ID: 1061008669

View in Genome Browser
Species Human (GRCh38)
Location 9:127942705-127942727
Sequence TCCCTTGCCCTGGTGGTGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 324}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061008669_1061008680 29 Left 1061008669 9:127942705-127942727 CCCCCCACCACCAGGGCAAGGGA 0: 1
1: 0
2: 4
3: 39
4: 324
Right 1061008680 9:127942757-127942779 GTGACCAAAGCCAGTGCTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 155
1061008669_1061008677 -9 Left 1061008669 9:127942705-127942727 CCCCCCACCACCAGGGCAAGGGA 0: 1
1: 0
2: 4
3: 39
4: 324
Right 1061008677 9:127942719-127942741 GGCAAGGGAACAACGGAGCAAGG 0: 1
1: 0
2: 0
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061008669 Original CRISPR TCCCTTGCCCTGGTGGTGGG GGG (reversed) Exonic
900663833 1:3800263-3800285 TCTCATGCTCTGCTGGTGGGAGG + Intergenic
900772491 1:4556305-4556327 TCCCTAGACCCAGTGGTGGGTGG + Intergenic
900941399 1:5800898-5800920 TCCTCTTCCCTTGTGGTGGGGGG - Intergenic
900960486 1:5915902-5915924 TCCCTTGTCCTGGGTGAGGGTGG - Intronic
901008742 1:6185829-6185851 TCCCATGCCAAGGAGGTGGGAGG - Exonic
901209431 1:7516051-7516073 TCTCCTGCCCTGGTGGGGGCCGG - Intronic
901250114 1:7771508-7771530 TCCCGAGGCCTGGGGGTGGGCGG + Intronic
901493647 1:9609202-9609224 TCCCCTGGCCTGGTGAGGGGAGG + Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
901529942 1:9846580-9846602 TCCCTTCCATTGGTGGTAGGGGG - Intergenic
901635284 1:10667625-10667647 TCCCTTGCCCTGGATGGGGAAGG + Intronic
901755836 1:11440962-11440984 TGCCTTGGCCTGGTGGTGGGAGG + Intergenic
903808694 1:26022620-26022642 TCCCTAGCCCTGACTGTGGGTGG + Exonic
903972975 1:27131107-27131129 TCCCCTGCCCTGCTGGAGGGAGG - Intronic
904386592 1:30146486-30146508 TCCTTTGCCCTGGGCGTGGGGGG - Intergenic
905946101 1:41902467-41902489 CACCTTGCCCTGGCAGTGGGGGG - Intronic
906117147 1:43364557-43364579 TCCCTGGAGCTGGTGGTGGGGGG - Exonic
906343225 1:44998853-44998875 TCACTTGGCCTGGAGGTGGAGGG + Intergenic
907389932 1:54151597-54151619 ACCCATGCCTGGGTGGTGGGAGG - Intronic
907959814 1:59268344-59268366 TCCCTGGTCTTGGAGGTGGGAGG - Intergenic
909042458 1:70670470-70670492 TACCTTGGCCTGGGGGAGGGCGG + Intergenic
909491690 1:76233442-76233464 TCCCTTGGCCTTGTGGTTGGTGG - Intronic
909530900 1:76680874-76680896 TCTCTGGCTCTGATGGTGGGGGG + Intergenic
909673235 1:78211939-78211961 TCCCTTTCTCTGCTGGTGCGTGG + Intergenic
911144832 1:94541874-94541896 TCACTTGCCGTCGCGGTGGGCGG + Intergenic
911161405 1:94686011-94686033 TCCTTTGCCCTGCATGTGGGTGG + Intergenic
912471775 1:109911386-109911408 GCCCGTGCCTTGGTGGTGGCGGG - Intronic
913606232 1:120468924-120468946 TCCCTAGCCCTGGTGTTTAGGGG + Intergenic
913965849 1:143377057-143377079 ACCATTGCCGTGGTGGTGGGTGG + Intergenic
914060223 1:144202665-144202687 ACCATTGCCGTGGTGGTGGGTGG + Intergenic
914118927 1:144763704-144763726 ACCATTGCCGTGGTGGTGGGTGG - Intergenic
914210202 1:145571228-145571250 TCCCTAGCCCTGGTGTTTAGGGG - Intergenic
914900705 1:151709688-151709710 GCCCTGGGCCTGGGGGTGGGAGG + Intronic
916381273 1:164214590-164214612 TCTCGTGCCCTGCTGGTGAGAGG + Intergenic
916747373 1:167694885-167694907 TCCCTCGCCCTGCTGGGAGGAGG + Intronic
917675135 1:177311708-177311730 TCCTTTGCCCTGGTGGGAGGAGG - Intergenic
920390672 1:205598557-205598579 TCTTTTGCCCTGCTGGAGGGAGG + Intronic
920512073 1:206558870-206558892 TCCCTTTCCCTGGCTGTAGGTGG + Intronic
920659451 1:207902891-207902913 GCGCTCGGCCTGGTGGTGGGTGG - Intronic
920800855 1:209186128-209186150 TCCCTTCTCCTGCTGCTGGGAGG + Intergenic
922478312 1:225921961-225921983 ACCCATGCCCTGGTGGAGGATGG - Exonic
922727068 1:227927541-227927563 TCCCTAGCCCTGGGGCTTGGAGG - Intronic
922960957 1:229645137-229645159 TAGCTGGGCCTGGTGGTGGGTGG + Intronic
1063424472 10:5940663-5940685 TCCACTGAGCTGGTGGTGGGGGG - Intronic
1063454910 10:6176273-6176295 TCCCTTGAGGTGGTGATGGGAGG + Intronic
1064316922 10:14266147-14266169 TTCTTTGTCCTGGGGGTGGGAGG + Intronic
1064963039 10:20987558-20987580 TCTGTGGCTCTGGTGGTGGGAGG - Intronic
1065094979 10:22271705-22271727 TCCCTCGTGCAGGTGGTGGGAGG + Intergenic
1065158390 10:22894234-22894256 TTCCATGGGCTGGTGGTGGGTGG + Intergenic
1065210533 10:23398258-23398280 ACCCTTTCCCTGGAGGTGGATGG + Intergenic
1066411287 10:35171971-35171993 TCCCTACACATGGTGGTGGGTGG + Intronic
1066633701 10:37480753-37480775 ACCCCTTCCCTGGTGGGGGGTGG - Intergenic
1067101546 10:43338272-43338294 GCGCTAACCCTGGTGGTGGGTGG - Intergenic
1067469862 10:46528369-46528391 TCTCATGTCCTGGTGGGGGGGGG + Intergenic
1068653776 10:59553653-59553675 TCCCTTACCGCGGGGGTGGGTGG - Intergenic
1070327036 10:75396134-75396156 TCCCCCGCCCTGCAGGTGGGAGG - Intergenic
1070597552 10:77843374-77843396 TCTCATCCCCTGGTGGTGGCTGG + Intronic
1072614295 10:97039150-97039172 TCGCTGGTCCTGGGGGTGGGGGG + Intronic
1074185401 10:111096509-111096531 TCCATTGCCCTGGTGATGTGGGG + Intergenic
1075956886 10:126532059-126532081 TTCATTGCCCTGGATGTGGGGGG - Intronic
1076250777 10:128982392-128982414 TCCTGTGACCTGGAGGTGGGGGG + Intergenic
1076388743 10:130079763-130079785 TCTCTGGCCTTGGTGCTGGGAGG + Intergenic
1076827616 10:132977195-132977217 CCTCTTACCCTGGTGGTCGGAGG + Intergenic
1076900936 10:133337027-133337049 TCCCTAGCCGGGGCGGTGGGTGG - Intronic
1076994745 11:292456-292478 GCCCTCGCCCTGGAGGAGGGGGG - Intronic
1077388348 11:2286435-2286457 TCCCTTGCCCTGGTGGAGTTTGG - Intergenic
1078279512 11:9886018-9886040 TCCCTTTACCTGTTTGTGGGAGG + Intronic
1081176858 11:39938069-39938091 TCCCTTCTGTTGGTGGTGGGGGG + Intergenic
1081524490 11:43916530-43916552 TCCTTAGCCCTGGTTTTGGGGGG + Intronic
1081718031 11:45265092-45265114 TCCATTGTCCTGTTGGTGGAAGG - Intronic
1083238927 11:61371390-61371412 TTCCTTTCCCTGGGGGTGTGGGG - Intergenic
1083324147 11:61865069-61865091 GCCTCTGCCCAGGTGGTGGGAGG + Intronic
1083464494 11:62835931-62835953 TCCCCTGCCCTGATGGTTGGGGG - Intronic
1083488315 11:62997067-62997089 GCCCTTGCCATGGTTTTGGGAGG - Intronic
1083737017 11:64687249-64687271 TGCCTTCCCCTGGTGGAGGCAGG + Intronic
1083860305 11:65416778-65416800 TTTGTTTCCCTGGTGGTGGGCGG + Intergenic
1084175548 11:67420597-67420619 CCCCCTGCCCAGGTGGTGTGCGG + Exonic
1084189383 11:67492076-67492098 CCCCGTGCCAGGGTGGTGGGTGG + Exonic
1084218939 11:67666178-67666200 TGCTTTGCCGTGGTGCTGGGCGG - Exonic
1084381987 11:68818402-68818424 TCCCTTGCTCTGGCGATGTGGGG - Intronic
1084438619 11:69158051-69158073 GCCCTTCCAGTGGTGGTGGGAGG + Intergenic
1084592003 11:70096091-70096113 TCTCTTGCCCTGGTGGGGGCGGG + Intronic
1084632757 11:70365331-70365353 TCCCTTGCCCTGGATGTGGTTGG + Intronic
1084657018 11:70525647-70525669 TCCGTTCCCCTGGCGTTGGGAGG - Intronic
1084731296 11:71075411-71075433 GCGCTTGCCCAGATGGTGGGTGG - Intronic
1084733971 11:71092674-71092696 TGCCTTGACCTGGGGGAGGGTGG - Intronic
1089366694 11:117924950-117924972 TGCCTCGCCCTGGGGGTGGGGGG + Intronic
1090406264 11:126477351-126477373 TCCCTTTCCCTGTGTGTGGGAGG + Intronic
1090591397 11:128274004-128274026 TCAATTGTCATGGTGGTGGGTGG - Intergenic
1091115986 11:133013998-133014020 TTCCTAGCGGTGGTGGTGGGAGG - Intronic
1092911480 12:13148821-13148843 TCGCTTGACCTGGAGGTGAGGGG + Intergenic
1093857896 12:24127761-24127783 TCCCTTCCCCAGGTGGGGTGAGG - Intergenic
1096386088 12:51196240-51196262 TCTGTTCCCCTGGTGGTGTGGGG - Intronic
1096499176 12:52054969-52054991 TCCCTCCCCCAGCTGGTGGGTGG - Exonic
1096677588 12:53233892-53233914 TGCCCTGCCCTAGTGGTGGCTGG + Intergenic
1097161356 12:57048605-57048627 TGCCTTCCCCTGGTGGTCAGAGG - Intronic
1097250109 12:57627851-57627873 TCCCTCTCCCTGCAGGTGGGGGG - Exonic
1097953298 12:65456835-65456857 ACCCTTGCCCTTGTGGATGGAGG + Intronic
1098071870 12:66684552-66684574 TCCCTTCCCCTGGCGGGGGACGG + Intronic
1100440935 12:94616425-94616447 TCCCTTCCCTTGGTGCTGGCTGG - Intronic
1101986355 12:109450552-109450574 TCCCTGGGGCTGGTGGTGTGAGG + Exonic
1102277938 12:111598045-111598067 TCCCTTCCCCAGGTGGGGGAGGG + Intronic
1102816223 12:115868540-115868562 TCCCTGGTCCTGGAGGTGGGAGG + Intergenic
1104122008 12:125808707-125808729 TCCCCTGCCCTGGTGTCTGGAGG + Intergenic
1104532391 12:129584454-129584476 TCCTTTGGCCTCATGGTGGGTGG + Intronic
1104904225 12:132204941-132204963 ACCCTTTCTCGGGTGGTGGGGGG - Intronic
1104908506 12:132228307-132228329 TCCCTTTCCCTGAGTGTGGGTGG + Intronic
1106476760 13:30105594-30105616 TCCCGGGCCCTGGAGGTAGGAGG - Intergenic
1109657144 13:65407859-65407881 TCCCTTGGCCTGGGGGTTGGGGG + Intergenic
1112019489 13:95359392-95359414 TCCCCTGCCAGTGTGGTGGGAGG + Intergenic
1112294495 13:98174956-98174978 AACCTGGCCATGGTGGTGGGTGG + Intronic
1113710905 13:112464692-112464714 TCCTGTGCCCTGCTGTTGGGTGG - Intergenic
1114574309 14:23698590-23698612 AACCTTGCTCTGGTGTTGGGGGG - Intergenic
1114642958 14:24236864-24236886 TACCTTGGCTTGGTGTTGGGTGG + Intronic
1118320472 14:64749515-64749537 TGCCTGGCCCGGGAGGTGGGGGG - Exonic
1119839612 14:77782161-77782183 TAGCTGGGCCTGGTGGTGGGCGG + Intergenic
1120754459 14:88229268-88229290 TGCCTTACCCAGGAGGTGGGTGG - Intronic
1120764001 14:88311825-88311847 TCCCTTGTCAGGGTGGTTGGGGG + Intronic
1121368579 14:93336949-93336971 CCCCTTGTGATGGTGGTGGGAGG + Intronic
1121741412 14:96254790-96254812 TGCCTTGCCAAGGTGGTGGAGGG - Intronic
1122176085 14:99920272-99920294 TCCCTCGCCCTGTTGGTTGCAGG + Intronic
1122355851 14:101122457-101122479 TCCCTCCCTCAGGTGGTGGGTGG - Intergenic
1122488645 14:102098060-102098082 TCCCTCTCCCTGGAGGTGGCAGG - Intronic
1123975384 15:25548787-25548809 TCCCTCTCCCTGCTGGGGGGTGG + Intergenic
1125159585 15:36627745-36627767 GCCCTGGCCCTGGTGATGGTTGG - Intronic
1125885170 15:43223887-43223909 TCGCTTGACCTGGTGGGTGGAGG + Intergenic
1126569757 15:50138099-50138121 TCTCATACCCTGGTGGTGAGAGG + Intronic
1126693922 15:51310019-51310041 TTCCCTGGCCTGGTGGTGGCAGG - Intronic
1128217701 15:65945685-65945707 TCCGTTCCCCAGGTGGTGGCAGG - Intronic
1128384239 15:67135743-67135765 TGCCTTGGCCTGTTGGTGGTGGG + Intronic
1129869088 15:78929409-78929431 TACCTTGCCCTGGTAGGGGTAGG + Exonic
1130068206 15:80623743-80623765 TGCCTTGGGCTGGGGGTGGGGGG + Intergenic
1130343338 15:83018973-83018995 TGCCTAGCCTTGGGGGTGGGGGG + Intronic
1130931322 15:88430215-88430237 TTCCCTGATCTGGTGGTGGGAGG - Intergenic
1131409721 15:92197102-92197124 TGCCATGGCCTGGGGGTGGGAGG + Intergenic
1131627200 15:94133927-94133949 TCCCTGGCCCAGGGGGTGGCAGG + Intergenic
1134015996 16:10888810-10888832 TCCCTCGCCGGGGTGCTGGGGGG + Intronic
1135042820 16:19131027-19131049 TTCCCTGCTCTTGTGGTGGGTGG - Intronic
1135413301 16:22250901-22250923 ACCTCTGCCCTGGTGTTGGGAGG + Intronic
1137692757 16:50440988-50441010 TTCCCTCCCCTGGTGCTGGGAGG + Intergenic
1137732313 16:50697876-50697898 TCCCCTGGGCTGGGGGTGGGGGG - Intronic
1137915875 16:52429400-52429422 TCCTTGGCCCTGGAGGAGGGAGG - Intergenic
1139419995 16:66844321-66844343 TCTCTGGCCCTGCTGGGGGGTGG + Intronic
1140033394 16:71355786-71355808 TCCCTGGCCTTGGTGGGTGGTGG + Intergenic
1140441493 16:74991428-74991450 CCCCTTGGCCTGGGGGAGGGTGG + Intronic
1141942076 16:87283794-87283816 TCTTGTGCCCTGGTGGTGGTTGG - Intronic
1142248987 16:88982593-88982615 TCTCTTGCCATGGGGGCGGGAGG - Intergenic
1142387431 16:89774767-89774789 TCCCTGGCCCTGCAGGTGGAAGG + Intronic
1142500234 17:328130-328152 CCCCTTGGCATGGTGCTGGGTGG - Intronic
1142998733 17:3777280-3777302 TCCATTGCCCAGGGGGAGGGTGG - Intronic
1143527315 17:7479879-7479901 GCCCTTTCCCTGGGGGTCGGTGG - Intronic
1143557166 17:7669069-7669091 TCCCTCTCCCTGTTGGTCGGTGG - Exonic
1143729025 17:8869832-8869854 TGCCTTGCCTTGGTGATGGTAGG - Intergenic
1143885783 17:10063845-10063867 CCCCTTGCACGGGTGGTGAGGGG + Intronic
1144568334 17:16379100-16379122 TCTCTGGGCCTGGTGGTGAGCGG + Intergenic
1144731295 17:17527970-17527992 GCCCTGGGCCAGGTGGTGGGGGG - Intronic
1144766876 17:17737942-17737964 ACCCTGCCCCTGGTGGGGGGAGG + Intronic
1147446793 17:40479641-40479663 TCCCTTGCCCTGGGGCTCCGGGG - Intronic
1147551663 17:41447257-41447279 GCTCTTGCCATGGGGGTGGGTGG + Intergenic
1147992855 17:44345622-44345644 TCCCCTCTCCTGGTGGTGGTGGG + Intronic
1148052830 17:44777568-44777590 CTCCTTGCCCTGGTGGTAGAAGG - Exonic
1148769535 17:50058967-50058989 TCCACTGCCCTGGGGGTGGGAGG + Intronic
1151491391 17:74433816-74433838 TCCTTGGCCCTGGTGGGTGGAGG + Intronic
1151542832 17:74773532-74773554 CCCCTAGCCCTGGTACTGGGAGG - Intronic
1151963149 17:77418020-77418042 TCCTGTTCCCTGGCGGTGGGGGG + Intronic
1152103887 17:78317956-78317978 TCCCCTGGCCTGGTGCTGGGAGG - Intergenic
1152168606 17:78727650-78727672 AGCCTTGCCCTGCTGGTAGGTGG - Intronic
1152706215 17:81844981-81845003 TCCCTTGCCCTGCTGGGCGAAGG + Intronic
1154039601 18:10841317-10841339 TTCCCTCCCCTGGTGCTGGGAGG + Intronic
1154163018 18:11993947-11993969 TCACCTGCCCTGCTGGTAGGAGG + Intronic
1155158280 18:23176215-23176237 TTCCATGCACTGGGGGTGGGGGG + Intronic
1156952546 18:42920053-42920075 TTCCTTACCCTTTTGGTGGGAGG - Intronic
1157601260 18:48894453-48894475 GCCCCTGCCCTGGGGCTGGGAGG + Intergenic
1157753716 18:50199759-50199781 TCCCTTGCCCTGGTTTGGGGGGG - Intergenic
1158595044 18:58808542-58808564 TGCCTTTCCCTGGTGCTGGCTGG + Intergenic
1159911803 18:74152623-74152645 ACCCTGTCCCTGGTGGTAGGGGG - Intronic
1159917740 18:74201375-74201397 TCCTTTCTCCTGGTGGAGGGGGG - Intergenic
1160237397 18:77097111-77097133 TGTGTTGCCCTGTTGGTGGGGGG - Intronic
1161016414 19:1985849-1985871 GCCCTGGCCCAGGTGGTGAGCGG - Exonic
1161301242 19:3544120-3544142 AGCCCTGCCCTGGTTGTGGGCGG - Intronic
1161907826 19:7170455-7170477 TTCCATGGACTGGTGGTGGGTGG - Intronic
1162007160 19:7788254-7788276 TCCCTTGCCCGGGGGGTGCGGGG - Intergenic
1162302246 19:9850515-9850537 TCCCATCGCCTGGTGGAGGGGGG + Intergenic
1162479542 19:10920584-10920606 TCCCTGGGGCTGGTGGTGGTGGG + Intronic
1162552575 19:11365714-11365736 TTCCTCCCCCGGGTGGTGGGGGG + Intergenic
1162924548 19:13923646-13923668 TCCCTGGCCCTGGGGATGGGTGG - Intronic
1163288340 19:16363391-16363413 TCCCAGGCTCAGGTGGTGGGCGG - Intronic
1164649351 19:29880874-29880896 ACCCTGGCCCTGGTGCTGGAGGG + Intergenic
1165399466 19:35588693-35588715 TCCCTTGCCCCGTTGGCCGGGGG - Intergenic
1165739087 19:38195104-38195126 CTCCTTGCCCTGGTGGTGTGGGG + Intronic
1167156694 19:47743169-47743191 TCTCTTTCCCTGGGGGAGGGCGG - Intergenic
1167289645 19:48617308-48617330 TCCCTTTCCCGGATGGTGAGTGG - Exonic
1168147572 19:54428661-54428683 TCTCTGGCCCTGGTGGGGTGAGG + Intronic
1168381510 19:55927637-55927659 TCACTTGCCCTGGTGGTTTATGG - Intronic
1202699627 1_KI270712v1_random:154550-154572 ACCATTGCCGTGGTGGTGGGTGG + Intergenic
925006209 2:444869-444891 ACCCTGGCCCTGGAGGTGAGGGG + Intergenic
925315680 2:2921441-2921463 GCCCTTCCCCTGGTGTTGGGAGG + Intergenic
925686112 2:6475695-6475717 TCCCACGCCCTGGTGGTGCAGGG - Intergenic
925855023 2:8121327-8121349 CCCCCTGCCCTGGTCGTGGATGG + Intergenic
926059508 2:9796366-9796388 TCCCTGGCCCTGGCTGTAGGAGG + Intergenic
927667661 2:25043276-25043298 TACCTTGCAGTGGGGGTGGGAGG - Intronic
927863771 2:26576218-26576240 TCCCTTCCCGTGGTGGGGGCAGG - Intronic
928170395 2:28999498-28999520 GCCCTTGACCTGGAAGTGGGTGG - Intronic
928420619 2:31135778-31135800 TCCTTTGGCATGGGGGTGGGGGG - Intronic
928845341 2:35665126-35665148 TGCCTAGGCCTGGTGGTGAGAGG - Intergenic
931597149 2:63960110-63960132 TGGCTTGAGCTGGTGGTGGGTGG + Intronic
932337200 2:70938143-70938165 AGCCTTCCCCTGGGGGTGGGAGG - Intronic
932596377 2:73096135-73096157 TCCTCTGCTTTGGTGGTGGGTGG - Intronic
933900570 2:86846731-86846753 ACCCTTGGCCTGCTGGTGGCTGG - Exonic
934170571 2:89538038-89538060 ACCATTGCCGTGGTGGTGGGTGG + Intergenic
934280873 2:91612358-91612380 ACCATTGCCGTGGTGGTGGGTGG + Intergenic
934514801 2:94980145-94980167 TCCCTGACTCTGGGGGTGGGTGG - Intergenic
934677461 2:96259788-96259810 CAGCATGCCCTGGTGGTGGGTGG - Intronic
935615942 2:105082084-105082106 TGCCTGGCCTTGGTGGTGGGGGG + Intronic
935779978 2:106502494-106502516 ACCCTTGGCCTGCTGGTGGCTGG + Intergenic
935873884 2:107485417-107485439 TCACTGGGCATGGTGGTGGGTGG + Intergenic
936054892 2:109255085-109255107 ACCCGTGTCATGGTGGTGGGAGG + Intronic
938462790 2:131508911-131508933 GCTCTTGCTCTGGGGGTGGGGGG + Intergenic
940500139 2:154483532-154483554 TCCTTTGTCTTGGAGGTGGGAGG + Intergenic
942376187 2:175340017-175340039 TCCCTTGGCTAGGGGGTGGGGGG + Intergenic
944408628 2:199414419-199414441 GGCATTGCCCTGGTGGGGGGTGG - Intronic
945856499 2:215075080-215075102 TCCCATGCATTGGTGGTGGGGGG - Intronic
947991995 2:234495760-234495782 TCCCCTGAGCTGGGGGTGGGGGG + Exonic
948130503 2:235597162-235597184 TCCCTGGCCTTGGTGGTTGAAGG - Intronic
1168766879 20:387939-387961 TCCTTTCCCCTGCTGGTGGGAGG - Intronic
1168835983 20:877810-877832 TCCTATGCCCTGGGGCTGGGTGG - Intronic
1169398690 20:5260538-5260560 TCACTTGAACCGGTGGTGGGTGG - Intergenic
1172113082 20:32558925-32558947 TCCCTTGCACTGGTTCTCGGCGG - Intronic
1172126980 20:32630262-32630284 TGGCTTGCCCTGTTGGTGGGTGG - Intergenic
1172189938 20:33055867-33055889 TCCCTTACCCTAGTGATGTGAGG - Intronic
1173927931 20:46794503-46794525 TCCCTTGTCCCTGTGCTGGGTGG - Intergenic
1175865531 20:62174241-62174263 GCCCTCGCCATGCTGGTGGGGGG + Intronic
1178707998 21:34890033-34890055 ACCCTAGCCCTGGGGGAGGGAGG - Intronic
1179574582 21:42299784-42299806 TCCCAGGCCCTGGGGGTGAGGGG + Intergenic
1180068372 21:45424080-45424102 TCCCGGGCACTGGTGCTGGGGGG + Intronic
1180796630 22:18608961-18608983 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1180936051 22:19625940-19625962 GCCCTGGCCCAGGTGGCGGGAGG - Intergenic
1181116543 22:20635456-20635478 TACCCTGCCCTGGTGCTGTGGGG - Intergenic
1181158503 22:20941244-20941266 TCCCATGCCGTGGTGGTGTGTGG + Intronic
1181225094 22:21386310-21386332 TCCCTGGCCCTGGAAATGGGGGG + Exonic
1181253538 22:21548503-21548525 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1181808758 22:25391026-25391048 TCCCTCACCCTGGTTGTGGATGG - Intronic
1182423175 22:30258194-30258216 TCCCAGCCCCTGGTGGAGGGTGG + Intergenic
1182708495 22:32305621-32305643 TCCCTTCTCCTGCTGGCGGGTGG + Intergenic
1183304736 22:37076539-37076561 GCCCATGCCCTGGAGATGGGAGG - Intronic
1184115817 22:42421575-42421597 GCCCATGACTTGGTGGTGGGAGG - Intronic
1184225945 22:43128938-43128960 TCAGCTGCCCTTGTGGTGGGCGG - Intronic
1184533560 22:45071649-45071671 TCCCTTGTCCTGGTGGGCTGGGG + Intergenic
1185220497 22:49627117-49627139 ACCCCTGCCCTCCTGGTGGGAGG - Intronic
1185231528 22:49686818-49686840 CCACCTGCCCTGTTGGTGGGAGG - Intergenic
950362902 3:12462383-12462405 TCCCCAGCCCCGGTGGTGGCAGG - Intergenic
950531472 3:13554593-13554615 TCCCTAGTCCTCGTGGTGGTTGG + Intronic
953447780 3:42982191-42982213 TTCTTTGCAGTGGTGGTGGGAGG + Intronic
953605384 3:44410189-44410211 TACCTTGGCCTGTGGGTGGGAGG - Intergenic
953993623 3:47502876-47502898 TCAGTTGCCCTGATGGTGAGTGG + Intronic
954372190 3:50174758-50174780 ACCCTGGCCCTGGGGGTGGAAGG - Intronic
955019714 3:55107511-55107533 TCCCGTGCCCAGTTGGTGGATGG + Intergenic
955415012 3:58684053-58684075 TCCCTTCCCCTGAGTGTGGGTGG - Intergenic
958764991 3:98357156-98357178 TGCCTTGCCCAGCTGGTTGGAGG - Intergenic
964344730 3:155744542-155744564 TCCCTTGCGGTGGTGGTGGGTGG - Intronic
964817401 3:160731466-160731488 TCTCTTGCCCTGGAGGGTGGAGG - Intergenic
966058489 3:175726933-175726955 TTCAATGCCCTGGTGTTGGGAGG + Intronic
966355227 3:179072174-179072196 TCCCTTAGCCTGCTGGTTGGCGG + Exonic
968881724 4:3303581-3303603 GAGCTTGCCCTGGTAGTGGGGGG + Intronic
969232303 4:5840214-5840236 TCCCTTTCCCCTGGGGTGGGAGG - Intronic
969586568 4:8097469-8097491 GCCCCTGGCCTGGTGGTGAGTGG + Intronic
972541956 4:40046943-40046965 TCGCTTGACCTAGGGGTGGGAGG + Intergenic
975743160 4:77450243-77450265 TTCCTTTCCCTGGAGGTGGTGGG - Intergenic
978153760 4:105466811-105466833 TCCCTTTCCCAAGTGCTGGGAGG - Intronic
979495846 4:121381118-121381140 TCCCTCGCCCTGAGGGTGCGGGG - Intergenic
982232790 4:153224026-153224048 TTCCTTTCCCAGGGGGTGGGAGG + Intronic
984084949 4:175298107-175298129 TGCCTTGTGCTGGTGGTGGGTGG + Intergenic
985772436 5:1821229-1821251 TACCTGGCCCTGAGGGTGGGGGG + Intergenic
986559449 5:9046191-9046213 CCCCTCACCCTGGTGGTGTGTGG - Intronic
986780557 5:11061544-11061566 TCCCTTGCCCAGATGGTGTAAGG + Intronic
987690875 5:21265320-21265342 TTCCTACCCCTGGTGGTGGTAGG + Intergenic
989323773 5:40166061-40166083 TCCCTGGCCTTAGGGGTGGGGGG - Intergenic
990374466 5:55155500-55155522 TGCATTGGGCTGGTGGTGGGTGG - Intronic
991404880 5:66292146-66292168 ACCATTGACCTGGGGGTGGGAGG - Intergenic
996793786 5:127321835-127321857 TCCCTTCCCATGGTAGGGGGAGG - Intronic
997662963 5:135603549-135603571 TCCCTGTGTCTGGTGGTGGGGGG + Intergenic
997783150 5:136680200-136680222 TCCAGTGGCCTGGTGCTGGGGGG - Intergenic
1001275728 5:170349854-170349876 TCCCTTGCCCATGTATTGGGGGG + Intergenic
1001306702 5:170579865-170579887 TCCCTTGCCTGAGTGGGGGGTGG + Intronic
1002069826 5:176672596-176672618 TCCCTTGACTTGGGGCTGGGGGG + Intergenic
1002259139 5:177982152-177982174 TCCCGTGCCCTGGGGGTGGGAGG - Intergenic
1002815796 6:678676-678698 CCCCATGCCCTGGTTCTGGGAGG - Intronic
1003980832 6:11388308-11388330 TCCCTTGACAGGGTGGTGAGTGG - Intergenic
1004306396 6:14505493-14505515 CCCTTTGCCCTGGTCCTGGGAGG + Intergenic
1005401237 6:25436671-25436693 TCCCTTCCCCCCATGGTGGGAGG + Intronic
1006151489 6:31992458-31992480 TCCCTAGCCCTGGTGGCGCTGGG + Exonic
1006157790 6:32025196-32025218 TCCCTAGCCCTGGTGGCGCTGGG + Exonic
1006173433 6:32108338-32108360 TCACGTGTACTGGTGGTGGGGGG + Intronic
1006786272 6:36669413-36669435 ACCCCTGCCCTGGTTGGGGGAGG + Intergenic
1007243783 6:40445447-40445469 TCCCTTGCCCTAGTTGGTGGGGG - Intronic
1007651535 6:43425399-43425421 TGCCCTGTCCTGGAGGTGGGGGG + Intergenic
1009867969 6:69420562-69420584 TCTGTTTCCATGGTGGTGGGTGG + Intergenic
1010041938 6:71395197-71395219 CCCCTTTCGATGGTGGTGGGTGG - Intergenic
1013543023 6:111130667-111130689 TCCAAGGCCCAGGTGGTGGGAGG - Intronic
1014260213 6:119207806-119207828 TCCCTTGGTCTGGTGGAGAGGGG + Intronic
1015751906 6:136568939-136568961 CCCCTTGGCCTGGGGGTAGGTGG - Intronic
1017052936 6:150410044-150410066 TACCCTGGCCTGGTGCTGGGTGG - Intergenic
1017886863 6:158606921-158606943 TTCCTCGCCGTGGTGGTGAGAGG + Intronic
1017994477 6:159520509-159520531 TCATTAGCCCTGGTGGTGGGTGG + Intergenic
1018845581 6:167553185-167553207 TGCATTGCCCTGGTGGTTGCCGG + Intergenic
1019134995 6:169902416-169902438 TTCCTTCCCCTGTTGGTGGGAGG - Intergenic
1019625138 7:2012074-2012096 TCCCTTCCCATGGTGGGGTGTGG - Intronic
1020177699 7:5896412-5896434 TCCCTTGCCTTTGAGGTGTGTGG - Intergenic
1023159230 7:37281422-37281444 TCCCTTTCCCTGTTTGTGGGGGG - Intronic
1025988313 7:66474764-66474786 GCCCTTGCCTTGGTGGGTGGCGG - Intergenic
1027201062 7:76064223-76064245 TCCCATGCCCTGGTGATGGGAGG + Intronic
1027211304 7:76150664-76150686 GCCCTTGCCTTGGTGGGCGGCGG - Intergenic
1028263121 7:88687517-88687539 TAGCTTGGCGTGGTGGTGGGCGG + Intergenic
1029081141 7:97974609-97974631 TCCCTTGCCTTTGAGGTGTGTGG + Intergenic
1029504207 7:100952347-100952369 TCCCTTGCAGTGGTGGTAGAGGG - Exonic
1029715516 7:102323323-102323345 CCCCGTGCCCTGGTGGTTTGGGG + Intergenic
1031075666 7:117210089-117210111 TCCCATCCCCCGGTGGTGGTGGG + Intronic
1031457241 7:121997075-121997097 TCGCATGCGCTGGTGGAGGGAGG - Intronic
1032817969 7:135496491-135496513 TCCTTTGGCTTGGTGGTGTGAGG - Intronic
1034339979 7:150346717-150346739 TAGCTTGCCCTGGCGGTAGGAGG + Intergenic
1034534442 7:151718255-151718277 CGCCTTCCCATGGTGGTGGGTGG + Intronic
1035560287 8:599226-599248 TCTATGGACCTGGTGGTGGGGGG - Intergenic
1036404012 8:8438537-8438559 TCCTTTCCTCTGGTGTTGGGTGG - Intergenic
1036705566 8:11043680-11043702 TCCCTTGGCCAAGAGGTGGGTGG - Intronic
1036980474 8:13464586-13464608 TCCATTTCCATGGTGGCGGGGGG - Intronic
1037154531 8:15684192-15684214 TACCTTGCCCCAGGGGTGGGTGG + Intronic
1037907518 8:22724237-22724259 TCCCTGGCCCTGGTGGCAGGAGG + Intronic
1040540317 8:48347824-48347846 TCCCTTGCACTGGTGGAGCAAGG - Intergenic
1048669001 8:136695550-136695572 GCCCCTGCCCTAGTGGTGCGTGG + Intergenic
1049725429 8:144143470-144143492 GCGCTTGCCCTGCAGGTGGGAGG + Intergenic
1049745311 8:144260758-144260780 TTCCTGGACCAGGTGGTGGGCGG + Exonic
1049791267 8:144473763-144473785 TACATGGTCCTGGTGGTGGGGGG - Exonic
1050362562 9:4844593-4844615 TCCCTGGCCCTGGGGGTTGGAGG - Exonic
1050395282 9:5188728-5188750 TCCCTTCCCATGGGAGTGGGTGG + Intergenic
1050526983 9:6554778-6554800 GCCCTTGCCTTTGTGGTAGGTGG - Exonic
1050577333 9:7010896-7010918 TCGCTAGGCATGGTGGTGGGTGG + Intronic
1052664053 9:31471834-31471856 TGCCTTTCCCTGGTGCTGGCTGG - Intergenic
1054810277 9:69428771-69428793 TCCCTTGCCCCAGTGGTAGTGGG + Exonic
1056743053 9:89276542-89276564 TCCCTTGCCCTGGAGATCTGTGG - Intergenic
1056938556 9:90936530-90936552 CCACTTCCCCTGGGGGTGGGTGG - Intergenic
1057786396 9:98090939-98090961 TCACTGCCCCTGGTGTTGGGAGG - Intronic
1058309660 9:103484936-103484958 TCCCATGCCCTAGTGGTCTGAGG + Intergenic
1059251543 9:112891156-112891178 GCCCCTGCCCCGGTGGTGGGGGG - Intergenic
1060242401 9:121915095-121915117 TCACTGGCAGTGGTGGTGGGAGG + Intronic
1060758943 9:126232824-126232846 TCCCTTGCCCTGAACTTGGGAGG - Intergenic
1061008669 9:127942705-127942727 TCCCTTGCCCTGGTGGTGGGGGG - Exonic
1061659062 9:132116216-132116238 TGCCTGGCCCTGGGGGAGGGTGG - Intergenic
1061790591 9:133057023-133057045 CCCCTGGCCCTGGTGGGAGGAGG + Intronic
1061794317 9:133076163-133076185 AGCCTTGCTCTGGAGGTGGGGGG + Intronic
1062386614 9:136314377-136314399 TGCCCTGCCCCCGTGGTGGGGGG - Intergenic
1062397918 9:136359936-136359958 TCCCTCCCCCGGGTGCTGGGTGG - Intronic
1062521261 9:136958949-136958971 TCTCTGGCCCTGGTGGTAGCGGG + Intergenic
1062523502 9:136969259-136969281 TCCAGAGCGCTGGTGGTGGGTGG - Exonic
1062581184 9:137229955-137229977 GCCCTTGCTCTGGGGGTGGGGGG - Intergenic
1062633490 9:137478046-137478068 GCCATTGCCCTGGTGCTTGGGGG - Exonic
1185457036 X:316450-316472 TCACTTGCCCAGGTGGGGGTCGG - Intronic
1186039877 X:5464006-5464028 TCCCTTGACCTAGTTTTGGGGGG + Intergenic
1187170191 X:16843522-16843544 CTCATTTCCCTGGTGGTGGGGGG + Exonic
1187958464 X:24544227-24544249 TCCTCTGCCCTGGGGGTGGCCGG + Intergenic
1189991161 X:46596430-46596452 TCCCTGGGTCTGGGGGTGGGGGG + Intronic
1190160639 X:48029169-48029191 CCCCTTCCCCTGCTGGTGTGGGG + Intronic
1191892759 X:65961542-65961564 TCCCTTGTCCTGTTATTGGGTGG + Intergenic
1195200577 X:102546856-102546878 TTCTTCGCCCTGGTGGGGGGCGG + Intergenic
1195238471 X:102926402-102926424 ACCCTTGCCCTGGTGACTGGTGG + Intergenic
1198575265 X:138003869-138003891 TCTCTTTCCATGGTGGTGGTGGG - Intergenic
1199338516 X:146647768-146647790 ACCCTTGCCCTTGTTCTGGGAGG - Intergenic
1200031311 X:153298143-153298165 TCCCTTTCCTGGGTGCTGGGAGG - Intergenic
1200134122 X:153866689-153866711 TCCCTTGCCCTGGCTGTTGACGG + Exonic