ID: 1061008119

View in Genome Browser
Species Human (GRCh38)
Location 9:127939875-127939897
Sequence CTCTGTTATATGCACAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061008119_1061008129 12 Left 1061008119 9:127939875-127939897 CCTCAGTTGTGCATATAACAGAG No data
Right 1061008129 9:127939910-127939932 TCGGCCTTCAGGGTTTAAAGGGG No data
1061008119_1061008125 1 Left 1061008119 9:127939875-127939897 CCTCAGTTGTGCATATAACAGAG No data
Right 1061008125 9:127939899-127939921 AAGGGGCAGAATCGGCCTTCAGG No data
1061008119_1061008132 24 Left 1061008119 9:127939875-127939897 CCTCAGTTGTGCATATAACAGAG No data
Right 1061008132 9:127939922-127939944 GTTTAAAGGGGCCATGAGTCGGG No data
1061008119_1061008126 2 Left 1061008119 9:127939875-127939897 CCTCAGTTGTGCATATAACAGAG No data
Right 1061008126 9:127939900-127939922 AGGGGCAGAATCGGCCTTCAGGG No data
1061008119_1061008124 -7 Left 1061008119 9:127939875-127939897 CCTCAGTTGTGCATATAACAGAG No data
Right 1061008124 9:127939891-127939913 AACAGAGGAAGGGGCAGAATCGG No data
1061008119_1061008131 23 Left 1061008119 9:127939875-127939897 CCTCAGTTGTGCATATAACAGAG No data
Right 1061008131 9:127939921-127939943 GGTTTAAAGGGGCCATGAGTCGG No data
1061008119_1061008128 11 Left 1061008119 9:127939875-127939897 CCTCAGTTGTGCATATAACAGAG No data
Right 1061008128 9:127939909-127939931 ATCGGCCTTCAGGGTTTAAAGGG No data
1061008119_1061008133 25 Left 1061008119 9:127939875-127939897 CCTCAGTTGTGCATATAACAGAG No data
Right 1061008133 9:127939923-127939945 TTTAAAGGGGCCATGAGTCGGGG No data
1061008119_1061008127 10 Left 1061008119 9:127939875-127939897 CCTCAGTTGTGCATATAACAGAG No data
Right 1061008127 9:127939908-127939930 AATCGGCCTTCAGGGTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061008119 Original CRISPR CTCTGTTATATGCACAACTG AGG (reversed) Intergenic
No off target data available for this crispr