ID: 1061010135

View in Genome Browser
Species Human (GRCh38)
Location 9:127949876-127949898
Sequence CCCCGGGGGCAGGTTTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061010135_1061010146 15 Left 1061010135 9:127949876-127949898 CCACTGGAAACCTGCCCCCGGGG 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1061010146 9:127949914-127949936 ATTTTCACTGATAATCCACTGGG No data
1061010135_1061010147 16 Left 1061010135 9:127949876-127949898 CCACTGGAAACCTGCCCCCGGGG 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1061010147 9:127949915-127949937 TTTTCACTGATAATCCACTGGGG No data
1061010135_1061010148 17 Left 1061010135 9:127949876-127949898 CCACTGGAAACCTGCCCCCGGGG 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1061010148 9:127949916-127949938 TTTCACTGATAATCCACTGGGGG No data
1061010135_1061010145 14 Left 1061010135 9:127949876-127949898 CCACTGGAAACCTGCCCCCGGGG 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1061010145 9:127949913-127949935 CATTTTCACTGATAATCCACTGG No data
1061010135_1061010149 22 Left 1061010135 9:127949876-127949898 CCACTGGAAACCTGCCCCCGGGG 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1061010149 9:127949921-127949943 CTGATAATCCACTGGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061010135 Original CRISPR CCCCGGGGGCAGGTTTCCAG TGG (reversed) Intronic
903500758 1:23799071-23799093 CTTAGGGGGCAGGATTCCAGTGG - Intronic
903762160 1:25706406-25706428 CCCCTAAGGCAGGTCTCCAGTGG - Intronic
904662506 1:32095741-32095763 CCCCTAGGACAGGTTTGCAGAGG + Intronic
905803944 1:40862496-40862518 CCCAAGGGGCGGGGTTCCAGTGG - Intergenic
907051116 1:51330436-51330458 CCCCGCGGGCAGGGCTCCTGGGG + Intronic
908774306 1:67625556-67625578 CCCCGGTGGCCTGTTCCCAGTGG - Intergenic
915977497 1:160400650-160400672 CCCCGGGGGCTGGGGGCCAGGGG - Exonic
916653220 1:166849846-166849868 CCCCCGGGGAAGTTTCCCAGTGG + Exonic
920198941 1:204247531-204247553 CCCTGGGGCCAGGGTACCAGAGG + Intronic
923048924 1:230376575-230376597 CCCTGGGGGCAGCTCTGCAGAGG - Intronic
924117752 1:240763979-240764001 GCCCAGAGGCCGGTTTCCAGCGG + Intergenic
1077242750 11:1519310-1519332 GTCCTGGGGCAGGTGTCCAGTGG - Intergenic
1077269051 11:1666516-1666538 GCCCGGCTGCAGGGTTCCAGCGG - Intergenic
1077271497 11:1684199-1684221 GCCCGGCTGCAGGGTTCCAGCGG + Intergenic
1077485996 11:2838723-2838745 CCACGGGGGCAGGTGGGCAGGGG - Intronic
1077532081 11:3102063-3102085 CCCCGAGGGCCGGCTTCCAGGGG - Intronic
1078073937 11:8140111-8140133 CTCCTGGGGCTCGTTTCCAGAGG - Exonic
1079110693 11:17603513-17603535 CACTGGGGGCAGGATGCCAGAGG + Intronic
1083747012 11:64742385-64742407 CCCCGGGGTCAAGAATCCAGAGG + Intronic
1084007587 11:66331512-66331534 CCCCAGGGCCTGATTTCCAGGGG + Intronic
1086448065 11:86888900-86888922 CCCCGGCAGCAAGTTCCCAGGGG - Intronic
1090264958 11:125348015-125348037 GCCCGGGGCTAGGTTTGCAGGGG + Intronic
1090267386 11:125361865-125361887 CCCTGCAGGCAGGTTTCCTGTGG + Intronic
1091289436 11:134429259-134429281 CCCCGGGGGAAGGTTAGCACGGG + Intergenic
1092056403 12:5511759-5511781 CCCCCTGGGCTGCTTTCCAGGGG - Intronic
1092070786 12:5629699-5629721 CTGCGGGGGTAGGATTCCAGTGG - Intronic
1092233174 12:6789174-6789196 CCCTGAGGGCATGTGTCCAGTGG - Intronic
1092579288 12:9821005-9821027 CCCTGGGGAGAGGCTTCCAGAGG + Intergenic
1094374410 12:29774967-29774989 CCCATGGGGCAGCTTTCCTGTGG - Intronic
1105413681 13:20192214-20192236 CCCCGGGGCCAAGATTTCAGTGG - Intronic
1107449748 13:40497774-40497796 CCCCCAGGGCACCTTTCCAGAGG - Intergenic
1108596030 13:51950323-51950345 CCCTGGGGGAAAGTTTCCAGTGG - Exonic
1109405373 13:61891396-61891418 CCCAGAGGGAAGGTTTCAAGAGG - Intergenic
1110506488 13:76293864-76293886 CCCTATGGGGAGGTTTCCAGTGG - Intergenic
1113564848 13:111313551-111313573 CACCGGGGGCAGGAATCCTGTGG + Intergenic
1113765199 13:112876827-112876849 ACCCGGGGGCTGGCTCCCAGCGG + Intronic
1115396067 14:32909710-32909732 CCCCAGGGGCATGCTCCCAGGGG + Intergenic
1116941837 14:50798383-50798405 CCCAGGAGGAAGGCTTCCAGGGG + Intronic
1121224188 14:92309366-92309388 CCGAGGGGGCGGGCTTCCAGGGG - Intergenic
1121967339 14:98322625-98322647 CCCAGGCAGCATGTTTCCAGAGG - Intergenic
1122905939 14:104801575-104801597 CCCCAGGGGCAGGGTTCCCCGGG - Exonic
1124244674 15:28058833-28058855 TCCAGGGGGCAGGTGTGCAGGGG + Intronic
1125482589 15:40090848-40090870 CATCGGGGGCAAGTTTGCAGTGG - Exonic
1125787323 15:42331591-42331613 CCACAGGGCCAGGTTTTCAGGGG - Intronic
1128555567 15:68629475-68629497 CCCCAGAGGCAGATTTACAGAGG + Intronic
1130969399 15:88720404-88720426 TTGCGGGGGAAGGTTTCCAGTGG - Intergenic
1132031923 15:98445379-98445401 CCCCAGTGGCAGTTTGCCAGTGG - Intronic
1132615707 16:840306-840328 CCCTGGGGGCAGGTTGGCAGGGG - Intergenic
1141699558 16:85636171-85636193 CCCCGGGGGCATCTTTCCTGGGG - Intronic
1142494650 17:299885-299907 CCTAGGGGGCAGGTGTCCCGGGG + Intronic
1143732923 17:8891080-8891102 TCCAGGGTCCAGGTTTCCAGGGG + Intronic
1143754649 17:9057458-9057480 CCCCGGGGTTTGCTTTCCAGGGG + Intronic
1146649382 17:34597289-34597311 CCCTTGGGGCAGGGCTCCAGGGG + Intronic
1146651908 17:34612333-34612355 CTCCAGGGGCAGGTGCCCAGAGG + Intronic
1147637597 17:41973614-41973636 CCCCCGCGGCAGGTTGTCAGTGG - Exonic
1149666215 17:58366428-58366450 CCCTGGGGGCATGCCTCCAGAGG - Intronic
1151347532 17:73511390-73511412 CCCAGTGAGCAGGTTTACAGAGG - Intronic
1151437136 17:74104820-74104842 CCCCGGGGGCAGGGGCCCAGGGG + Intergenic
1151565202 17:74893700-74893722 CCCCGGGGGCGGGTGTCCCCAGG - Intronic
1151981291 17:77510776-77510798 CCACCGGGGAAGGTTCCCAGAGG + Intergenic
1152816344 17:82410283-82410305 CCTCGGGGGCAGGCTCCCTGGGG + Intronic
1155992428 18:32292700-32292722 CCATGAGGGCAAGTTTCCAGAGG + Intronic
1159004181 18:62998295-62998317 TCCCGAGGGGAGGTCTCCAGTGG + Intergenic
1160021506 18:75185257-75185279 CCCTGAGGGCTGGTTTCCAGGGG + Intergenic
1161206979 19:3046595-3046617 CCCCGGTGGCAGGACTCTAGCGG - Intronic
1161346788 19:3772190-3772212 CCGCTGGGGCAGGTGTCCCGTGG - Exonic
1161772161 19:6236735-6236757 CCCAGGAGGCTGGTTTCCAGGGG - Intronic
1162533194 19:11247605-11247627 CCCCGGGGGCTGGTGTGGAGGGG + Intronic
1163203791 19:15787597-15787619 CCCCAGTGGCACGTTCCCAGAGG - Intergenic
1165312038 19:35034281-35034303 CCCCCGGGGCAGGAGTGCAGAGG - Intronic
1165708612 19:37993765-37993787 CCACGGGGACAGGTTTCCCAAGG + Intronic
1166319377 19:42006848-42006870 CCACGGGGGCAGGTCAGCAGGGG - Intronic
1167136425 19:47618867-47618889 CCCCGGAGCCACCTTTCCAGAGG + Intronic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
934563662 2:95326671-95326693 CCCCTGGGCCAGGTGGCCAGAGG - Intronic
937674446 2:124574177-124574199 CCCCGGTGGCAGGTTGCGGGGGG + Intronic
937934386 2:127230922-127230944 GCCCAGGGACAGGCTTCCAGAGG + Intergenic
940497102 2:154445288-154445310 CCCTGGGGTCATGTTTCCAGAGG + Intronic
940906581 2:159175128-159175150 ACCCGGTGGCAGCTTTCAAGAGG + Exonic
940954406 2:159712333-159712355 CCCCGGGGGCAGCTCTTCAACGG + Intergenic
947365876 2:229394465-229394487 CTTTGGGGGCAGGTTTGCAGAGG + Intronic
948601180 2:239108239-239108261 ACCCGGGGGCAGCCTGCCAGTGG - Intronic
948625378 2:239265121-239265143 CCCCTGGGGCGGGTTCACAGTGG - Intronic
948889232 2:240898721-240898743 CAGCAGGGGCATGTTTCCAGGGG + Intergenic
1170136272 20:13076863-13076885 CCCAGGAGGCAGGTTCCCGGAGG + Intronic
1170719131 20:18859858-18859880 CACCGGGTGCAAGTTGCCAGTGG - Intergenic
1170855745 20:20052358-20052380 TGCCGGGGACAGGTGTCCAGAGG - Exonic
1173817368 20:45998324-45998346 TGCCCGGGGGAGGTTTCCAGTGG + Intergenic
1175392160 20:58634369-58634391 CCCAGGGGTCAGGTCTTCAGAGG + Intergenic
1178856576 21:36255205-36255227 CCCCAGGGGCGGGGTTGCAGTGG - Intronic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1179655502 21:42842042-42842064 CCCCGGGGTCAGGTGGCCACAGG - Intergenic
1179985638 21:44919151-44919173 CCCCGGGGTCAGGTGGCCACAGG + Intronic
1182982701 22:34686495-34686517 CCCCAAGCCCAGGTTTCCAGAGG - Intergenic
1183075800 22:35426082-35426104 ACCCTGGGGTAGGTTCCCAGGGG + Intergenic
1183620337 22:38968345-38968367 CTCCTGGGGCAGGTGTGCAGGGG + Intronic
1183650906 22:39152757-39152779 CCCCGGGGGCGGGGTTCCGATGG - Intergenic
1184033973 22:41910024-41910046 GCCCAGGGGCAGGCGTCCAGCGG + Exonic
1184232776 22:43167598-43167620 CCTCGGGAGCAGGGTTCCACCGG - Exonic
1185067426 22:48639210-48639232 GCCCGGGGGCAGGTCCCCAACGG - Intronic
952965496 3:38618525-38618547 TCCCGGTGGCGGGTTTCCAGCGG + Intronic
953541976 3:43828384-43828406 CTCTGGGGGCAGCTGTCCAGGGG + Intergenic
953982660 3:47420417-47420439 CCCCAGAGCCAGGCTTCCAGGGG + Intronic
961204547 3:125071195-125071217 CCCCAGTGGCAGGTCTTCAGGGG + Intergenic
961244337 3:125438278-125438300 CCCCATGGGCTTGTTTCCAGTGG + Intergenic
963598507 3:147357499-147357521 TCCCGTGGGCAGGTTACCTGGGG - Intergenic
963788582 3:149559955-149559977 CCTCAGGGGCAGCTATCCAGTGG - Intronic
968447255 4:658106-658128 CGGCGGGGGCAGGTCACCAGGGG + Intronic
968704357 4:2071063-2071085 CCCCGGGAGCACATTTCCAGGGG + Intergenic
969622508 4:8285801-8285823 CCCCGAGGGCAGGGGTGCAGAGG - Intronic
969964973 4:10984705-10984727 ACCTGAGGGCAGGTTTCTAGGGG - Intergenic
972475567 4:39446549-39446571 CACCGCGGACAGGTTGCCAGTGG - Exonic
972574386 4:40338567-40338589 CCCTGGGTGGAGGCTTCCAGTGG + Intronic
975509785 4:75181311-75181333 CCCCGGGGGCAGAATTCCACTGG + Intergenic
977114883 4:93011485-93011507 GCATGGGGGCTGGTTTCCAGGGG - Intronic
984595816 4:181666828-181666850 CCCCAGGTGCAGGTAGCCAGGGG - Intergenic
985548942 5:523767-523789 CCCCGGGGCCGGGTTTCCTTCGG - Intronic
985995872 5:3596501-3596523 GTCCGGGGGCAGGTTCCCGGTGG + Intronic
987162253 5:15156314-15156336 CCCAGGGAGCATATTTCCAGAGG + Intergenic
987831695 5:23103827-23103849 CCCAGGGTGGAGGCTTCCAGGGG - Intergenic
991509850 5:67364574-67364596 CCCCTGGGACAGGTTTCCACTGG + Intergenic
993152189 5:84174870-84174892 CCCCAGGGCCAGGTATGCAGAGG - Intronic
994560722 5:101367458-101367480 CCCCGAGGCCCAGTTTCCAGAGG + Intergenic
997978458 5:138454127-138454149 CCTCGGGAGCAGGATTCCACAGG - Intergenic
1005013269 6:21355883-21355905 CCCTGGGGCCAGGTATGCAGAGG + Intergenic
1005955419 6:30660049-30660071 CCCCGGACGCAGGTTTCCTGTGG - Exonic
1007167776 6:39841038-39841060 CTCCAGGGGCAGGGTTCCAGGGG + Intronic
1007167913 6:39841366-39841388 TCCCAGGGGGAGGGTTCCAGGGG + Intronic
1013196406 6:107848454-107848476 CCCCGGAGTCCGGATTCCAGCGG - Intergenic
1013364993 6:109430368-109430390 GCCAGTGGGGAGGTTTCCAGTGG - Intronic
1013769664 6:113613722-113613744 CTCCGGGGTCAGGTGGCCAGAGG - Intergenic
1014745401 6:125194540-125194562 GCCTGGGGTCAGGGTTCCAGGGG - Intronic
1017845882 6:158257968-158257990 CCACGGGAGCAGGTTCCAAGGGG + Intronic
1018112124 6:160546132-160546154 CCCCAGGGGCTGGTTGCCAAGGG + Intronic
1019564249 7:1671707-1671729 CCCAGGGGGCAGGAGGCCAGGGG - Intergenic
1022478952 7:30730583-30730605 TTCCAGGGGCAGGTTTGCAGAGG - Intronic
1022506517 7:30911346-30911368 CCCCGGGCCCAGGGCTCCAGAGG - Intergenic
1024565680 7:50678079-50678101 CCCCGGGGGCTGCTTGCCTGGGG - Intronic
1026969845 7:74461159-74461181 CCCCGGGGGCAGGTCTGTGGTGG + Intronic
1030441650 7:109595334-109595356 GCCCTGGGGCAGAGTTCCAGGGG + Intergenic
1032080409 7:128855873-128855895 CCAGGGGGCCAGGTGTCCAGGGG + Intronic
1032388525 7:131540760-131540782 GCCCTGGTGGAGGTTTCCAGAGG - Intronic
1035344969 7:158191851-158191873 CCCCCGGGGCAGGCTTGCCGGGG + Intronic
1039472440 8:37821780-37821802 CCCCGGGGGCTGGTATGCAGGGG + Intronic
1041979271 8:63837148-63837170 TCCAGGGTGCAGGATTCCAGAGG + Intergenic
1047333978 8:123919002-123919024 CCCCTGGGGCAGGATCCCACTGG - Intronic
1049385248 8:142339870-142339892 CCCCCGGCGCAGCTGTCCAGAGG - Intronic
1049465513 8:142749619-142749641 CCCAGGGGTCAGGTGCCCAGGGG - Intergenic
1049611089 8:143555653-143555675 CCCAGGGCGCTGGCTTCCAGGGG + Intronic
1051540303 9:18208349-18208371 CCCTGGTGGCAGGATTCCTGAGG + Intergenic
1053288450 9:36864713-36864735 CCCTGGCGGCAGGCTCCCAGGGG - Intronic
1057197022 9:93120984-93121006 CCCGGGAGCCAGGTTTCCACTGG + Intergenic
1057204524 9:93163306-93163328 CCCCGGGGTCACACTTCCAGTGG + Intergenic
1057600202 9:96450685-96450707 TCCCGGGGGCCGGTTTCAGGAGG + Intronic
1059779076 9:117507864-117507886 CCCTGGGGTAAGGCTTCCAGAGG - Intergenic
1061010135 9:127949876-127949898 CCCCGGGGGCAGGTTTCCAGTGG - Intronic
1061199843 9:129131452-129131474 CCCAGTGGGCAGGTGCCCAGGGG - Intronic
1061449758 9:130661625-130661647 CCCCGGGAGGAGATTTCGAGGGG - Intergenic
1061633081 9:131885918-131885940 CCCCCAAGGCAGGTTCCCAGAGG - Intronic
1062252091 9:135603358-135603380 CCCAGGGGGAGGGTGTCCAGAGG - Intergenic
1062414594 9:136441847-136441869 CCCTGGGGGCAGGCATGCAGAGG - Intronic
1062478479 9:136741041-136741063 ACCCAGGTGCAGGTGTCCAGAGG + Intronic
1062589555 9:137267228-137267250 CCCCGGGCGCAGGTTTCTGCAGG + Exonic
1189652239 X:43203184-43203206 CCCTGGGACAAGGTTTCCAGAGG - Intergenic
1190316672 X:49156266-49156288 CCCAGGGGGCAGGTTCGGAGAGG - Intergenic
1192473563 X:71420117-71420139 CCCCGGGGTCACGTCTACAGAGG - Intronic
1193749772 X:85327167-85327189 TCCTGCTGGCAGGTTTCCAGAGG + Intronic
1193935343 X:87611824-87611846 TCCCAGTGGCAGGTTTCTAGGGG - Intronic