ID: 1060985090

View in Genome Browser
Species Human (GRCh38)
Location 9:127815227-127815249
Sequence AGTTCAGGTGTGGAGGCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 178}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060985084_1060985090 -3 Left 1060985084 9:127815207-127815229 CCCTGCCAGTTAGTTAGGCAAGT 0: 1
1: 0
2: 1
3: 5
4: 117
Right 1060985090 9:127815227-127815249 AGTTCAGGTGTGGAGGCCGCAGG 0: 1
1: 0
2: 2
3: 14
4: 178
1060985086_1060985090 -8 Left 1060985086 9:127815212-127815234 CCAGTTAGTTAGGCAAGTTCAGG 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1060985090 9:127815227-127815249 AGTTCAGGTGTGGAGGCCGCAGG 0: 1
1: 0
2: 2
3: 14
4: 178
1060985078_1060985090 28 Left 1060985078 9:127815176-127815198 CCCAGGCTGGGCTCCGCTAGGCT 0: 1
1: 0
2: 3
3: 33
4: 226
Right 1060985090 9:127815227-127815249 AGTTCAGGTGTGGAGGCCGCAGG 0: 1
1: 0
2: 2
3: 14
4: 178
1060985079_1060985090 27 Left 1060985079 9:127815177-127815199 CCAGGCTGGGCTCCGCTAGGCTC 0: 1
1: 0
2: 2
3: 39
4: 242
Right 1060985090 9:127815227-127815249 AGTTCAGGTGTGGAGGCCGCAGG 0: 1
1: 0
2: 2
3: 14
4: 178
1060985080_1060985090 15 Left 1060985080 9:127815189-127815211 CCGCTAGGCTCCTGTCTCCCCTG 0: 1
1: 0
2: 4
3: 41
4: 377
Right 1060985090 9:127815227-127815249 AGTTCAGGTGTGGAGGCCGCAGG 0: 1
1: 0
2: 2
3: 14
4: 178
1060985083_1060985090 -2 Left 1060985083 9:127815206-127815228 CCCCTGCCAGTTAGTTAGGCAAG 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1060985090 9:127815227-127815249 AGTTCAGGTGTGGAGGCCGCAGG 0: 1
1: 0
2: 2
3: 14
4: 178
1060985081_1060985090 5 Left 1060985081 9:127815199-127815221 CCTGTCTCCCCTGCCAGTTAGTT 0: 1
1: 0
2: 3
3: 14
4: 153
Right 1060985090 9:127815227-127815249 AGTTCAGGTGTGGAGGCCGCAGG 0: 1
1: 0
2: 2
3: 14
4: 178
1060985085_1060985090 -4 Left 1060985085 9:127815208-127815230 CCTGCCAGTTAGTTAGGCAAGTT 0: 1
1: 0
2: 1
3: 5
4: 68
Right 1060985090 9:127815227-127815249 AGTTCAGGTGTGGAGGCCGCAGG 0: 1
1: 0
2: 2
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060985090 Original CRISPR AGTTCAGGTGTGGAGGCCGC AGG Exonic
900323012 1:2094266-2094288 AGTTCAGGCCGGGAGGCCGAGGG - Intronic
900798566 1:4724162-4724184 AGGTCACGTGTGGTGGCCGCGGG + Intronic
901063051 1:6482244-6482266 TGACCAGGTGTGGAGGCAGCAGG - Intronic
902470097 1:16643182-16643204 AGGTCAGGTGTGGGGGCCCCTGG - Intergenic
904585323 1:31576784-31576806 AGGTCAGGGATGGAGGCTGCTGG + Intronic
905142140 1:35855890-35855912 AGTGCAGGTGTGGTGCCCGCTGG - Exonic
905239434 1:36572281-36572303 AGCTCATGTGGGGAAGCCGCCGG - Intergenic
905441110 1:37997080-37997102 AGTCCAGGTTTGGAGGGCTCGGG + Exonic
905692993 1:39956210-39956232 AGCTCAGGGGTGGAGGGCGATGG + Intronic
906545187 1:46615378-46615400 AGTTCAGGAGAGGAGGCTGTGGG - Intronic
906711030 1:47930091-47930113 AGTTCTGGAGTGGAGGCTGTGGG + Intronic
908556894 1:65265487-65265509 AGGTAAGGTGTGGAGGCTGATGG - Intronic
912771103 1:112464968-112464990 AGTTCAGGTGCGGAAGGCGTCGG - Intergenic
914902460 1:151718124-151718146 AGCTCAGGAATGGAGGCCCCTGG - Intronic
919806235 1:201382499-201382521 ATTTCAGGAGTGGAGGCAGTCGG - Intronic
920333257 1:205227718-205227740 AGTTCAGGGGCGGGGGCGGCGGG - Intergenic
922617627 1:226972210-226972232 AGTTCCTGTGTGAAGGCCCCAGG - Intronic
923323511 1:232859776-232859798 AGTCCAGGTGTGGGAGCAGCAGG - Intergenic
923897151 1:238284415-238284437 AGTTCAGGTGGGGAAGCAGCTGG + Intergenic
1062924130 10:1301848-1301870 GGTGCATGTGTGGAGGCAGCAGG - Intronic
1070129417 10:73646732-73646754 AGCTCATGTGTGGAGGCCTGGGG - Exonic
1071517474 10:86308276-86308298 AGTTCAGGTCTGGAGGTAGACGG - Intronic
1071889465 10:89987315-89987337 AGTGCATGTGTGGAGGGTGCTGG + Intergenic
1072460185 10:95611549-95611571 AGTTCAGTTGTTGAGGCTACAGG - Intronic
1072716336 10:97755267-97755289 GGTTCAGGAGCAGAGGCCGCAGG - Intronic
1073567321 10:104546245-104546267 AGTTCAGGGCTGGGGGCCGGAGG - Intergenic
1075732331 10:124643986-124644008 CGAGCAGGTGTGGAGGCCCCTGG - Intronic
1076761790 10:132609556-132609578 ATTTCAGCTGTGTAGGCGGCAGG - Intronic
1077283654 11:1756557-1756579 AGCTCAGGGCAGGAGGCCGCCGG + Intronic
1079339629 11:19601384-19601406 AGTCCAGGAGGGGAGGCCGGAGG - Intronic
1084284474 11:68122115-68122137 AGTTCAGGGCTGGAGGCCCAGGG + Intergenic
1084432967 11:69121815-69121837 AGAACAGGAGTGGAGGCAGCTGG + Intergenic
1087746638 11:101955808-101955830 GGGTCAGGTGTGGAGACAGCTGG - Intronic
1088740427 11:112762482-112762504 GGGTCAGGTGTGGGGGCAGCAGG + Intergenic
1089461913 11:118658664-118658686 AGTTCAGGTGAGCAGGCCAGGGG - Exonic
1089466530 11:118689713-118689735 AGTTCAGGTGAGCAGGCCAGGGG - Intergenic
1090609497 11:128457566-128457588 AGTTCAGATGAGGAGCCCTCAGG - Intergenic
1090700489 11:129290683-129290705 AGTTCCAGTGTGGAGCCCGGGGG + Intergenic
1092294600 12:7188598-7188620 ATTTCAGAGGTGGAGGCCTCAGG - Intergenic
1092305106 12:7292294-7292316 AGCACAGCTGTGGAGGCCTCAGG + Intergenic
1098048639 12:66428932-66428954 GGTTAAGGTGTGGAGGCATCAGG + Intronic
1100469100 12:94874004-94874026 AGCTCAGTTCTGGGGGCCGCGGG - Intergenic
1104496746 12:129247747-129247769 AGTCCAGGTGAGGAGGTGGCTGG + Intronic
1104894151 12:132153659-132153681 AGTTCACTTGAGGAGCCCGCTGG - Intergenic
1105250881 13:18697827-18697849 ACTGCAGTTGTGGAGGCCCCAGG + Intergenic
1106437047 13:29732396-29732418 AGGTCAGGGGTGGAGGCAGAGGG + Intergenic
1110569601 13:76990202-76990224 TGTTCAGTGGTGGAGGCCTCTGG - Intergenic
1112286131 13:98106049-98106071 AGTTCCTGTGTGGTGGCCTCTGG - Intergenic
1114937430 14:27558971-27558993 AAGTCAGCTGTGGAGGCCTCTGG - Intergenic
1114975951 14:28099764-28099786 AGCACAGCTGTGGAGGCCTCAGG - Intergenic
1117253216 14:53955023-53955045 GGTCCGGGTGCGGAGGCCGCGGG + Intronic
1119668029 14:76498746-76498768 CCTTCAGGAGTGGAGGCCACTGG + Intronic
1124365449 15:29068114-29068136 AGGCCAAGTGTGGAGGCCACAGG + Intronic
1126140141 15:45430581-45430603 ATATAAGGTGGGGAGGCCGCCGG + Intronic
1126204838 15:46034078-46034100 GGTTCAGGTGTGGTGGCTCCAGG + Intergenic
1129609761 15:77043873-77043895 ATGACAGGTGTGGAGGCAGCAGG + Exonic
1132149259 15:99447840-99447862 AAAACAGGTGTGGGGGCCGCAGG - Intergenic
1132973706 16:2701304-2701326 AGTTCATGTAGGGAAGCCGCTGG + Intronic
1136008175 16:27345240-27345262 AGTTCAGGGGTGGAAACAGCTGG - Intronic
1140126733 16:72124363-72124385 AGTTCATGGCAGGAGGCCGCAGG - Intronic
1140141475 16:72262175-72262197 AGTTGAAGTATGGAGGCCACTGG - Intergenic
1141660833 16:85440696-85440718 AGTTCTGGTGCTGAGGCCCCAGG + Intergenic
1141888741 16:86911880-86911902 AGTTCCACTGTGGAGGCCGGTGG + Intergenic
1142334427 16:89478422-89478444 AGTTGTGGTGTGGAGGCGTCGGG - Intronic
1143053252 17:4143757-4143779 TGTTGAGGTGCGGAGGCCGTGGG + Exonic
1143345258 17:6244497-6244519 AGGTCAGGTGGGGAAGCTGCAGG + Intergenic
1148643815 17:49207490-49207512 AGTCGAGGTGTGGAGGGAGCTGG - Intronic
1150132988 17:62679457-62679479 AGTTCAGATGAGGAGGTGGCAGG - Intronic
1150510357 17:65745918-65745940 AATTCAGGTTTTGAGGCGGCCGG + Intronic
1151136778 17:71954191-71954213 AGCACAGCTGTGGAGGCCTCAGG + Intergenic
1152475215 17:80513491-80513513 AGTGCAGGTTGGGAGGGCGCAGG - Intergenic
1152528515 17:80903253-80903275 TGTTCAGGTGTGGAGAGCACAGG - Intronic
1152759511 17:82100663-82100685 AGTGCAGGGGTGGAGGCAGCCGG - Intergenic
1155293120 18:24360890-24360912 AGTTCAGGTGTGAGGGTGGCTGG - Intronic
1157252216 18:46104749-46104771 AGTTCAGATGTGGAAGCCGCCGG - Intronic
1159543319 18:69808825-69808847 AGTTCAGTTGTGAAGGCATCAGG - Intronic
1160619450 18:80160502-80160524 TGTCCAGGTGTGCACGCCGCCGG + Exonic
1162300997 19:9844946-9844968 AGTGCAGGAATGGAGGCTGCTGG - Intronic
1163175964 19:15564225-15564247 AGTTCCGTTTTGGAGGCTGCTGG - Intergenic
1163571876 19:18087104-18087126 AGTTCAGGTCTGGGGCCAGCAGG - Intronic
1164475065 19:28569329-28569351 AGCTCAGGTGTGGATGGTGCAGG - Intergenic
1165906096 19:39195992-39196014 AGGTCAGGTGTGGAGGAAGTGGG - Intergenic
1167920951 19:52782728-52782750 AGGACAGGTGTGGTGGCGGCTGG + Intronic
925661076 2:6203388-6203410 GTATCAGGTGTGGAGACCGCAGG - Intergenic
926125215 2:10267749-10267771 AGATAAGCTGTGCAGGCCGCTGG - Intergenic
926143227 2:10381005-10381027 AGTTCAAGTGTGGGAACCGCTGG + Intronic
928075621 2:28261803-28261825 AGGTCAGGTCTGGAGGCCACTGG - Intronic
928290249 2:30030363-30030385 AATTCAGGTGAGGAGACAGCGGG + Intergenic
928652954 2:33421441-33421463 ACTTCAGGGGTGGAGGCCAGTGG + Intergenic
931515477 2:63048518-63048540 AGGTCAGGTGCTGAGGCTGCAGG + Intergenic
934561503 2:95315848-95315870 AGGGCAGGTCTGGAGGGCGCAGG - Intronic
934652719 2:96101649-96101671 AGGGCAGCTGTGGATGCCGCAGG - Intergenic
936086377 2:109472313-109472335 AGTGCAGGTGAGGAGGGCCCGGG - Intronic
937010544 2:118559037-118559059 AGTTCCTGAGTGGAGGCCACAGG + Intergenic
937119790 2:119433197-119433219 AGCTCAGCTGGGGAGGCCACAGG + Intronic
937216945 2:120318830-120318852 AGGCAAGGTGGGGAGGCCGCAGG + Intergenic
937358304 2:121212118-121212140 GGTACAGGTGTGGATGCCACTGG - Intergenic
938277426 2:130038427-130038449 CGTGCAGGTGGGGAGGCCTCTGG - Intergenic
938328397 2:130429230-130429252 TGTGCAGGTGGGGAGGCCTCTGG - Intergenic
938361550 2:130692264-130692286 TGTGCAGGTGGGGAGGCCTCTGG + Intergenic
938437959 2:131298953-131298975 TGTGCAGGTGGGGAGGCCTCTGG + Intronic
942165685 2:173238488-173238510 AATTTAGGTGTGGATGCAGCAGG - Intronic
943342172 2:186694252-186694274 AGTTCCGCTCTGGCGGCCGCGGG - Exonic
946202040 2:218076172-218076194 AGTTCCTGGGTGGAGGCCGAAGG - Intronic
946362929 2:219229778-219229800 GGCTCAGGTGCGGACGCCGCCGG + Exonic
1169049206 20:2562004-2562026 AGCTCAGGTGAGCAGGCTGCGGG + Exonic
1169112628 20:3043752-3043774 GGTTCAGGGGTGGAGGCACCTGG - Intronic
1172767804 20:37360024-37360046 AGAACAGGTGTGGAGGAGGCAGG - Intronic
1174192233 20:48748771-48748793 GGGTCACGTGGGGAGGCCGCAGG + Intronic
1174875529 20:54223085-54223107 GGCTCAGGTGTGGGGGCCTCGGG - Intronic
1175561996 20:59938990-59939012 AGCTTAGGTGTGGAGGCTCCAGG + Exonic
1175916768 20:62429628-62429650 AGTTCAGGGTAGGAGGCTGCTGG - Intergenic
1176117267 20:63438549-63438571 TGTTGAGGAGTGGAGGCCGCTGG - Intronic
1176162504 20:63654908-63654930 AGTTCTTGTGTGGAGGCCCTGGG - Intergenic
1176419129 21:6499894-6499916 AGTTCATGGGTGAAGGCAGCGGG + Intergenic
1179694622 21:43108216-43108238 AGTTCATGGGTGAAGGCAGCGGG + Intergenic
1180049540 21:45324994-45325016 GGTGCAGGTGAGGAGGCCTCAGG - Intergenic
1180176497 21:46093013-46093035 TGTTGAGGTGTGGTGTCCGCAGG + Intergenic
1180203880 21:46244891-46244913 AGTGCAGGTGAGGAAGCAGCCGG + Exonic
1180789206 22:18565273-18565295 ACCCCAGGTGTGGAGGCCCCAGG - Intergenic
1180802536 22:18638529-18638551 TGTTCAGGTGTGGGGGAAGCAGG - Intergenic
1180843817 22:18970942-18970964 AGGTCCGGGGTGGGGGCCGCGGG + Intergenic
1180853772 22:19034085-19034107 TGTTCAGGTGTGGGGGAAGCAGG - Intergenic
1181219187 22:21356732-21356754 TGTTCAGGTGTGGGGGAAGCAGG + Intergenic
1181232535 22:21430038-21430060 ACCCCAGGTGTGGAGGCCCCAGG + Intronic
1181246116 22:21504819-21504841 ACCCCAGGTGTGGAGGCCCCAGG - Intergenic
1182529037 22:30941233-30941255 AGATCAGCTGTGGAGGTGGCTGG - Intronic
1183579610 22:38716081-38716103 AGGTCAGGTGAGGAGGCCGCGGG + Exonic
1183950411 22:41349432-41349454 AGTTCAGGAGAGGTGGCTGCGGG + Intronic
1184227167 22:43135689-43135711 AGGTCAGGTATGGTGGCCCCAGG - Intronic
1184422019 22:44387575-44387597 GGTTCTGGTGTGGACGCCGTCGG - Intergenic
1185377904 22:50490679-50490701 GGTTCAGGGGTGGTGGCCGCAGG - Intergenic
949826629 3:8172448-8172470 AGTTCAAGTGTTGTGGCGGCTGG - Intergenic
950268347 3:11592479-11592501 AGTAAAGGGGTGGAGGCCCCGGG - Intronic
950654635 3:14428963-14428985 AGTTCAGCTGAGCAGGCCCCAGG - Intronic
953707794 3:45244355-45244377 ATTTAAGGTGTGGGGGCCACAGG + Intergenic
954299334 3:49691071-49691093 AGGTCAGGTGTGGGGGCCCCTGG + Intronic
954628774 3:52037102-52037124 GGTTCAGGGGTGGAGACTGCTGG + Intergenic
955738014 3:62059932-62059954 AGTACAGCTGGGGAGGCCTCAGG - Intronic
965510519 3:169563672-169563694 AGTTCCGGTGTGAAGGGTGCTGG + Intronic
967112228 3:186304126-186304148 ACTGCAGGTGTGGAGGCCACAGG - Intronic
967853758 3:194101106-194101128 AGGACAGGTGTGGTGGCCACAGG + Intergenic
968812610 4:2806732-2806754 CTTCCAGGTGTGGAGGCCCCCGG + Intronic
974110149 4:57515561-57515583 TCTTCAGGTGTGAAGGCTGCTGG - Intergenic
976196311 4:82535506-82535528 AATTCAGGTGGGGAAGCCACAGG + Intronic
980541367 4:134201105-134201127 GGTTCAAGTGTGGAGGCCTCGGG + Exonic
984548642 4:181134903-181134925 ATTTCAGGTCTGGAGGCTGGAGG + Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985602878 5:844018-844040 AGGGCAGGTGTGGGGGGCGCAGG + Intronic
989570738 5:42943993-42944015 AGCTCAGGGCTGGAGGCGGCTGG - Intergenic
990210545 5:53478918-53478940 GGTGCAGGTGCGGCGGCCGCGGG + Intergenic
991487885 5:67156744-67156766 AGTGAAGGGGTTGAGGCCGCAGG + Intronic
999325760 5:150642405-150642427 AGTTTAGGTGGGGAGGCGGTGGG + Intronic
1005709019 6:28485638-28485660 AGTTCCTGGGTGGAGGCCACAGG + Intergenic
1005778128 6:29160047-29160069 CGTTAGGGTGTGGAGGGCGCGGG + Intergenic
1005778733 6:29165832-29165854 CGTTAGGGTGTGGAGGGCGCGGG - Intergenic
1006100019 6:31680832-31680854 GGGTCAAGAGTGGAGGCCGCCGG + Intronic
1006408361 6:33857902-33857924 GATTCAGGTGTGGAGGGGGCTGG - Intergenic
1007095086 6:39208038-39208060 AGAGCAGGTGAGGAGGCCCCTGG - Intronic
1007274391 6:40662770-40662792 AGCCCAGGTGGGGAGGCCCCAGG - Intergenic
1009030027 6:58045577-58045599 AGTTCAGGGATGGAGGGTGCTGG + Intergenic
1009205557 6:60796808-60796830 AGTTCAGGGATGGAGGGTGCGGG + Intergenic
1011260160 6:85462080-85462102 AGTGCAGGAGTGGAAGCCACAGG - Intronic
1011338689 6:86287946-86287968 AGTTCCTGGGTGGAGGCCACAGG - Intergenic
1013893941 6:115062355-115062377 AGTTCAGCTGTGAAGGCTTCTGG + Intergenic
1014429351 6:121348944-121348966 TGTTCAAGTGTGGAGACTGCAGG + Intergenic
1015669180 6:135668261-135668283 AGTTCAAGTGTGGAGTCAGAGGG - Intergenic
1018848517 6:167571699-167571721 AGCTCTGGTGTGGAGGCCCGGGG - Intergenic
1019437639 7:1030296-1030318 GGCTCAGGTGTGGAGGCGGGTGG - Intronic
1020120469 7:5500472-5500494 ACCTCAGGTGAGGGGGCCGCGGG - Exonic
1022395149 7:29981596-29981618 AGTTCAAGTTGGGAGGCCCCAGG + Intronic
1022645309 7:32223997-32224019 AGTTCATCTGAGAAGGCCGCAGG - Intronic
1024531769 7:50399772-50399794 TGTGCAGGTGTGGGGTCCGCAGG + Intronic
1029681120 7:102111517-102111539 AGTTGGGGTGTGGAAGCTGCGGG + Intronic
1032074049 7:128827900-128827922 TGTTCAGGTGGAGAGGCCGGAGG - Intergenic
1033166325 7:139041527-139041549 AGTTCAGGTGCAGAGTCTGCAGG - Intergenic
1033422279 7:141214397-141214419 AGTTCAGGGGTGGAGGAGGGTGG + Intronic
1035898088 8:3426906-3426928 AGTTCAGCTGGGGAGGCCTCAGG + Intronic
1040588303 8:48765045-48765067 AGGGAAGGTGTGGAGGCCACAGG - Intergenic
1041680319 8:60582596-60582618 AGCCCAGGTGAGGAGGCTGCAGG - Intronic
1044178487 8:89159452-89159474 AGTTCATGGGTGGTGGCAGCTGG - Intergenic
1045272178 8:100671200-100671222 TGTGCAGTTGTGGAGGCTGCAGG + Intergenic
1049003016 8:139838062-139838084 AGTCCTGGTGTGGAGGCCTGTGG - Intronic
1053270449 9:36745975-36745997 AGTGCTGGTAAGGAGGCCGCGGG + Intergenic
1059102669 9:111484512-111484534 AGTTCTGGTGTGGAGGTGGCTGG + Exonic
1059464629 9:114460073-114460095 AACTCAGGTGTGGAGGCCGTGGG + Intronic
1060534752 9:124375924-124375946 GGCTCAGGTGTGGAAGCTGCTGG - Intronic
1060985090 9:127815227-127815249 AGTTCAGGTGTGGAGGCCGCAGG + Exonic
1061211411 9:129195531-129195553 AGTTCAGGTCTGGAGACTCCGGG + Intergenic
1061290928 9:129649874-129649896 AGCTCTGGGGTGGGGGCCGCTGG + Intergenic
1061805147 9:133133586-133133608 AGTTGCGGTGGGGAGGCTGCAGG - Intronic
1062578076 9:137217787-137217809 AGTTCAGGGGTGGTGGCCCTGGG - Intergenic
1187359262 X:18609652-18609674 AGTGTAGGTGAGAAGGCCGCTGG - Intronic
1190245123 X:48685830-48685852 AGTGGAGGTGAGGAGGCCACAGG + Exonic
1200225091 X:154412738-154412760 TGTTCAGGAGTGGAAGCCCCAGG - Intronic