813 9:86113505-86113527 GTTTCCATGGAGAAATGGTGTGG + Intergenic
1058376790 9:104331582-104331604 ATTTCAATGGGGAAACAGCTAGG - Intergenic
1059667551 9:116463136-116463158 GTTGCAATGGAGAAAAAGGCGGG - Intronic
1060983661 9:127807790-127807812 GTTTCAATGGGGAAATAGTCTGG - Intronic
1188224484 X:27580294-27580316 GTTTCAATGGGGAAAAAGACAGG + Intergenic
1188725774 X:33580259-33580281 CTTTCATTGGGGAAATTGACTGG + Intergenic
1190490274 X:50975453-50975475 TTTTAAATGGGGAAATTGTCTGG - Intergenic
1192706480 X:73532199-73532221 GTTTCAGTGGGGGAATAGGTGGG - Intergenic
1194331612 X:92590513-92590535 ATTGCAGTGGAGAAATAGTCTGG + Intronic
1196657969 X:118239767-118239789 GTTTCAGTGGGGAATCAGTGTGG - Intergenic
1200640318 Y:5709569-5709591 ATTGCAGTGGAGAAATAGTCTGG + Intronic
1201311669 Y:12603195-12603217 GTTTCAATTGGGGAATACTGGGG + Intergenic
1201455514 Y:14163765-14163787 GTTTCAGTTGGGAAATAATGGGG - Intergenic
1201965917 Y:19735550-19735572 GTTTCATGGGAGAAATAGTTTGG - Intronic