ID: 1061008131

View in Genome Browser
Species Human (GRCh38)
Location 9:127939921-127939943
Sequence GGTTTAAAGGGGCCATGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061008119_1061008131 23 Left 1061008119 9:127939875-127939897 CCTCAGTTGTGCATATAACAGAG No data
Right 1061008131 9:127939921-127939943 GGTTTAAAGGGGCCATGAGTCGG No data
1061008117_1061008131 30 Left 1061008117 9:127939868-127939890 CCTCCTTCCTCAGTTGTGCATAT No data
Right 1061008131 9:127939921-127939943 GGTTTAAAGGGGCCATGAGTCGG No data
1061008118_1061008131 27 Left 1061008118 9:127939871-127939893 CCTTCCTCAGTTGTGCATATAAC No data
Right 1061008131 9:127939921-127939943 GGTTTAAAGGGGCCATGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061008131 Original CRISPR GGTTTAAAGGGGCCATGAGT CGG Intergenic
No off target data available for this crispr