ID: 1061011519

View in Genome Browser
Species Human (GRCh38)
Location 9:127958061-127958083
Sequence CAGTGCCAAAATAATTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061011516_1061011519 14 Left 1061011516 9:127958024-127958046 CCAACCTTCACTTTTATGGTCAA 0: 1
1: 0
2: 1
3: 6
4: 188
Right 1061011519 9:127958061-127958083 CAGTGCCAAAATAATTCAGTGGG No data
1061011517_1061011519 10 Left 1061011517 9:127958028-127958050 CCTTCACTTTTATGGTCAATTGA 0: 1
1: 10
2: 93
3: 292
4: 736
Right 1061011519 9:127958061-127958083 CAGTGCCAAAATAATTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061011519 Original CRISPR CAGTGCCAAAATAATTCAGT GGG Intronic
No off target data available for this crispr