ID: 1061008117

View in Genome Browser
Species Human (GRCh38)
Location 9:127939868-127939890
Sequence ATATGCACAACTGAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061008117_1061008122 -10 Left 1061008117 9:127939868-127939890 CCTCCTTCCTCAGTTGTGCATAT No data
Right 1061008122 9:127939881-127939903 TTGTGCATATAACAGAGGAAGGG No data
1061008117_1061008123 -9 Left 1061008117 9:127939868-127939890 CCTCCTTCCTCAGTTGTGCATAT No data
Right 1061008123 9:127939882-127939904 TGTGCATATAACAGAGGAAGGGG No data
1061008117_1061008126 9 Left 1061008117 9:127939868-127939890 CCTCCTTCCTCAGTTGTGCATAT No data
Right 1061008126 9:127939900-127939922 AGGGGCAGAATCGGCCTTCAGGG No data
1061008117_1061008129 19 Left 1061008117 9:127939868-127939890 CCTCCTTCCTCAGTTGTGCATAT No data
Right 1061008129 9:127939910-127939932 TCGGCCTTCAGGGTTTAAAGGGG No data
1061008117_1061008124 0 Left 1061008117 9:127939868-127939890 CCTCCTTCCTCAGTTGTGCATAT No data
Right 1061008124 9:127939891-127939913 AACAGAGGAAGGGGCAGAATCGG No data
1061008117_1061008128 18 Left 1061008117 9:127939868-127939890 CCTCCTTCCTCAGTTGTGCATAT No data
Right 1061008128 9:127939909-127939931 ATCGGCCTTCAGGGTTTAAAGGG No data
1061008117_1061008127 17 Left 1061008117 9:127939868-127939890 CCTCCTTCCTCAGTTGTGCATAT No data
Right 1061008127 9:127939908-127939930 AATCGGCCTTCAGGGTTTAAAGG No data
1061008117_1061008131 30 Left 1061008117 9:127939868-127939890 CCTCCTTCCTCAGTTGTGCATAT No data
Right 1061008131 9:127939921-127939943 GGTTTAAAGGGGCCATGAGTCGG No data
1061008117_1061008125 8 Left 1061008117 9:127939868-127939890 CCTCCTTCCTCAGTTGTGCATAT No data
Right 1061008125 9:127939899-127939921 AAGGGGCAGAATCGGCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061008117 Original CRISPR ATATGCACAACTGAGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr