ID: 1060988600

View in Genome Browser
Species Human (GRCh38)
Location 9:127835642-127835664
Sequence CAGTAGGACTGGATGGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060988600 Original CRISPR CAGTAGGACTGGATGGCCAT GGG (reversed) Intronic
906518260 1:46452281-46452303 CTGTGGGCCTGGGTGGCCATGGG + Intergenic
913278468 1:117162407-117162429 CAGTAGGCCTGGAGAGTCATAGG - Intronic
915847892 1:159287410-159287432 CAAGAGGACTGGCAGGCCATCGG + Intergenic
917308843 1:173656111-173656133 CATTGGGACTGGTTGGACATTGG - Intronic
917464382 1:175262261-175262283 CACTAGGACTGGTTGGACAGTGG - Intergenic
918159255 1:181882337-181882359 CATTGGGACTGGATGGACAGTGG + Intergenic
921447200 1:215260788-215260810 CATTAGGACTGGTTGGACAGTGG - Intergenic
923550473 1:234959198-234959220 CAGAAGGACTGGCTGCCCAACGG + Intergenic
923839466 1:237652477-237652499 CACTAGTACTGGGTAGCCATTGG - Intronic
1066140874 10:32502389-32502411 CAATAGGACTGGTTGGACAGTGG - Intronic
1066205585 10:33186281-33186303 CAGCTGGTCTGGATGGCCATTGG - Exonic
1067772999 10:49140513-49140535 CAGTGAGACTGGCTGGACATTGG + Intergenic
1071066774 10:81644974-81644996 CATTAGGACTGGTTGGACAGTGG - Intergenic
1074017090 10:109545448-109545470 CATTAGGACTGGTTGGACAGTGG + Intergenic
1075699105 10:124457112-124457134 CAGGAGGTCTGGGTGGCCCTAGG - Intergenic
1075923808 10:126235012-126235034 GACTAGGACTGGATGGACATGGG + Intronic
1076321052 10:129581790-129581812 CAGGAGGACGGGACGGCCACTGG - Intronic
1077229214 11:1451108-1451130 CAGCAGCACTGGCTGGCCCTTGG - Intronic
1085253545 11:75159430-75159452 CAGGAGGATGGGACGGCCATGGG - Intronic
1091238048 11:134034665-134034687 CAGGAGGGCTGGCTGGCCTTGGG - Intergenic
1091760705 12:3085344-3085366 CAGGAGGCCTGTATGGCCTTGGG + Intronic
1091831636 12:3554447-3554469 CAGTAGGACAGGATGCCTACAGG - Intronic
1091855709 12:3737665-3737687 CAAGAGGACTGGGTGGCCAATGG + Intronic
1094037900 12:26090238-26090260 CAGTAGGACAGGCTGACGATTGG - Intergenic
1094759923 12:33520852-33520874 CACTAGGACTGGTTGGACAGTGG + Intergenic
1096078785 12:48820281-48820303 CTGTGGGGCTGGATGGCCCTAGG + Intronic
1096196075 12:49649602-49649624 CAGAAGGACTGGAAGGGCAGGGG + Intronic
1099658218 12:85522319-85522341 CATAAGGATTGGATGGTCATAGG + Intergenic
1099740324 12:86626855-86626877 CATTAGGACTGGTTGGACAGTGG + Intronic
1102599590 12:114019445-114019467 CAGTGGGACTGGGCTGCCATAGG - Intergenic
1104084671 12:125463331-125463353 CAATAGGGATGGATGGCAATGGG + Intronic
1108792404 13:53987264-53987286 CAGTAGGACAGGATGATAATGGG - Intergenic
1109358533 13:61266776-61266798 CACTGGGACTGGATGGACAGTGG + Intergenic
1114539928 14:23447511-23447533 CAGTAGGCCTGGAAGGACCTGGG - Intergenic
1115118844 14:29915510-29915532 CATTAGAACTGGACGGTCATTGG - Intronic
1116482740 14:45411517-45411539 CACTGGGACTGGTTGGACATTGG + Intergenic
1119652377 14:76392883-76392905 CAGTAGCCCTGGGTGGCCACTGG + Intronic
1120894106 14:89514378-89514400 AAGGAGGTGTGGATGGCCATCGG - Intronic
1125391575 15:39198376-39198398 CAGAAGGACTGGAAGTCCATGGG + Intergenic
1127563590 15:60164866-60164888 CTGTAGGACTGAATGGCTTTGGG - Intergenic
1128905104 15:71460467-71460489 CAGTAGGGCTGGATGGCATGTGG + Intronic
1133171198 16:3983462-3983484 CAGAATGACTGGGAGGCCATGGG + Intronic
1138173955 16:54878934-54878956 CAGTAGGACTGAATTGTAATGGG + Intergenic
1138699682 16:58849162-58849184 CAGTAGGACACCATGGACATTGG + Intergenic
1139901247 16:70330130-70330152 CAGGAGGACTGGATGCCCCTGGG + Intronic
1140491117 16:75336733-75336755 TAGTAGCACAGGATTGCCATTGG - Intronic
1140949299 16:79800796-79800818 CAGGAGAACTTGATGCCCATGGG + Intergenic
1141333974 16:83137816-83137838 AAGTAGAACTGGATGGAGATGGG + Intronic
1141749712 16:85950154-85950176 AAGTAGGACTGGCTGGTCAGAGG + Intergenic
1142187300 16:88700725-88700747 CACCAGGACAGGATGGACATGGG + Intronic
1142268224 16:89075179-89075201 CAGCAGCACTGCAGGGCCATGGG - Intergenic
1144756143 17:17681717-17681739 CCGGAGGCCTGGGTGGCCATGGG - Exonic
1145011301 17:19369859-19369881 CAGGAGGAGGGAATGGCCATGGG - Intronic
1145378942 17:22376587-22376609 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145379899 17:22381327-22381349 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145380379 17:22383702-22383724 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145380858 17:22386049-22386071 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145381337 17:22388424-22388446 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145382545 17:22394563-22394585 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145382825 17:22395926-22395948 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145383398 17:22398749-22398771 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145383912 17:22401217-22401239 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145384350 17:22403419-22403441 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145384669 17:22404881-22404903 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1145385450 17:22408954-22408976 CAGCAGGCCTTGAGGGCCATGGG + Intergenic
1146975704 17:37109767-37109789 CAGAAGGACTGGATGGTGAGGGG - Intronic
1149639445 17:58193405-58193427 AAGTAGGACAGGAGGTCCATGGG - Exonic
1151964867 17:77426005-77426027 CAGTGGGTCAGGATGGCCAGAGG + Intronic
1156443903 18:37219835-37219857 CATTGGGACTGGATGGACAGTGG - Intronic
1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG + Intronic
1163699557 19:18780564-18780586 CAGGAGGGATGGATGGACATGGG - Exonic
1164090935 19:21951784-21951806 CACTGGGACTGGATGGACAGTGG + Intronic
925344324 2:3159884-3159906 CGGTAGGACTGGCTGGGCCTGGG + Intergenic
931594453 2:63926622-63926644 CATTGGGACTGGATGGACAGTGG + Intronic
932959965 2:76402111-76402133 CAGCAGCACTGGATTCCCATAGG + Intergenic
935565902 2:104607448-104607470 CATTAGGACTGGTTGGACAGTGG + Intergenic
939044311 2:137231912-137231934 CAGCAGGACAGCATGGCCACTGG + Intronic
939193427 2:138942986-138943008 CATTAGGACTGGTTGGACAGTGG - Intergenic
941365278 2:164603269-164603291 TAGTATGAATGGATGGTCATTGG + Intronic
942434587 2:175957694-175957716 CACTGGGACTGGTTGGCCAGTGG + Intronic
942475196 2:176311908-176311930 CACTGGGACTGGATGGGCAGTGG - Intronic
946310669 2:218880930-218880952 CAGTGGGACTGGAGAGCCAGGGG - Exonic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
1168964033 20:1888113-1888135 GAGAAGGAGTGGAAGGCCATTGG + Intergenic
1170702737 20:18718291-18718313 CACTAGGACTGTGTGACCATAGG + Intronic
1172360995 20:34312390-34312412 CAGTGGGGCTGGATGGCCTCTGG + Intergenic
1173324648 20:42021588-42021610 CAGGAGGACTGGCTGTCCAAGGG - Intergenic
1174339258 20:49885920-49885942 CAGTAGGTCTGAATGGGCTTGGG - Intronic
1175573176 20:60039483-60039505 TAGAAGGTCTGGATGGCCAAGGG + Intergenic
1181065511 22:20303941-20303963 CAGCAGGACTTGATGGCCTCAGG + Intergenic
1183709156 22:39492310-39492332 CCCAAGGACTGGATGGCCAGTGG + Intergenic
1184512207 22:44940386-44940408 CAGGAGGACTGCATGGACAAGGG - Intronic
951012110 3:17693219-17693241 CATTGGGACTGGTTGGACATTGG + Intronic
954648660 3:52146345-52146367 CAGCAGGACTACAGGGCCATTGG + Intronic
961325602 3:126107516-126107538 CACTAGGATTGGATGGACTTGGG - Intronic
961597523 3:128030363-128030385 CAGTAGGACTGGTAGGTCATAGG + Intergenic
967478472 3:189947466-189947488 CAGTAGGATTGGATACCCCTGGG + Intergenic
967920227 3:194609022-194609044 CAAAAGGAATGGATGGGCATGGG + Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
973394168 4:49579248-49579270 CAGCAGGATGGGATGGGCATGGG + Intergenic
975844074 4:78506757-78506779 CACTGGGACTGGTTGGACATTGG - Intronic
977194681 4:94044606-94044628 CACTGGGACTGGATGGACAGTGG + Intergenic
979272919 4:118783111-118783133 CATTAGGACTGGTTGGACAGTGG - Intronic
980666892 4:135951976-135951998 CAGGAGGACTGCTTGGGCATAGG + Intergenic
981859940 4:149341864-149341886 CATTGGGACTGGATGGACAGTGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
988321053 5:29697420-29697442 CATTAGTTCTGGATGGCCAGTGG + Intergenic
989449520 5:41570305-41570327 CAGTGGGACTCCATGGGCATAGG + Intergenic
990231282 5:53715818-53715840 CAGTGGGACTGGATAGGCAGTGG + Intergenic
990713056 5:58606035-58606057 CATTAGGACTGGTTGGACAGTGG + Intronic
992085006 5:73270421-73270443 CAGTGGGAGTGGATGGGGATGGG - Intergenic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
994014955 5:94955074-94955096 CAGTGGGACTGGTTGGACAGTGG + Intronic
995350070 5:111164741-111164763 AAGTAGGCCTGGCAGGCCATGGG - Intergenic
995418697 5:111938077-111938099 TAGAAGGACTGGATGGACACAGG - Intronic
997981188 5:138468139-138468161 CAGGAGGAGGAGATGGCCATAGG + Exonic
999053897 5:148553236-148553258 AAGGAGGACTGGATGGCCTGTGG + Intronic
1000059216 5:157638301-157638323 CAGTGTGGCTGGATGGCCAAGGG + Exonic
1000332241 5:160214995-160215017 AAGTTCCACTGGATGGCCATGGG - Intronic
1003731511 6:8829804-8829826 CTGTAGGACTGGATGGACAAAGG + Intergenic
1004540618 6:16546358-16546380 CAGTTGGACATGATGGCCCTGGG - Intronic
1005469000 6:26143402-26143424 CAGTAGGATTGAATGAACATTGG + Intergenic
1006225885 6:32535658-32535680 GGGGAGGAATGGATGGCCATGGG - Intergenic
1007625790 6:43245785-43245807 CAGCAGGTCTGGGTGGGCATGGG - Intronic
1009738939 6:67719137-67719159 GAATAGAACTGCATGGCCATAGG + Intergenic
1009930206 6:70168194-70168216 CAGGAGGACCGGGTGGCCCTGGG - Exonic
1010656557 6:78518343-78518365 CAGTAGGATTGGGAGGCCTTTGG + Intergenic
1013436596 6:110116167-110116189 CATTAGGACTGGTTGGACAGTGG + Intronic
1013860898 6:114633988-114634010 CAGTGGGACTGGTTGGACAGTGG - Intergenic
1013964110 6:115935157-115935179 CAGTGGGACTGGTTGGACAGTGG + Exonic
1016139108 6:140586134-140586156 CTGCAGCACTGCATGGCCATGGG + Intergenic
1017677547 6:156829330-156829352 CTGTGGGCCTGGAGGGCCATAGG - Exonic
1022522168 7:31015372-31015394 CAGGAGCACAGGATGGCCAAGGG + Intergenic
1023558603 7:41449172-41449194 CAGGAGGAGTGGATGGGAATAGG + Intergenic
1024976159 7:55115792-55115814 TAGTTGGACTGGATGTCCCTGGG + Intronic
1030202428 7:106918914-106918936 CATTAGGACTGGTTGGACAGTGG + Intergenic
1032518312 7:132523358-132523380 CAGGGGGACTGAATGGCCAGGGG + Intronic
1034590341 7:152133005-152133027 CAATAGGGCAGGATGGCCCTAGG + Intergenic
1034951451 7:155299070-155299092 CAGCGGGACTGAAAGGCCATTGG + Intronic
1036767117 8:11556217-11556239 GAGTGGGACAGGATCGCCATGGG + Intronic
1039154036 8:34535510-34535532 CAGTGGGACTGGTTGGACAGTGG + Intergenic
1047931505 8:129732796-129732818 CAATAGGACTGGTTGGACAGTGG + Intergenic
1048149850 8:131883762-131883784 CAATAGGACTGGTTGGACAGTGG - Intergenic
1054997306 9:71407214-71407236 CATTAGGACTGGTTGGACAGTGG + Intronic
1055353854 9:75417558-75417580 CACTAGGACTGGATGACTGTGGG + Intergenic
1055642873 9:78334447-78334469 CATTGGGACTGGTTGGACATGGG + Intergenic
1057893190 9:98885002-98885024 CAGAGGGACTGGAAGGCCAGAGG - Intergenic
1058614267 9:106809293-106809315 CATTAGGACTGGTTGGACAGTGG + Intergenic
1060988600 9:127835642-127835664 CAGTAGGACTGGATGGCCATGGG - Intronic
1061168488 9:128938392-128938414 CAGTAGGGCTGCATGGGCCTGGG + Intronic
1186163865 X:6806070-6806092 CAGTGGGAATGGATGGAGATAGG + Intergenic
1188062903 X:25622610-25622632 CAGGAGGAAAGGATGGCCAATGG - Intergenic
1192612868 X:72585557-72585579 CATTAGGACTGGTTGGACAGTGG + Intronic
1193122068 X:77834058-77834080 CAGGAGAACTGGATATCCATAGG + Intronic
1201394848 Y:13537142-13537164 CACTAGGACTGGTTGGACAGTGG - Intergenic