ID: 1060984161

View in Genome Browser
Species Human (GRCh38)
Location 9:127810087-127810109
Sequence CACCTGCAGCAGCTTCAGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 7, 3: 50, 4: 439}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060984161_1060984168 -7 Left 1060984161 9:127810087-127810109 CCCTGCTGAAGCTGCTGCAGGTG 0: 1
1: 0
2: 7
3: 50
4: 439
Right 1060984168 9:127810103-127810125 GCAGGTGAGGGGCCAACTTGGGG 0: 1
1: 0
2: 1
3: 33
4: 385
1060984161_1060984166 -9 Left 1060984161 9:127810087-127810109 CCCTGCTGAAGCTGCTGCAGGTG 0: 1
1: 0
2: 7
3: 50
4: 439
Right 1060984166 9:127810101-127810123 CTGCAGGTGAGGGGCCAACTTGG 0: 1
1: 0
2: 1
3: 21
4: 242
1060984161_1060984170 -3 Left 1060984161 9:127810087-127810109 CCCTGCTGAAGCTGCTGCAGGTG 0: 1
1: 0
2: 7
3: 50
4: 439
Right 1060984170 9:127810107-127810129 GTGAGGGGCCAACTTGGGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 230
1060984161_1060984175 22 Left 1060984161 9:127810087-127810109 CCCTGCTGAAGCTGCTGCAGGTG 0: 1
1: 0
2: 7
3: 50
4: 439
Right 1060984175 9:127810132-127810154 GGCAGGCAGTCCTGAAGCCCTGG 0: 1
1: 0
2: 3
3: 37
4: 334
1060984161_1060984169 -6 Left 1060984161 9:127810087-127810109 CCCTGCTGAAGCTGCTGCAGGTG 0: 1
1: 0
2: 7
3: 50
4: 439
Right 1060984169 9:127810104-127810126 CAGGTGAGGGGCCAACTTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 232
1060984161_1060984177 28 Left 1060984161 9:127810087-127810109 CCCTGCTGAAGCTGCTGCAGGTG 0: 1
1: 0
2: 7
3: 50
4: 439
Right 1060984177 9:127810138-127810160 CAGTCCTGAAGCCCTGGGTCTGG 0: 1
1: 0
2: 4
3: 25
4: 329
1060984161_1060984167 -8 Left 1060984161 9:127810087-127810109 CCCTGCTGAAGCTGCTGCAGGTG 0: 1
1: 0
2: 7
3: 50
4: 439
Right 1060984167 9:127810102-127810124 TGCAGGTGAGGGGCCAACTTGGG 0: 1
1: 0
2: 1
3: 15
4: 158
1060984161_1060984176 23 Left 1060984161 9:127810087-127810109 CCCTGCTGAAGCTGCTGCAGGTG 0: 1
1: 0
2: 7
3: 50
4: 439
Right 1060984176 9:127810133-127810155 GCAGGCAGTCCTGAAGCCCTGGG 0: 1
1: 0
2: 0
3: 26
4: 267
1060984161_1060984174 5 Left 1060984161 9:127810087-127810109 CCCTGCTGAAGCTGCTGCAGGTG 0: 1
1: 0
2: 7
3: 50
4: 439
Right 1060984174 9:127810115-127810137 CCAACTTGGGGGTGGGCGGCAGG 0: 1
1: 0
2: 3
3: 20
4: 354
1060984161_1060984171 -2 Left 1060984161 9:127810087-127810109 CCCTGCTGAAGCTGCTGCAGGTG 0: 1
1: 0
2: 7
3: 50
4: 439
Right 1060984171 9:127810108-127810130 TGAGGGGCCAACTTGGGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 203
1060984161_1060984172 1 Left 1060984161 9:127810087-127810109 CCCTGCTGAAGCTGCTGCAGGTG 0: 1
1: 0
2: 7
3: 50
4: 439
Right 1060984172 9:127810111-127810133 GGGGCCAACTTGGGGGTGGGCGG 0: 1
1: 2
2: 29
3: 410
4: 1932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060984161 Original CRISPR CACCTGCAGCAGCTTCAGCA GGG (reversed) Exonic
900178051 1:1299342-1299364 TACCTGCAGCAGCGTCTGGAGGG + Exonic
900408583 1:2502971-2502993 CACCTGCTGCTGCTTCTGCGTGG + Intronic
900555678 1:3279243-3279265 CTCCTGCTCCAGCTTCTGCAGGG - Intronic
900648814 1:3721132-3721154 CCCCTGCAGCGGCCTCAGCGGGG + Intronic
900827293 1:4936979-4937001 CAGCTGCAGGACCTTGAGCAAGG + Intergenic
901199652 1:7459430-7459452 AACCAGCAGCAGGTACAGCAAGG - Intronic
901405058 1:9039872-9039894 CATCCGGAACAGCTTCAGCACGG + Exonic
901766157 1:11501455-11501477 CAGCTGCAGCAGCTGCATCTCGG + Exonic
901787787 1:11636116-11636138 CACCTGCAGCAGCTGCCTTAGGG - Intergenic
901949289 1:12728676-12728698 CACCTGCAGCATCAACATCAAGG - Intronic
902618791 1:17638599-17638621 CACCCGCATCAGCCTCTGCAGGG - Exonic
903575596 1:24337797-24337819 GGCCTGGAGCAGCTTCAGAAGGG + Intronic
903579013 1:24357293-24357315 CACCTGGAGCACCTACAGCATGG - Exonic
904028862 1:27521553-27521575 CATCAGCAGCAGCAGCAGCAGGG - Intergenic
904286526 1:29456237-29456259 CACCTGCAGCAGCTCCAGCCAGG - Intergenic
905513074 1:38539100-38539122 CACCTGAAGCTCGTTCAGCAGGG - Intergenic
905792698 1:40798807-40798829 CACGGGCAGCAGCTGCAGCCAGG - Intronic
905817877 1:40966005-40966027 GACTTGCAGTAGCTTAAGCAAGG + Intergenic
905876403 1:41434515-41434537 CCCCTGCAGGATTTTCAGCAAGG - Intergenic
906242831 1:44252423-44252445 CACCCGCCGCACCTACAGCAGGG - Intronic
906671107 1:47655688-47655710 CAGCTGGAGGAGCTCCAGCAGGG - Intergenic
906890652 1:49709369-49709391 CACCTACACAAGCCTCAGCATGG + Intronic
907580851 1:55571392-55571414 CACCAGCAGCAGGCTCTGCATGG + Intergenic
908250635 1:62263096-62263118 CTCCAGCAGCAGCTTCACGATGG + Exonic
908537477 1:65091635-65091657 CACCTGCAGCACCTGCTACAGGG - Intergenic
908574945 1:65449565-65449587 CAGCTGCAGCAGCTCCACCAGGG - Intronic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
909673258 1:78212052-78212074 CACCTGCAGCAGTGTCATCATGG - Intergenic
910013809 1:82496623-82496645 CAGCTGCTCCAGCTCCAGCATGG - Intergenic
910367946 1:86486695-86486717 TACCTGCAGCAGCTTCAGGAGGG + Exonic
912032798 1:105270776-105270798 CAAATGCAGAAGCTGCAGCAAGG + Intergenic
913441391 1:118901831-118901853 CACCTGCCACATCCTCAGCAGGG + Intronic
914244126 1:145873172-145873194 CAGCTGCTGCTGCCTCAGCACGG + Exonic
915670155 1:157482328-157482350 CACCTTCTGCATCTTCAGCTTGG - Intergenic
916966273 1:169945506-169945528 CATCTGGAGCAGCTGCTGCAGGG - Intronic
917335702 1:173922440-173922462 CACCTGCATGGGTTTCAGCAAGG + Intergenic
918075246 1:181166086-181166108 CACCTGCAGCAGCCTCCCAAAGG + Intergenic
918121294 1:181543234-181543256 CAGCAGCATCAGCATCAGCAGGG - Intronic
919649523 1:200132799-200132821 CACCTCCAGGAGCCTTAGCAAGG + Intronic
919724573 1:200873456-200873478 CGCCTCGAGCAGCTTCACCACGG - Exonic
919924774 1:202186588-202186610 CTGCTGCAGCAGCCTCAACAGGG - Intergenic
920674565 1:208030155-208030177 CAGCTGCAGCAGCTTCTCCCAGG - Intronic
921149333 1:212387056-212387078 CAGCAGCATCCGCTTCAGCAAGG - Exonic
921532881 1:216307233-216307255 CACTCAGAGCAGCTTCAGCAAGG - Intronic
921706155 1:218324223-218324245 CCCCTGCAGCTGCTGCTGCAGGG - Intronic
921729118 1:218557009-218557031 CACCTTAAGTAGCTTCAGAATGG + Intergenic
923350383 1:233099238-233099260 GACATGCAGCAGCTACAGAAAGG + Intronic
1063174350 10:3538190-3538212 CAGCAGCAGCAGCCTCTGCACGG + Intergenic
1066188758 10:33036719-33036741 CAACTGCAGCAGCAGCCGCAGGG + Intergenic
1066996290 10:42567104-42567126 CACCTTCAGCTGCTGCAGGAAGG - Intergenic
1067764029 10:49071715-49071737 CACCTGCAGCAACATCTGCCTGG - Intronic
1069653232 10:70066827-70066849 CACCTGGAGCAGTCTCAGCTGGG - Intronic
1069916735 10:71791186-71791208 CAGCAGCAGCAGCTCCAGGATGG - Intronic
1070097302 10:73350280-73350302 CAGCTTCAGCATTTTCAGCAAGG + Intronic
1070389617 10:75958077-75958099 CACCAGCACCATCGTCAGCAAGG - Intronic
1070662261 10:78315564-78315586 GATCTGCAGCAGCTCCTGCAAGG - Intergenic
1070686123 10:78483769-78483791 CAGATGCTGCAGCTTCAGGATGG - Intergenic
1071514334 10:86287158-86287180 CACCTGCAGCTCCTTCCCCACGG - Intronic
1071784120 10:88880261-88880283 TTCCTGCAGCAGCGGCAGCAGGG + Exonic
1071919416 10:90332418-90332440 CAGCTGCAGAGGCTGCAGCAGGG + Intergenic
1073942269 10:108712558-108712580 CCCCTGCAGCAGCTTCTGCCTGG + Intergenic
1074903559 10:117840344-117840366 CAGCCTCAGCATCTTCAGCATGG + Intergenic
1075089105 10:119433291-119433313 CACTGCCAGCCGCTTCAGCAGGG + Intronic
1075256120 10:120927015-120927037 GTCCTGCAGCAGCTACAGCAGGG + Intergenic
1076062987 10:127427958-127427980 CACCTGCAGCAGCTCCCGCTGGG - Intronic
1076250503 10:128980551-128980573 CACCTGCAGCAGGCTCAGGCTGG + Intergenic
1076611925 10:131731451-131731473 GACCGGCAGCAGCACCAGCATGG + Intergenic
1076769640 10:132656001-132656023 CACCTGCAGCAGCTTCTTCAAGG + Intronic
1076904935 10:133356964-133356986 CAGGGGCAGCAGCTTCAGCACGG + Exonic
1077079783 11:720117-720139 CAGCTGCACCAGCTTCCGGATGG - Exonic
1077079790 11:720162-720184 CACCTGCAGCAGCATCTCCTGGG - Exonic
1077094057 11:791927-791949 GTCCTGCAGCAGCCCCAGCAGGG + Exonic
1077211369 11:1372294-1372316 CACCTGCAGCTGCTGTACCAGGG + Intergenic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1080446887 11:32345754-32345776 CCCCTCCAGCAGCTTCATGATGG + Intergenic
1080851077 11:36070750-36070772 CACCTGCAGCAGGATCCCCAGGG - Intronic
1081061041 11:38477912-38477934 CACCTCCAGCTGTTTCAGCCTGG - Intergenic
1083622525 11:64056216-64056238 CACCTGCTGCAGCTCCTCCAGGG - Intronic
1083635433 11:64118190-64118212 CAACGGCAGCAGCCTCTGCAAGG + Exonic
1083746398 11:64739462-64739484 CAGCTGTAGCAGCTTCTGGAAGG + Exonic
1084420820 11:69059652-69059674 CACCTGAAGCAGCATTTGCAGGG + Intronic
1084954853 11:72685737-72685759 CAGCTGCAGCAGCTTCAGCGGGG - Intronic
1085300041 11:75452624-75452646 CTCCAGCAGCAGCTTAAGGAAGG - Intronic
1087133852 11:94694660-94694682 CAGCTGGAGCAGCAGCAGCACGG + Intergenic
1087135699 11:94716751-94716773 CACCTGCATCAACATCAGTAGGG - Intronic
1087551952 11:99662758-99662780 CAACAGCAGCAGCATCACCAGGG + Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089530706 11:119127059-119127081 CACCTGCAGCAGCACCTGCATGG + Exonic
1089544840 11:119215975-119215997 TTCCTGCAGCAGCTTCCGCAAGG + Intronic
1090136492 11:124204472-124204494 CACCCCCAGCAGCTGCAGCCTGG - Intergenic
1090383924 11:126345576-126345598 CTCCTGCAAGAGCTTGAGCAGGG - Exonic
1091594278 12:1865198-1865220 TTCCAACAGCAGCTTCAGCAAGG - Intronic
1091653707 12:2328591-2328613 CAACTGGAGCAGCTTCAGTATGG + Intronic
1091890371 12:4049095-4049117 CACCTGCAACAGTTTCACCTTGG + Intergenic
1092197085 12:6555977-6555999 CTCCTGCAGCAGGAGCAGCAGGG - Exonic
1092605384 12:10112466-10112488 CTCCTGCTGCTGCTTCAGTATGG - Intergenic
1092955255 12:13543543-13543565 CACCTTCAGCTGCTTAAACAGGG - Exonic
1094284330 12:28775621-28775643 CAGCTGCTGCACCTTCAGCCTGG - Intergenic
1094725155 12:33107133-33107155 CACCTCCATCAGCTTCTTCAAGG + Intergenic
1095592007 12:43914167-43914189 GACATGCAGCAGCTTCGGGAGGG + Intronic
1096154908 12:49336457-49336479 CACCAGCAGCAGCAGCACCATGG + Exonic
1096180698 12:49548986-49549008 CAACTGCAGCAGCAGCAGCGAGG + Exonic
1097169772 12:57106116-57106138 CACCTGTAGGGCCTTCAGCAGGG + Intronic
1097368119 12:58742430-58742452 CCCCTGCAGCAACTTCTGCCCGG - Intronic
1097707478 12:62882874-62882896 CACGTGCAGCTGCTTCTGCTTGG + Intronic
1098264759 12:68706978-68707000 CAGCTGCACCAGCTCCACCAGGG + Intronic
1101210067 12:102526532-102526554 CACCTTCAACAGCTTCAGTCAGG - Intergenic
1101779900 12:107825790-107825812 CACGTGCATAAACTTCAGCATGG - Intergenic
1102610625 12:114108816-114108838 CCACTGCAGCATCTTCAACAAGG + Intergenic
1103842323 12:123875262-123875284 TTCCAACAGCAGCTTCAGCAAGG - Exonic
1104958496 12:132477209-132477231 AAACCGCAGCAGCTGCAGCAGGG - Intergenic
1106449996 13:29872346-29872368 CACCTGCAGTGGCTGCTGCAGGG - Intergenic
1106589724 13:31089007-31089029 CTCCTCAGGCAGCTTCAGCATGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107105352 13:36636931-36636953 CCCCTGCAGCAGCTTCTGCCTGG + Intergenic
1107391503 13:39969534-39969556 CACCTGCATCAGAATCATCAGGG + Intergenic
1109295739 13:60528378-60528400 CAGCCACAGCAGCTTCATCAGGG + Exonic
1110695259 13:78480633-78480655 CACCTGAAGCATATTCAGCATGG + Intergenic
1110730933 13:78877507-78877529 CATCTGGAGCAGCTGCTGCAAGG - Intergenic
1111268684 13:85853174-85853196 CCCCAGCAGCTGCTTCAGAAGGG - Intergenic
1113812092 13:113149174-113149196 CACCTCCAGCATCTTGAGCCTGG - Exonic
1114454416 14:22845924-22845946 CACCAGGAGCAGCAGCAGCACGG - Exonic
1115087991 14:29540040-29540062 CATCTGCAGCAGTTCCAGGAGGG - Intergenic
1115951679 14:38728387-38728409 CAGCTGCACCAGCTCCACCAGGG + Intergenic
1116183878 14:41570966-41570988 CACCTGCAGGAGCTGCCACAAGG - Intergenic
1116326843 14:43540949-43540971 CAGCTGCACCAGCTCCACCAGGG - Intergenic
1116894777 14:50305244-50305266 CTCCTGCAGCAGCTTTAGATTGG + Intronic
1117772883 14:59152186-59152208 CACCTGCAGCAGAATCACCCTGG + Intergenic
1118439492 14:65799797-65799819 CACGGGCAGCAGGTACAGCAGGG - Intergenic
1118933949 14:70269028-70269050 AACCTGCAGCAGCTGGAGAATGG + Intergenic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119562791 14:75604353-75604375 CAACTGCAGAAGCTACAGGAAGG + Intronic
1120238226 14:81917509-81917531 CACCTCCAGCTGCTGCAGGAAGG - Intergenic
1121138653 14:91521552-91521574 AACCTGCAGATGCTTCAGAAGGG - Intergenic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121633533 14:95438736-95438758 CACTAGCAGCAGCTCCTGCAGGG - Intronic
1122293150 14:100690279-100690301 CACCTGCAGCACCTCCTGGAGGG - Intergenic
1122618857 14:103041676-103041698 CACCGGCCGCAGCTGCAGCTTGG + Intronic
1122887462 14:104716587-104716609 CACGTGTAGCAGGTTCAGGAGGG - Intronic
1123019871 14:105392633-105392655 CACCTGCAGCCCCATCAGCTCGG - Exonic
1124003906 15:25781040-25781062 CACCTGCCGCCGCTTCAGGTTGG + Exonic
1124477012 15:30044510-30044532 CACCTGCGGCTGCGTCAGGAAGG - Intergenic
1124551417 15:30684303-30684325 CATTTGAAGCAGCATCAGCATGG + Intronic
1124679831 15:31721362-31721384 CATTTGAAGCAGCATCAGCATGG - Intronic
1125680630 15:41528048-41528070 TAACTTCAGCATCTTCAGCAAGG - Intronic
1125716120 15:41820935-41820957 CAGCTGCCGCAGATCCAGCATGG - Exonic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126183650 15:45810268-45810290 CACCTCCAGCGGCCGCAGCATGG + Intergenic
1127796776 15:62445160-62445182 CACCTGCAGGTGCTGCAGCCTGG - Intronic
1128548497 15:68583107-68583129 CTCCTGCCTCAGCTCCAGCAGGG + Intronic
1128800863 15:70496080-70496102 CACCTGTAGAAGCTGCAGCTGGG - Intergenic
1129412317 15:75356711-75356733 CAACTCCAACAGCTTCAGCGTGG - Exonic
1129465919 15:75724160-75724182 GAGCAGCAGCAGCTACAGCAGGG - Exonic
1129607949 15:77033986-77034008 CACCTGAAGCAGTATCAGGAAGG + Intronic
1129628903 15:77235840-77235862 CAGCTGCTTCAGCTCCAGCATGG + Intronic
1129975335 15:79816812-79816834 CACATGCAGCGGCTTCTGGATGG + Intergenic
1131512501 15:93056996-93057018 CATCTGCTGGAGCTTCACCAGGG - Intronic
1131747449 15:95464297-95464319 CACTTGCAGCTGCTTCTGGAAGG + Intergenic
1132469797 16:96011-96033 GACCTGCAGCAGGGACAGCAGGG + Intronic
1132699923 16:1217962-1217984 CACCTTCAGCAACTTCGGCATGG + Exonic
1133111391 16:3550133-3550155 CAGCTGCAGCAGCTTTGGTAGGG - Intronic
1134419100 16:14070097-14070119 CACCTGCAACAGCGTCTGCATGG - Intergenic
1135007353 16:18838179-18838201 GGCCTCCAGCAGCGTCAGCAGGG + Exonic
1135397162 16:22139988-22140010 CTCCTGCAGCAGATTCAGAAGGG - Intronic
1135943295 16:26841588-26841610 TCCCTGCAGCAGGTTCAGAATGG + Intergenic
1136024753 16:27462291-27462313 CACCTGGAGCAACTCCAGCACGG + Exonic
1136589287 16:31207723-31207745 CTCCTGCAGCAGTTTCAGGTCGG + Intergenic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1138190669 16:55011061-55011083 CAGCTGGAGCAGCTGCAGGATGG + Intergenic
1138415694 16:56870216-56870238 CACCTGGAGCAGGTCCCGCACGG - Exonic
1138549592 16:57740250-57740272 CACAGGCAGCAGCGCCAGCAAGG - Intronic
1139286874 16:65823122-65823144 CACCTGCAGCAGGTTCCAAAGGG + Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139370002 16:66461157-66461179 CCCCTGTACCAGCTGCAGCAAGG - Intronic
1139552560 16:67683198-67683220 CACCAGCAGCAGCATCACCTGGG - Intronic
1139582758 16:67883130-67883152 ATCCTGCAGCTGCTGCAGCAGGG + Exonic
1139721862 16:68862563-68862585 AAACTGCAGCACCTTCTGCAGGG + Intronic
1139722191 16:68865353-68865375 AAACTGCAGCACCTTCTGCAGGG + Intronic
1140200362 16:72889940-72889962 CACCTGCAGCAGCATGAGAGTGG - Exonic
1140309460 16:73835125-73835147 CATCTGAAGCAGCTTCTGCAGGG + Intergenic
1142143384 16:88482594-88482616 TACCTGCTGCAGCCTCAGGAAGG - Intronic
1142157827 16:88540633-88540655 GACCTGCAGCAGCTTCTGTCTGG + Intergenic
1142177042 16:88650192-88650214 CCACTGCAGCAGCTCCAGGAAGG - Intronic
1142299719 16:89249269-89249291 AACCTGCAGCAGTAACAGCATGG + Intergenic
1142426895 16:90006304-90006326 CACCTGCCCCAGCTCCTGCAGGG - Exonic
1142502095 17:338945-338967 CTCCGCCAGCAGCTTCTGCACGG + Intronic
1143464785 17:7129473-7129495 CACCTGCAGCAGCGCCACCCCGG + Intergenic
1143862964 17:9904717-9904739 CCTCTGCAGCAGCTGCAGCAGGG + Intronic
1144461048 17:15458827-15458849 CACCAGCAGCAGCAACACCAGGG + Intronic
1145998210 17:29116441-29116463 TACCTTCAGCAGCTTCTGTAAGG + Exonic
1146743358 17:35305740-35305762 CACATGCATAAACTTCAGCATGG + Intergenic
1146780352 17:35665368-35665390 CACCTGCCTCAGCTTCCGTAAGG + Intronic
1147245151 17:39115440-39115462 GACCTGCAGCAGATTCTGCATGG - Intronic
1147539184 17:41342777-41342799 CACCTGCAGCAGGCTCAGCGAGG + Intergenic
1147787609 17:42991013-42991035 CACCTCCAGCCTCTTCAGCAAGG - Exonic
1148400609 17:47356896-47356918 CCCCGACAGCAGCTGCAGCAAGG - Intronic
1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG + Exonic
1150440607 17:65188341-65188363 CTGCTCCAACAGCTTCAGCAAGG + Intronic
1150484293 17:65533213-65533235 CCCCTGCAGGGGCTTCAGGAAGG - Intronic
1151227040 17:72655351-72655373 CACCTGCATCAGCTCCAGAGTGG + Intronic
1151555319 17:74843529-74843551 CATCTACAGCTGCTTCAGCGGGG - Exonic
1151557200 17:74852555-74852577 CACCTGCAGCTGCTGCTCCAGGG + Exonic
1151575863 17:74952304-74952326 CACCTGCAGCAGCCTCATGATGG + Exonic
1151716350 17:75833013-75833035 CACCTCCAGGAACTTCATCAGGG + Exonic
1152068639 17:78124614-78124636 CACCAGCAGCAGCAGCAGGAGGG + Exonic
1152142916 17:78548953-78548975 CAGCTGCTGCAGCTTCAGAATGG + Intronic
1152460669 17:80440623-80440645 CACCAGCAGCAACATGAGCATGG - Intergenic
1152469302 17:80482081-80482103 AGCCTGCAGCAGCTGCAGCCAGG + Intergenic
1152662151 17:81547470-81547492 GAACAGCAGCAGCTTCAGCCTGG - Exonic
1152757040 17:82091394-82091416 CTGCTCCAGCAGCTTCTGCACGG + Exonic
1152768234 17:82152364-82152386 CCCCTGCACCTGCTTCAGGAGGG - Intronic
1152795734 17:82305226-82305248 CATCTGCCGCAGCTTCTCCAAGG - Intergenic
1156675649 18:39524608-39524630 CATGTGCATCAGCTTCAGGATGG + Intergenic
1157063503 18:44320871-44320893 CAGCTGCATCAGCTCCACCAGGG - Intergenic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1160701065 19:507658-507680 CGCCTCCAGCACCTTCAGCAGGG - Exonic
1161384319 19:3982909-3982931 CTCCAGCTGCAGCTCCAGCAGGG + Exonic
1161930672 19:7337392-7337414 CACCTGCAGAAGACTCATCAGGG - Intergenic
1162523097 19:11193474-11193496 CAGCTGCCGCAGCTTCCGCAGGG + Exonic
1162722904 19:12673015-12673037 CACCTGCACCTGCTTCAGCCGGG + Exonic
1164524239 19:29001585-29001607 AAGCGGCAGCAGCTTCAGAAAGG + Intergenic
1164705534 19:30316841-30316863 CACCTGGACCAGGCTCAGCACGG - Intronic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1168275272 19:55274453-55274475 CAGCCGCAGCAGCTTACGCAGGG + Exonic
1168524677 19:57079274-57079296 CACCTGCGGCAGCTGCTCCATGG - Intergenic
1168632329 19:57967190-57967212 CAACTGAAGCAGTTTCAGGAGGG + Intronic
926251047 2:11155599-11155621 GATCTGCGGCAGCTTCAGCGCGG - Exonic
926302965 2:11617609-11617631 CACTTGCAACACCTTCCGCAAGG - Intronic
926333860 2:11848831-11848853 CACCTGCAGCAGCATCGCTAAGG - Intergenic
928177675 2:29046155-29046177 CACCAGCTGAAGCTTGAGCAAGG - Intronic
928178676 2:29052538-29052560 CACGTGCTGCAGCTTTTGCAGGG - Exonic
928195520 2:29214040-29214062 CACGTGCAGAAGGTCCAGCATGG + Exonic
928683677 2:33727473-33727495 CACCTTCAGCAGCCCCAGCTCGG + Intergenic
929454789 2:42058059-42058081 CATGTGCAGCAGCAGCAGCAGGG - Exonic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604364 2:43225376-43225398 CACCTGCAGCAGCAGCAGAAGGG - Exonic
930028883 2:47046326-47046348 CACCTGCTCCAGCTTCACCTTGG - Exonic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
930617334 2:53607242-53607264 CAACTGCATCAGCCACAGCAGGG + Intronic
930872556 2:56183913-56183935 AACCCGCAGCAGCTCCCGCATGG - Intergenic
931282309 2:60804876-60804898 CACCTGGAGCGGCTGCAGCAGGG - Intergenic
931684969 2:64785027-64785049 CACCAGGAGCAGCTGCACCAAGG + Intergenic
931881394 2:66574868-66574890 CAGCCGCAGCAGCAGCAGCAGGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932448945 2:71797477-71797499 CAACTGCAGCCGCTTCTCCATGG - Intergenic
933197331 2:79407106-79407128 GACCTCCAGCTGCTTCAGGATGG + Intronic
933226434 2:79754553-79754575 CTCCTGCAGCACTTTCCGCAGGG + Intronic
936008090 2:108907842-108907864 CACCTGCAGGAGCCTCACCCCGG + Exonic
936400277 2:112159715-112159737 CAGCTGCAGCAGCTGCTGAAGGG + Exonic
936558210 2:113514267-113514289 GAGCTGAAGCAGCTGCAGCAGGG + Intergenic
936712065 2:115142886-115142908 CACCACCAGCAGCAGCAGCAAGG - Intronic
937083876 2:119158225-119158247 CGCCTGCAGCAGCAGCGGCACGG + Exonic
937325621 2:120988304-120988326 CTCCTGCAGCTGGCTCAGCATGG - Exonic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
938483743 2:131682512-131682534 CCCCTGCAGCAGCAGCAGCGTGG + Intergenic
941656696 2:168152052-168152074 CACCTGGAGCAGCAACAGAAGGG + Intronic
942553546 2:177147161-177147183 CACCTGGAGTAAATTCAGCATGG - Intergenic
943064377 2:183071114-183071136 CAGCTGCATCAGCTACACCAGGG - Intergenic
943186668 2:184615822-184615844 CACTGGAAGCAGCTGCAGCAGGG + Intronic
943273078 2:185832303-185832325 CAACAGCAGCAGATTGAGCAGGG + Intronic
943425802 2:187732132-187732154 GATCTGCAGCAGCAGCAGCAGGG + Intergenic
944382614 2:199128973-199128995 CACATGCAACAGCATCATCAGGG - Intergenic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
945022995 2:205592882-205592904 CACCTGCAGCAGATGCCCCATGG + Intronic
945178687 2:207069222-207069244 CACCTGCATCAGAATCATCAAGG - Intergenic
945298301 2:208192628-208192650 CAGCTGCAGCAGCCTCAGCTGGG - Intergenic
946320823 2:218953479-218953501 CAGCTGCACCAGCTCCACCAGGG - Intergenic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947912911 2:233813262-233813284 CAGCAGCAGCAGCTTCACCTTGG - Intronic
948987129 2:241532632-241532654 CTCCTGCAGAAGCTGCAGCTTGG + Intergenic
1168946992 20:1769245-1769267 CACCAGCAGCAGCTTTTCCAGGG + Intergenic
1169687205 20:8288698-8288720 CACCTTCAGCATCTGCAGGATGG + Intronic
1170986763 20:21266095-21266117 CATCTGCAGCACATGCAGCAAGG + Intergenic
1171198030 20:23216512-23216534 CATCAGCATCAGCATCAGCAGGG + Intergenic
1172224696 20:33297505-33297527 CAGCTGCAACAGCATAAGCAAGG - Exonic
1173720402 20:45253228-45253250 CCCCTGCTCCAGCTTCAGCAGGG + Intronic
1173895290 20:46546181-46546203 GACCTGCAGCAGCAGCAGCCAGG + Exonic
1174079757 20:47962590-47962612 CACCTGCAGCTGCCTCTGGAAGG + Intergenic
1174367355 20:50064627-50064649 CCCCTGCAGCAGCCACTGCAGGG + Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175220094 20:57411857-57411879 CACAGGCAGCTGCTTCAGGAGGG - Intergenic
1175381754 20:58568599-58568621 CTCCTGCAGCAGCACCAGCAGGG - Intergenic
1175900769 20:62359107-62359129 CACCTGTAGCACCTGCAGCGTGG + Intronic
1176308186 21:5135330-5135352 CACCTGCCGCAGCTGCAGCGAGG - Intronic
1176688203 21:9873618-9873640 CATGTGCACCAGCTGCAGCAGGG - Intergenic
1177037292 21:16060179-16060201 CACCTGGTCCAGCTGCAGCAGGG - Intergenic
1177212565 21:18088403-18088425 GACCTAGAGCAGCCTCAGCAGGG - Intronic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1179022085 21:37649613-37649635 CACCTGCAGAAATGTCAGCAAGG - Intronic
1179053157 21:37906581-37906603 AACCAGCAGCAGCATCACCAGGG - Intronic
1179081771 21:38178297-38178319 CATCTGCAGCAGCAAGAGCAGGG - Intronic
1179449466 21:41458613-41458635 GTCCTGCAGGAGCTGCAGCATGG - Exonic
1179678799 21:43003226-43003248 GACCTGCACCAGCAGCAGCAAGG + Intronic
1179848874 21:44126702-44126724 CACCTGCCGCAGCTGCAGCGAGG + Intronic
1180127286 21:45801119-45801141 CACCTGCAGCACCCACAGCCTGG + Intronic
1181104296 22:20564450-20564472 CACCTGCTGGAGCTGCAGCTGGG - Exonic
1181172034 22:21015293-21015315 AAACTGCAGCAGCCTCTGCAGGG - Exonic
1181177271 22:21044907-21044929 AAACTGCAGCAGCCTCTGCAGGG + Intergenic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181599513 22:23941232-23941254 CACCTGCATCATCTCCACCACGG - Intergenic
1181601987 22:23958282-23958304 CACCTGCATCAGCTCCTCCAGGG + Exonic
1181606522 22:23983025-23983047 CACCTGCATCAGCTCCTCCAGGG - Exonic
1181608997 22:24000072-24000094 CACCTGCATCATCTCCACCACGG + Intergenic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182204579 22:28610410-28610432 CACCAGCAGAAGCTGCAGAACGG - Intronic
1183448666 22:37877912-37877934 CACCTTCAGCTGCTGCAGGAAGG - Exonic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184559685 22:45254878-45254900 CAGCGGCAGCAGAATCAGCAGGG - Intergenic
1184660609 22:45963945-45963967 CACCTCCAGGAGCTGCAGCCTGG + Intronic
1184871261 22:47239954-47239976 CACCTGCAGCGGCTGGGGCAGGG - Intergenic
1185249298 22:49791374-49791396 CACTTGAAGCAGCTTGAACAAGG - Intronic
1185322717 22:50209308-50209330 CCCCTGGAGCAGCTGCAGCCAGG + Intronic
1185418043 22:50720691-50720713 CACCTGCAGCTGCTTCACCAGGG - Intergenic
949625127 3:5857153-5857175 CTCCTGCCTCAGCTTCAGCTGGG - Intergenic
949951509 3:9232818-9232840 CACCTGCAGCAGAATCACCTTGG - Intronic
950395945 3:12734289-12734311 TACCTGCATCAGGTTCACCAAGG + Exonic
950408884 3:12821504-12821526 CACGTGCAGAAGCTCTAGCAAGG + Intronic
950432350 3:12958146-12958168 CACCTGCACCAGGTCCTGCAAGG - Intronic
950435676 3:12978321-12978343 CAGCAGCAGCAGCCTCAGCTGGG + Intronic
951017414 3:17745555-17745577 CAGCTGCGGCAGCTTGAGTAGGG - Intronic
951770441 3:26250230-26250252 CACCTGCAGCTGCTGCTGCTCGG + Intergenic
953832314 3:46310905-46310927 CATCTCCAGCAGCTGCAGCCTGG + Intergenic
954224020 3:49171470-49171492 CACATGCCGCAGCTGGAGCAGGG - Intergenic
954297211 3:49680972-49680994 CACCTCCAGAAGGTACAGCATGG - Intronic
956179658 3:66505222-66505244 GAACTGCAGCAGCTGCAGCTTGG - Intergenic
956525032 3:70149435-70149457 CAGCAGCATCAGCTTCAGCTGGG + Intergenic
956738462 3:72256845-72256867 CATCTCCAGCAGCACCAGCAAGG - Intergenic
957186872 3:76952777-76952799 CTCCTCCAGCATGTTCAGCAGGG + Intronic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
962188033 3:133280709-133280731 AACCTGGACCAGATTCAGCAAGG + Intronic
963234646 3:142945148-142945170 CACCTGCAGGATGTGCAGCAGGG + Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
965373720 3:167895820-167895842 CTCCTGGAGCAGCTTTAACAGGG - Intergenic
965749492 3:171961169-171961191 CACCTGCATGAGTTTCAGGATGG + Intergenic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966855683 3:184192629-184192651 CCCCAAAAGCAGCTTCAGCATGG - Exonic
966902639 3:184497949-184497971 TAATTGCAGCAGCTTCATCATGG + Intronic
968729248 4:2261945-2261967 CGCCTCCAGCAGGATCAGCAGGG + Exonic
968967850 4:3778339-3778361 CAGCTGCAGCAGCAGCAGCTGGG + Intergenic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
972554067 4:40163390-40163412 CACCTGCAGGAGCTACAGAGGGG - Intergenic
972765868 4:42151988-42152010 CACGTGCGGCAGCTCCACCAGGG + Exonic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973636420 4:52865461-52865483 CACGTGCAGCAGCTACACCTGGG + Exonic
974981271 4:68960267-68960289 CACCTTCAGGAGCTGCAGCTGGG + Intergenic
976039981 4:80871723-80871745 CACCTGCAAACACTTCAGCATGG + Intronic
977659182 4:99563365-99563387 CACCTGCAGCAACTTCCCCTCGG + Exonic
978090377 4:104707674-104707696 CACCAGCAGAAGCTGCAGAATGG - Intergenic
978852154 4:113352013-113352035 CACCTTCAGCAGCTTATGCATGG + Intronic
978953012 4:114583601-114583623 CACCTGCCGCAGCCTCACAAAGG - Intergenic
979478442 4:121185744-121185766 CACTAGCAGCAGCTTCAGAATGG + Intronic
980273594 4:130618775-130618797 CATCTGCATCAGCTTCATGAAGG - Intergenic
980351575 4:131691457-131691479 CATGTGCACCAGCTGCAGCAGGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
983889463 4:173015970-173015992 CAGCTGCTTCAGCTCCAGCATGG + Intronic
984437901 4:179727391-179727413 CAGCTTCAGCAGCTTCAGAATGG - Intergenic
985279473 4:188270965-188270987 CACCAGCAGCAGCAGCAGCCTGG + Intergenic
985572940 5:660019-660041 CACCTGCAGGAGGAACAGCAGGG + Exonic
985947178 5:3194906-3194928 GACCTGCAGCAGCAGCAGCCAGG + Intergenic
986296937 5:6447072-6447094 CACCAGCAGCAGCGGCAGCAAGG + Intergenic
986954411 5:13133867-13133889 CACCTCCAGCAGCTTAAGCATGG + Intergenic
987065633 5:14286942-14286964 CTCCTGCAGGATCTTCAGAAGGG - Exonic
988782238 5:34532932-34532954 CAATTGCAGCAGGTGCAGCAAGG + Intergenic
989219062 5:38934747-38934769 CACCTGCCTCAGCTTCCCCAAGG + Exonic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
991272734 5:64804061-64804083 CACCTGTAGCAGATTCTTCAAGG + Intronic
992148136 5:73873575-73873597 CATCTGCAGTTGCTTTAGCATGG + Intronic
992365224 5:76083651-76083673 CACCTGCAGCCGCTTCCCCGGGG - Intronic
992579480 5:78157158-78157180 CACTTGCAGTACCTTCAGTAGGG - Intronic
992957373 5:81923714-81923736 CACTTTCAGCAGCCTCACCAAGG - Intergenic
994034038 5:95178173-95178195 CCCCCACAGCAGCTGCAGCAAGG + Intronic
994643015 5:102433746-102433768 CAACAGCAGCAGCGGCAGCATGG + Intronic
994970565 5:106731286-106731308 CACCAGCAGCAGTGGCAGCATGG - Intergenic
995301999 5:110595094-110595116 CACCAGCAGAAGCTGCAGTATGG - Intronic
995442324 5:112205779-112205801 CACCTGCAGGAGAGGCAGCAAGG + Intronic
995567879 5:113450784-113450806 CACCATCAGCATCTTCAGTAAGG + Intronic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
997452192 5:133992680-133992702 CCACTGCAGCAGCTTCCACAGGG + Intronic
998550140 5:143069454-143069476 AACCTGCAGCAGATTCACAAGGG - Intronic
999132968 5:149298801-149298823 CACCAGCATCAGCTGCAGCTTGG + Intronic
999141887 5:149367829-149367851 CTTCTGCAGCCGCATCAGCATGG + Intronic
999228548 5:150047636-150047658 CTCCTGGAGCAGCCTCACCAAGG - Exonic
999922648 5:156338751-156338773 CACCTCCAGTAGCCTCATCAGGG - Intronic
1000231565 5:159320312-159320334 CACCAGCAGCTTCTTCATCAGGG - Exonic
1001318763 5:170663352-170663374 GGCATGCACCAGCTTCAGCACGG - Intronic
1001794438 5:174490347-174490369 CACCTGCAGAGGCAGCAGCAGGG + Intergenic
1002322070 5:178382224-178382246 CAGCCGCAGCAGCTGCAGCTGGG - Intronic
1002986446 6:2193426-2193448 CATCTGCAGCTGCCACAGCAGGG + Intronic
1003083860 6:3045382-3045404 CAGCTGCTGCAGCTCCACCATGG - Intergenic
1003993656 6:11515024-11515046 TTCCTGCATCAGCTTCAGGAGGG - Intergenic
1004004788 6:11628649-11628671 CAGCAGCAGCAGCTACAGGAAGG - Intergenic
1004564325 6:16781359-16781381 CAGCTGCAGCAGCATCACCTGGG + Intergenic
1006395481 6:33784380-33784402 TTCATGCAGCAGCTCCAGCAAGG + Exonic
1007224457 6:40303091-40303113 CACTTGCAGCACCTGCAGCCAGG + Intergenic
1007323610 6:41043941-41043963 CAGCAGCAGCAGGTGCAGCAGGG - Exonic
1007414690 6:41684619-41684641 CCGCCGGAGCAGCTTCAGCATGG - Exonic
1007570979 6:42890697-42890719 CTCCTGCAGCTGGTCCAGCAGGG - Exonic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1009939006 6:70267842-70267864 CAACTGCAGAAGATTCAGCCTGG - Intronic
1009940057 6:70280862-70280884 CACCTGCAGGACCCTGAGCAGGG + Exonic
1010018352 6:71130531-71130553 GACCTGCAACACCTCCAGCAAGG - Intergenic
1011261559 6:85475638-85475660 AACCTGCAGCAGGTACAACAGGG + Intronic
1011399929 6:86949355-86949377 CAACAGCAGCAGCAGCAGCAGGG - Intronic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1013540725 6:111105820-111105842 CACTTCCAGCACCTTCAGCTGGG - Intronic
1014290936 6:119557728-119557750 CCCCAGCAGCACCGTCAGCATGG + Intergenic
1015878916 6:137851454-137851476 CACCAGCAGCAGCAGCAGCTGGG + Intergenic
1016675192 6:146756969-146756991 CACCTGCATCAGCTTCCCCAAGG + Intronic
1016764112 6:147773329-147773351 CAGATGCTGCAGCTTGAGCAAGG + Intergenic
1018095790 6:160386103-160386125 CACCTTGAGCACCTTGAGCACGG + Intronic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018317316 6:162569632-162569654 CAGCTGCACCAGCTCCACCAGGG + Intronic
1018992079 6:168681886-168681908 CACCTGCAGCAGCTCAGCCATGG - Intergenic
1022333291 7:29399956-29399978 CACTGGCAACAGCTCCAGCAGGG + Intronic
1022480195 7:30738612-30738634 CAGCAGCAGCAGCATCACCAGGG - Intronic
1023278958 7:38550224-38550246 CACCAGCATCAGCCTCACCAGGG + Intronic
1023416380 7:39937027-39937049 CACCTCCAGCAGCCTGTGCACGG + Intergenic
1023969550 7:44980836-44980858 AACCAGCAGCAGCTAAAGCAAGG - Intergenic
1026459571 7:70601793-70601815 GACCTTCACCAGCCTCAGCAAGG + Intronic
1027681887 7:81232587-81232609 CACCTGCAGCAGGGCAAGCAGGG + Intergenic
1028593930 7:92528304-92528326 TACCTGCAGCAGATGCAGCTGGG + Exonic
1029336885 7:99908579-99908601 CACCTGAAGCAGCTCCAGGGTGG + Exonic
1032539545 7:132691943-132691965 CAGCTGCAAGAGGTTCAGCAGGG - Intronic
1032568801 7:132977213-132977235 CAGCTGCAGTAGCATCAGCTGGG + Intronic
1032780165 7:135158881-135158903 AACCTGGAGCAGCCTCAGCAGGG - Intronic
1033142278 7:138838288-138838310 CACCTGCAGCATAGGCAGCAGGG - Intronic
1033214474 7:139483541-139483563 CACCTGCGGCTGCTCCAGCGTGG + Exonic
1033353073 7:140578172-140578194 CAACTGAAGAGGCTTCAGCAGGG - Intronic
1034783018 7:153899072-153899094 TACCAGCAGCAGCTACAGGAGGG - Intronic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035635254 8:1139393-1139415 CACCTGCTGCACCTTGATCACGG - Intergenic
1036431743 8:8698325-8698347 AACCTGCAACAGCTTCATCTTGG - Intergenic
1037815017 8:22107552-22107574 CTCCTGCAGCAGCCGCAGGACGG + Exonic
1037856405 8:22374374-22374396 CACTTACTGCAGCTTCAGGAAGG - Intronic
1038543918 8:28411663-28411685 CACCTGCAGAACTTTCAGGAAGG - Intronic
1038883650 8:31640246-31640268 CACCCGCAGCGGCGGCAGCAGGG + Intronic
1039210274 8:35205134-35205156 CATCTGCAGCAGCTGCTGCAAGG - Intergenic
1039763929 8:40608242-40608264 CTCCAACAGCAGCTACAGCAAGG - Intronic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041706227 8:60849081-60849103 AATCTGCAGGAACTTCAGCATGG - Exonic
1041943404 8:63414114-63414136 TATCTGCAGCAACTGCAGCATGG + Intergenic
1045385812 8:101670088-101670110 CACCTGCACCAACCTCTGCATGG + Intergenic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048561954 8:135548836-135548858 CACCTGCAGAAGCTTATGCCAGG + Exonic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048986821 8:139739193-139739215 CACCGGCAGCAGCTCAAGCTGGG + Intronic
1049399675 8:142419337-142419359 CAGATGCAGCAGGTGCAGCAGGG + Intergenic
1049416448 8:142497689-142497711 CCCCTGCAGCAGCTTGGGCCTGG + Intronic
1049681322 8:143919762-143919784 GCCCTGCAGCAGCGTCCGCACGG + Exonic
1049791082 8:144473032-144473054 CACCTGCAGCAGCAGCACCGCGG - Exonic
1049894652 9:101999-102021 GAGCTGAAGCAGCTGCAGCAGGG - Intergenic
1053351460 9:37416110-37416132 CACCAGCAGCAGCATCACCCGGG + Intergenic
1053735859 9:41101989-41102011 GAGCTGAAGCAGCTGCAGCAGGG - Intergenic
1053781137 9:41608255-41608277 CATGTGCACCAGCTGCAGCAGGG + Intergenic
1054169084 9:61818408-61818430 CATGTGCACCAGCTGCAGCAGGG + Intergenic
1054668448 9:67762408-67762430 CATGTGCACCAGCTGCAGCAGGG - Intergenic
1054692515 9:68329409-68329431 GAGCTGAAGCAGCTGCAGCAGGG + Intronic
1055489206 9:76787713-76787735 GTCCTGCAGCAGCTTCAACCTGG + Intronic
1056052252 9:82781382-82781404 CACCAGCAGCAGCATCACCTGGG + Intergenic
1056111694 9:83402672-83402694 CACATGTATCAGCCTCAGCAGGG + Intronic
1056579543 9:87880830-87880852 CCCCTGCAGCAGCAGGAGCAAGG + Intergenic
1057131212 9:92655838-92655860 CACCCACAGCAGCTGCAGAAGGG + Intronic
1057410032 9:94809951-94809973 CACCTGCAGCACAATCAGCTGGG - Intronic
1059477993 9:114563507-114563529 CACATTCAGCAGCTTCTGCAGGG - Intergenic
1059602015 9:115789006-115789028 CACCTGCAGCACCTACTGCCTGG + Intergenic
1060035976 9:120256107-120256129 TACTTCCAGCAGCTTCTGCATGG + Intergenic
1060505663 9:124196833-124196855 GACATGGAGCAGCTTCAGGAAGG + Intergenic
1060588495 9:124801499-124801521 CACCTGAAGCAGCTTCTCCTTGG - Exonic
1060618696 9:125043778-125043800 CATCTGGAGCAGCTGCTGCAGGG + Intronic
1060881935 9:127123414-127123436 TACCTGCAACAGCTGCAGCGAGG + Intronic
1060984161 9:127810087-127810109 CACCTGCAGCAGCTTCAGCAGGG - Exonic
1061137217 9:128741818-128741840 CTTCTGAATCAGCTTCAGCATGG + Exonic
1061955481 9:133959247-133959269 CACCTGGGGCAGCTGCTGCACGG + Intronic
1062271624 9:135712507-135712529 CACCTGAACCAGCTTCAACAGGG + Intronic
1062491255 9:136806172-136806194 CAGCTCCAGCTGCTTCACCAGGG - Exonic
1062576230 9:137209688-137209710 CACCTACAGCATCCTCAGCAAGG - Intronic
1186224735 X:7386654-7386676 CAGCTGCAGGTGCTTCAGCAGGG - Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186495089 X:10006744-10006766 CTCCTGCTGCTGCTTCAGTAGGG - Intergenic
1187219194 X:17307739-17307761 CCCCCACAGCAGCTGCAGCAAGG - Intergenic
1187682151 X:21778391-21778413 CAGCTGCTGCAGCTTCCCCAAGG + Intergenic
1189348804 X:40262127-40262149 CTCCTGCAGCAGCAGCAGCCTGG + Intergenic
1189774383 X:44457085-44457107 CATCTGCAGCAGCTAGAGGATGG + Intergenic
1189893721 X:45632361-45632383 CAGCCGCACCAGCTTCACCAGGG - Intergenic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190296397 X:49030172-49030194 CCGCCGCAGCAGCTTCAGCATGG - Exonic
1193412716 X:81183627-81183649 CCCCTGCAGCAGCTTCTGCCTGG - Intronic
1194358782 X:92920616-92920638 CACCCCCTGCAGCTTCAGCATGG - Intergenic
1194583437 X:95704798-95704820 CACCCCCAGCACCTTCAGCCTGG + Intergenic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1198434339 X:136601075-136601097 AACATGCAGCAGCTTCCCCATGG + Intergenic
1198694753 X:139324239-139324261 CACCTGCTGCAGCAGCTGCATGG + Intergenic
1200062383 X:153489318-153489340 CACCTGCCCCTCCTTCAGCACGG + Intronic
1200268879 X:154662603-154662625 CAGCTGCACCAGCTGCAGCTGGG + Intergenic
1200666948 Y:6036310-6036332 CACCCCCTGCAGCTTCAGCATGG - Intergenic