ID: 1060994838

View in Genome Browser
Species Human (GRCh38)
Location 9:127870052-127870074
Sequence TCCCTCCTTCGGTGAAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060994832_1060994838 1 Left 1060994832 9:127870028-127870050 CCGGCCACACTTCCAGGCTGACC 0: 1
1: 0
2: 4
3: 32
4: 295
Right 1060994838 9:127870052-127870074 TCCCTCCTTCGGTGAAGCCCTGG No data
1060994829_1060994838 23 Left 1060994829 9:127870006-127870028 CCAGAAAAGCTTTGGGTGTGAGC 0: 1
1: 0
2: 1
3: 11
4: 104
Right 1060994838 9:127870052-127870074 TCCCTCCTTCGGTGAAGCCCTGG No data
1060994833_1060994838 -3 Left 1060994833 9:127870032-127870054 CCACACTTCCAGGCTGACCCTCC 0: 1
1: 1
2: 8
3: 30
4: 388
Right 1060994838 9:127870052-127870074 TCCCTCCTTCGGTGAAGCCCTGG No data
1060994827_1060994838 30 Left 1060994827 9:127869999-127870021 CCAGTCTCCAGAAAAGCTTTGGG 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1060994838 9:127870052-127870074 TCCCTCCTTCGGTGAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060994838 Original CRISPR TCCCTCCTTCGGTGAAGCCC TGG Intronic
No off target data available for this crispr