ID: 1061007483

View in Genome Browser
Species Human (GRCh38)
Location 9:127936391-127936413
Sequence GCTGCCAGTCAGTAACCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061007483_1061007490 16 Left 1061007483 9:127936391-127936413 CCCAGAGGTTACTGACTGGCAGC 0: 1
1: 0
2: 0
3: 12
4: 121
Right 1061007490 9:127936430-127936452 GAAAACCCCACGGGTGAGTTCGG 0: 1
1: 0
2: 0
3: 4
4: 78
1061007483_1061007491 17 Left 1061007483 9:127936391-127936413 CCCAGAGGTTACTGACTGGCAGC 0: 1
1: 0
2: 0
3: 12
4: 121
Right 1061007491 9:127936431-127936453 AAAACCCCACGGGTGAGTTCGGG 0: 1
1: 0
2: 0
3: 5
4: 71
1061007483_1061007489 7 Left 1061007483 9:127936391-127936413 CCCAGAGGTTACTGACTGGCAGC 0: 1
1: 0
2: 0
3: 12
4: 121
Right 1061007489 9:127936421-127936443 GATGAACAGGAAAACCCCACGGG 0: 1
1: 0
2: 4
3: 14
4: 175
1061007483_1061007492 18 Left 1061007483 9:127936391-127936413 CCCAGAGGTTACTGACTGGCAGC 0: 1
1: 0
2: 0
3: 12
4: 121
Right 1061007492 9:127936432-127936454 AAACCCCACGGGTGAGTTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 70
1061007483_1061007488 6 Left 1061007483 9:127936391-127936413 CCCAGAGGTTACTGACTGGCAGC 0: 1
1: 0
2: 0
3: 12
4: 121
Right 1061007488 9:127936420-127936442 GGATGAACAGGAAAACCCCACGG 0: 1
1: 0
2: 1
3: 28
4: 225
1061007483_1061007486 -6 Left 1061007483 9:127936391-127936413 CCCAGAGGTTACTGACTGGCAGC 0: 1
1: 0
2: 0
3: 12
4: 121
Right 1061007486 9:127936408-127936430 GGCAGCCTCGAAGGATGAACAGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061007483 Original CRISPR GCTGCCAGTCAGTAACCTCT GGG (reversed) Intronic
902691732 1:18114082-18114104 GTTGCCAGTCAGTGCACTCTTGG + Intronic
904732544 1:32605984-32606006 GCCACCAGCCAGAAACCTCTTGG + Intronic
904868611 1:33602285-33602307 GTTACCAGTCAGTTACCTATTGG - Intronic
906150015 1:43582277-43582299 GCTACTAGTCAGTAGCCTCTCGG + Intronic
907687550 1:56627479-56627501 GGAGCCAGACAGTAACCTATAGG - Intronic
908755007 1:67461420-67461442 GCTGCGAGTCAGTCTCCTCTTGG + Intergenic
909170712 1:72290594-72290616 GCAGCCTTTCAGTCACCTCTAGG + Intergenic
910200653 1:84695141-84695163 GTAGCCACTCAGTAACATCTGGG - Intergenic
914222294 1:145691928-145691950 GCTGGCAGACAGGAACCGCTCGG + Intronic
915428379 1:155846070-155846092 GCTGCCAGTCATTAGCCTATAGG + Intronic
916263074 1:162861879-162861901 CCTGCCTCTCAGTAAACTCTGGG - Intronic
919929280 1:202210617-202210639 GCTGCCAGCCAGTCAGCTCGTGG + Intronic
922798835 1:228354723-228354745 GCTGACAGCCAGGCACCTCTGGG - Intronic
1065778282 10:29142881-29142903 TCTGCCAGTCAATGACCTCCCGG - Intergenic
1065938010 10:30538451-30538473 GCTGGGAGTCAGTAACAGCTGGG - Intergenic
1067497458 10:46773559-46773581 CCTGCCAGTCAGGTAGCTCTGGG + Intergenic
1067597194 10:47566856-47566878 CCTGCCAGTCAGGTAGCTCTGGG - Intergenic
1069922415 10:71824274-71824296 GCTGCTGGTCACTAACCTGTGGG - Intronic
1075576599 10:123582293-123582315 GCTGCCAGCCAATGACCACTCGG + Intergenic
1084518351 11:69648319-69648341 CCAGCCAGTCAGTAAGTTCTAGG - Intronic
1089492009 11:118889734-118889756 GCTGCCAGACAAATACCTCTTGG + Intronic
1089570375 11:119404070-119404092 GCTGCAAGACAGTAGCATCTGGG + Intergenic
1091139137 11:133220449-133220471 GCTGCCAGACAGCAGCCTCTGGG + Intronic
1093877157 12:24362376-24362398 TGTGCAAGACAGTAACCTCTAGG + Intergenic
1094161234 12:27393168-27393190 GCTTCTACTCAGAAACCTCTTGG + Intronic
1096404677 12:51334910-51334932 ACAGCCAGTCAGCAACATCTTGG + Intronic
1099459430 12:82904385-82904407 GCTGCCAGTCATTAACTGATTGG + Intronic
1104934692 12:132358183-132358205 GAGGCCAGTCAGTGCCCTCTGGG - Intergenic
1107800415 13:44102556-44102578 ACTGCCTGGCATTAACCTCTAGG - Intergenic
1108797657 13:54051306-54051328 GCTGCCAGCCAGCAACCTATGGG - Intergenic
1108916423 13:55618402-55618424 CCTTCAAGTCAGGAACCTCTGGG - Intergenic
1109285098 13:60399202-60399224 CCTGCCAGTCAGAATTCTCTGGG + Intronic
1111243154 13:85501985-85502007 TCTCCCAGTCAGTCAGCTCTTGG + Intergenic
1115652808 14:35415301-35415323 GTTGCCTGAGAGTAACCTCTGGG + Intergenic
1125349463 15:38752274-38752296 CCTGCCCGCCAGTAACCTGTGGG - Intergenic
1125968257 15:43891537-43891559 GCTCACAGACAGTGACCTCTGGG - Intronic
1126047228 15:44653462-44653484 GTAGCCAGTCATTAACATCTGGG - Intronic
1127560151 15:60128118-60128140 GCTGCCAGTGAGCCAACTCTTGG - Intergenic
1127932974 15:63609617-63609639 GCTTCCAGTCTGCACCCTCTTGG - Intronic
1128508789 15:68300774-68300796 GTTGCAATTCAGTGACCTCTGGG + Intronic
1131963765 15:97815951-97815973 GCATCCAGTCTGTAAACTCTGGG + Intergenic
1132760738 16:1507447-1507469 GCTGCCTGTCAGCCACCTCGAGG - Intronic
1138157048 16:54715472-54715494 GCTGCTAGTCTGAAACATCTAGG - Intergenic
1138360156 16:56421744-56421766 GCTTCCATTCAGCTACCTCTTGG - Intronic
1142708175 17:1709566-1709588 TCTGCCAGGAAGTAACCTGTGGG + Exonic
1146922266 17:36721598-36721620 ACTGCCTGTCAGCAGCCTCTGGG - Intergenic
1146943879 17:36861368-36861390 GGTGCCAGTCACTAACATGTAGG + Intergenic
1150641842 17:66954539-66954561 GCTGCCCATCAGCAACCACTGGG + Intergenic
1151324241 17:73369090-73369112 TCTGCCAGACAGTAAACTCCAGG + Intronic
1151368396 17:73631570-73631592 GCTGCCAGCCAGGAACCCCGGGG + Intronic
1152512223 17:80798188-80798210 GCTTCCAGAAGGTAACCTCTGGG - Intronic
1156389304 18:36635664-36635686 GGGGCCAGTCAGTAAGCTCCTGG + Intronic
1157411280 18:47465385-47465407 GCAGCCATTGGGTAACCTCTGGG + Intergenic
1165815913 19:38642179-38642201 GCTGCCAGGAAGTAGCCTCAAGG + Intergenic
1166305230 19:41933747-41933769 GTAGCCAGTTAGTAACATCTGGG - Intergenic
1166609269 19:44175134-44175156 ACTGCCGGGCAGTAACTTCTGGG + Intronic
925224559 2:2172170-2172192 GCTGCCAGGCAGCAGCCACTAGG + Intronic
926579173 2:14615926-14615948 GCTGCGAATCAGAAAGCTCTGGG - Intergenic
927290072 2:21396492-21396514 GCTGCCAGGAACTAACCTCCTGG + Intergenic
928709403 2:33987500-33987522 GCTGCCACACAGTCACCACTGGG - Intergenic
930260529 2:49140972-49140994 GCTGAGAGTCAGTTACTTCTGGG + Intronic
932468131 2:71936531-71936553 GCTCCCAGGCAGGAACCTCTGGG + Intergenic
932673762 2:73760172-73760194 ACTTCCGGTCAGTACCCTCTTGG + Intergenic
937908592 2:127064617-127064639 GCAGCCACTCAGGCACCTCTAGG + Intronic
942111327 2:172685238-172685260 GAGGCCAGTCAGGAACCTATTGG - Intergenic
944674384 2:202023100-202023122 GCTGCCTATCAGAAGCCTCTGGG - Intergenic
1170102926 20:12722087-12722109 GCTGGTTGTCAGTAACCGCTGGG - Intergenic
1173302488 20:41816572-41816594 GCTGACAGTCAGTGGCTTCTCGG - Intergenic
1176927563 21:14768592-14768614 ACTGCCAATCAGTAAACCCTGGG - Intergenic
1178297798 21:31425401-31425423 GCTGCCATCCATTTACCTCTTGG - Intronic
1179093987 21:38295075-38295097 GCTGCCAGTGAGTATTCTCAGGG - Intronic
1180196248 21:46196057-46196079 GCTGCCAGCCCGTGACTTCTGGG - Intronic
1181324704 22:22036020-22036042 CCTGCCAGTAAGTAAGCTCCTGG + Intergenic
1181513831 22:23400634-23400656 GCTGCCAGTCAGCACCCACGGGG + Intergenic
1183145535 22:35988014-35988036 GCTGCCTGTTAGCATCCTCTGGG - Intronic
1183380624 22:37488899-37488921 CCTGCCAGTCTGTCACCACTGGG - Intergenic
1183428044 22:37750205-37750227 GCTGTCAGGCTGGAACCTCTAGG - Intronic
1185291732 22:50030823-50030845 GCTGCCCGTCTGCAACCTCAAGG - Exonic
953886432 3:46717060-46717082 GCTCCCAGCCAGGGACCTCTGGG - Intronic
960050497 3:113234647-113234669 GCTGACAGTAAGCACCCTCTAGG - Intronic
960775270 3:121243591-121243613 GCTGCCAGTGAGTATTCTCGGGG - Intronic
962537490 3:136342975-136342997 GGTGACAGTGAGTATCCTCTTGG + Intronic
963986895 3:151606651-151606673 GGTGCCAGTCATTTACCTTTAGG + Intergenic
966582527 3:181584359-181584381 GCTGCCAGTCAGTGCCCTGCAGG + Intergenic
968001443 3:195209501-195209523 GCTGCCTGACACTGACCTCTGGG - Intronic
970234421 4:13944383-13944405 TCTGCCAGTCAGTGACCTGCCGG - Intergenic
972424028 4:38915933-38915955 GCCACCAGGCAGTACCCTCTGGG + Intronic
973257472 4:48127899-48127921 GTTGCCACCCAGGAACCTCTGGG - Intronic
974016445 4:56653568-56653590 GCTGCCTGTCTCTAAGCTCTGGG + Intronic
976139140 4:81972038-81972060 GCTGCCTCTCTGTAACCTTTGGG - Intronic
981575727 4:146203008-146203030 GCTGACAGTCAGCATCCTTTAGG + Intergenic
986344617 5:6823055-6823077 GCTCCCAGTCAGCCGCCTCTGGG + Intergenic
987363534 5:17127968-17127990 GCCGCCAGTCAGTAAGCACCTGG - Intronic
990530608 5:56669808-56669830 GCTGGCAGGCAGGAACCTCCAGG + Intergenic
990865715 5:60377659-60377681 TCAGTCAGTCAGTTACCTCTGGG - Intronic
992382558 5:76252548-76252570 GCATCAAGTTAGTAACCTCTGGG + Intronic
994900971 5:105768725-105768747 GCTGCCAGTGAGTATTCTCAGGG - Intergenic
997840631 5:137236211-137236233 GCTGCCAGTGAGGGCCCTCTAGG + Intronic
1000346818 5:160321387-160321409 GCTGGCAGTGAGGAACTTCTAGG - Intronic
1002921084 6:1574042-1574064 GCTGCCAGGTTGCAACCTCTGGG + Intergenic
1006227412 6:32551257-32551279 GATGCCTGTCAGGAATCTCTAGG + Intergenic
1009289680 6:61867834-61867856 GCAACCAGTCAGTAACCCCCTGG - Intronic
1012133944 6:95532348-95532370 GCTGCTAGTCAGGATCCACTAGG - Intergenic
1014361334 6:120479569-120479591 GATGCCAGTCAGTAAAGACTTGG - Intergenic
1017206703 6:151809653-151809675 TCTGCCCTTCAGTATCCTCTGGG - Intronic
1018380657 6:163255380-163255402 GCTGCCCGTCAGTCACCTCCTGG - Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1020861783 7:13502568-13502590 GCTGGCAGTCTGTAACCTAGAGG + Intergenic
1022871693 7:34486920-34486942 GCTGCCAGGCTGTTACCTCTGGG - Intergenic
1024085409 7:45888412-45888434 GCTGCCAATCATTAACCTCCTGG + Exonic
1024714552 7:52061147-52061169 GCTGCCTCTCAGTCATCTCTTGG - Intergenic
1024804034 7:53114982-53115004 GCTGCCAATCAGGAACCACGTGG - Intergenic
1026243758 7:68599810-68599832 GCTGCCAGTGAGTGTTCTCTTGG + Intergenic
1032580234 7:133097201-133097223 GCTGGCAGTCTGGAACCTCTGGG + Intergenic
1038882395 8:31628769-31628791 GCTGGCCATCAGTGACCTCTGGG - Intergenic
1043210098 8:77502953-77502975 GCTGCCAGTAAGTAACATTTTGG - Intergenic
1044484172 8:92730781-92730803 GCTGCCAGTCTGTTTCCTATAGG + Intergenic
1047408999 8:124609007-124609029 GCAGCAAGTCAGTATCTTCTGGG - Intronic
1049184712 8:141243953-141243975 GCTTCCAGTCAGGAAGCTGTTGG + Intronic
1056258872 9:84827621-84827643 GCTGCCAATCTGTAACCCTTGGG + Intronic
1057700888 9:97362378-97362400 GGTGCCAGCCAGAAAACTCTGGG + Exonic
1061007483 9:127936391-127936413 GCTGCCAGTCAGTAACCTCTGGG - Intronic
1061199503 9:129128889-129128911 GCTGCCAGACAATGACCCCTTGG - Intronic
1189189425 X:39086458-39086480 GCTGCCAGTGAGTATTCTCAGGG - Intergenic
1190327468 X:49215636-49215658 GGTGCCAGGCAGGAAACTCTGGG - Intronic
1191133241 X:57037590-57037612 GCTGGCAGGCAGGAACGTCTAGG + Intergenic
1194387167 X:93269508-93269530 GCAGCTTGTCAGTAAGCTCTAGG + Intergenic
1194624851 X:96215216-96215238 TCTCCCAGTCAGTAGCCACTGGG - Intergenic
1195366571 X:104132289-104132311 GTTGCCTTTCGGTAACCTCTAGG + Intronic
1196050681 X:111300559-111300581 ACTGCCAAACAGTAACCTCCAGG - Exonic
1196469411 X:116009044-116009066 GGTGCCAGTTTGCAACCTCTAGG + Intergenic
1196496228 X:116328059-116328081 CAGGCCAGTCAGTAACCTCTGGG - Intergenic
1198094617 X:133367007-133367029 GTGGCCAGTAAGAAACCTCTAGG + Intronic
1199804092 X:151280556-151280578 CCTACCAGACTGTAACCTCTGGG - Intergenic