ID: 1061012191

View in Genome Browser
Species Human (GRCh38)
Location 9:127962266-127962288
Sequence GACACTCCAGTGGCCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 264}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061012191_1061012202 22 Left 1061012191 9:127962266-127962288 CCACCTCTGGCCACTGGAGTGTC 0: 1
1: 0
2: 1
3: 20
4: 264
Right 1061012202 9:127962311-127962333 AGAAAAGAAAGGATGAAGATGGG No data
1061012191_1061012200 11 Left 1061012191 9:127962266-127962288 CCACCTCTGGCCACTGGAGTGTC 0: 1
1: 0
2: 1
3: 20
4: 264
Right 1061012200 9:127962300-127962322 GTGAGTAGGGAAGAAAAGAAAGG No data
1061012191_1061012201 21 Left 1061012191 9:127962266-127962288 CCACCTCTGGCCACTGGAGTGTC 0: 1
1: 0
2: 1
3: 20
4: 264
Right 1061012201 9:127962310-127962332 AAGAAAAGAAAGGATGAAGATGG No data
1061012191_1061012203 27 Left 1061012191 9:127962266-127962288 CCACCTCTGGCCACTGGAGTGTC 0: 1
1: 0
2: 1
3: 20
4: 264
Right 1061012203 9:127962316-127962338 AGAAAGGATGAAGATGGGCATGG No data
1061012191_1061012198 -3 Left 1061012191 9:127962266-127962288 CCACCTCTGGCCACTGGAGTGTC 0: 1
1: 0
2: 1
3: 20
4: 264
Right 1061012198 9:127962286-127962308 GTCTGGAGATTGGGGTGAGTAGG No data
1061012191_1061012199 -2 Left 1061012191 9:127962266-127962288 CCACCTCTGGCCACTGGAGTGTC 0: 1
1: 0
2: 1
3: 20
4: 264
Right 1061012199 9:127962287-127962309 TCTGGAGATTGGGGTGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061012191 Original CRISPR GACACTCCAGTGGCCAGAGG TGG (reversed) Intronic
900316079 1:2057093-2057115 GAGGCTCCAGTGGCCAGCGTAGG + Intronic
901090511 1:6637734-6637756 GACCCTCCGGTGGCCACCGGTGG + Intronic
902384275 1:16067509-16067531 GTCACTCTTGTGGACAGAGGAGG - Intronic
902583220 1:17422517-17422539 GCCTCCCCAGTGGCCATAGGAGG - Intronic
902697724 1:18151518-18151540 CACATTCTAGTGGCCAGAGCAGG + Intronic
903774329 1:25783061-25783083 CACACTGCAGAGGCCACAGGAGG - Intronic
903812990 1:26045410-26045432 GGCCCTTCAGAGGCCAGAGGAGG + Intronic
903840289 1:26234123-26234145 GACTCCCGATTGGCCAGAGGCGG + Intergenic
904285737 1:29452286-29452308 GACACCACAGTGGACAGAAGAGG - Intergenic
904419684 1:30383739-30383761 GACACCACAGTGGACAGAAGAGG + Intergenic
906458378 1:46018164-46018186 GACACACCAGTAGGAAGAGGTGG - Intronic
909445427 1:75743557-75743579 GACAAGCCAGTGGCTATAGGAGG - Intronic
917878210 1:179306285-179306307 GACCCTCCAGTGGGCCCAGGAGG + Intronic
918138527 1:181700114-181700136 GGCACTCCAATGTCTAGAGGAGG + Intronic
918238048 1:182599195-182599217 AACACTGGAGTGGGCAGAGGTGG - Exonic
918251633 1:182708344-182708366 GACACTGCAGGGGCCAGCGGGGG - Intergenic
921363222 1:214349881-214349903 AACACTGCAGTTGTCAGAGGTGG + Exonic
922202536 1:223418340-223418362 AACACTCCACTCCCCAGAGGTGG + Intergenic
923329437 1:232909132-232909154 GACACAGCAGTGGGAAGAGGTGG - Intergenic
923337974 1:232986305-232986327 GACACTCAGGTGGCCGGTGGTGG + Exonic
923706394 1:236348092-236348114 GAGAGTCCAGAGGTCAGAGGAGG + Intergenic
1063372243 10:5529458-5529480 GTCACTCCAGCTGCCAGGGGTGG + Intergenic
1063452797 10:6162899-6162921 GACACTCCGGTAGCAAGAAGAGG - Intronic
1063463403 10:6228606-6228628 GACACTCCTGGGGCAGGAGGGGG - Intronic
1065780200 10:29160202-29160224 CACACTCCTGTTGCCAGAGCTGG + Intergenic
1066998906 10:42587940-42587962 GGCACTCCAGTTGCCTAAGGAGG - Intronic
1067142001 10:43666161-43666183 GACTCTGCAGAGCCCAGAGGTGG + Intergenic
1067163409 10:43845793-43845815 GACATTGCAGTGGCAAAAGGAGG + Intergenic
1067468191 10:46517093-46517115 GACACTCCCGGGGCGAGGGGAGG - Intergenic
1069486044 10:68824290-68824312 GAGGCTACAGTGGGCAGAGGTGG + Intergenic
1072578337 10:96720097-96720119 GACACTCCTAGGGCCAGAGGTGG + Intronic
1072616110 10:97049705-97049727 GTCACTCCTGTGGCCTGGGGTGG - Intronic
1073440853 10:103551881-103551903 TTCACTCAAGTGGCCAGAGTTGG + Intronic
1074218000 10:111406850-111406872 GTCACTGCAGTGGCTAAAGGTGG + Intergenic
1074352269 10:112749191-112749213 GCCAGTCCAGTGGCCTTAGGTGG + Intronic
1075835363 10:125448358-125448380 CACAAACAAGTGGCCAGAGGTGG - Intergenic
1075855697 10:125627825-125627847 GGCACTGCAGAGCCCAGAGGAGG + Intronic
1076472754 10:130730124-130730146 GAAACTGCAGTGGACAGAGCTGG + Intergenic
1076638240 10:131897352-131897374 AACACCCCTGTGGCCAGGGGGGG + Intergenic
1076888003 10:133271359-133271381 GGCACCCCAGTGGTCAGGGGAGG - Intronic
1077104844 11:837731-837753 GTCACCCCAGTGGCCGGATGTGG + Intronic
1077114001 11:874934-874956 CACACTCCTGAGGCCAGAGCCGG - Intronic
1077279079 11:1733873-1733895 GGGAGTCCAGTGGACAGAGGTGG - Exonic
1078465882 11:11549959-11549981 TAAGCTCCAGTGGCCAGAGCTGG - Intronic
1083105036 11:60349234-60349256 GACTCTCCAGTAGGCAGAGTCGG + Intronic
1083119696 11:60499183-60499205 GACAGTGCAGGGGCCACAGGTGG + Intronic
1086424282 11:86669127-86669149 GGCACTCCAGTGGGAAGAGAAGG + Intronic
1086576403 11:88343033-88343055 GACTCTCCAGAGTCTAGAGGTGG + Intergenic
1089890033 11:121871566-121871588 GACACTCCAAAGGCAAGAAGGGG - Intergenic
1090404211 11:126467421-126467443 GGCTCTCCACTGCCCAGAGGAGG - Intronic
1091601787 12:1922353-1922375 GACACTGCAGTGGCCAGGGCTGG + Intergenic
1093539252 12:20261447-20261469 CAAGCTCCAGTGGCCAGGGGTGG + Intergenic
1094487903 12:30939383-30939405 GAGGTGCCAGTGGCCAGAGGTGG + Intronic
1095290283 12:40471494-40471516 GCCATTTCAGTGGCCAGAGATGG - Intronic
1100799207 12:98213589-98213611 AATACTCCAGTGGCAAGAGCAGG + Intergenic
1101495894 12:105253929-105253951 CACACCCCTGAGGCCAGAGGAGG + Intronic
1105891589 13:24686146-24686168 GACATTACAGGGGCCAGACGTGG + Intronic
1105923380 13:24985130-24985152 GACACAGCAGTGACCAGAGATGG - Intergenic
1107700336 13:43040980-43041002 GACATTCCATTGCCCAGAGATGG + Intronic
1112386536 13:98945477-98945499 GACACTAGAGGGCCCAGAGGAGG - Intronic
1112445640 13:99462124-99462146 GATCCTCCACTGACCAGAGGAGG + Intergenic
1112629987 13:101149953-101149975 GACACTGCTGTGGCCAAGGGAGG - Intronic
1115923178 14:38400948-38400970 GACATTCCAGGGGACAGAGCAGG + Intergenic
1118613503 14:67559673-67559695 GACACTCAAGTTGGCAAAGGTGG + Exonic
1118709339 14:68506843-68506865 CACACTCAAGTGTGCAGAGGGGG + Intronic
1118719469 14:68583959-68583981 GCCACTCCAGTCACCAGATGAGG + Intronic
1119264982 14:73259266-73259288 TAGACTCCAGAGGCCAGTGGTGG + Exonic
1119471274 14:74901207-74901229 GACAGGCCAGTGGCTATAGGAGG + Exonic
1120827648 14:88969922-88969944 GAAAGTCCAGTGGCCAGAGCTGG - Intergenic
1121011502 14:90522780-90522802 CACACTCCAGAGGCCAGGGAAGG - Intergenic
1121080268 14:91102481-91102503 GACAGTCCCGGGGCCGGAGGAGG - Intronic
1121220192 14:92279204-92279226 GACACCCCAGGGGACAGAGAGGG + Intergenic
1122611592 14:102987090-102987112 GAGACGGCAGTGGCCAGACGAGG + Intronic
1122706545 14:103625532-103625554 GACACTCCCGTGGCAGGTGGGGG - Intronic
1122722207 14:103728402-103728424 GGGACGGCAGTGGCCAGAGGTGG - Intronic
1122762504 14:104039680-104039702 GACGTGCCAGTGGTCAGAGGAGG + Intronic
1127390592 15:58502126-58502148 GACACTACAGTTCCCAGAGTGGG + Intronic
1127566408 15:60193514-60193536 GCTACTCCAGGGGCCTGAGGTGG - Intergenic
1127809277 15:62549423-62549445 TAAACTTCAGTGGCCAGGGGCGG - Intronic
1128768410 15:70264986-70265008 GCAGCTCAAGTGGCCAGAGGAGG - Intergenic
1129117224 15:73371156-73371178 AACAGTCCAGGGGACAGAGGAGG + Intergenic
1129774469 15:78226927-78226949 GACACACCATTGGCCAGGGGTGG + Intronic
1129903321 15:79168517-79168539 GACAGTCCAGAGTCAAGAGGAGG + Intergenic
1131171203 15:90179541-90179563 GACAAGGAAGTGGCCAGAGGTGG + Intronic
1132004330 15:98213038-98213060 GACCCTCCAGTGGCCACTTGGGG + Intergenic
1132246484 15:100300183-100300205 GACACTCCAGAGGCCTCTGGAGG - Intronic
1133126278 16:3648270-3648292 GCCACTGCAGTGGCCGGATGCGG + Intronic
1133518485 16:6532871-6532893 GGCACTCAAGGGGCCAGAGAAGG - Intronic
1134264539 16:12681902-12681924 TACTCTCCAGGGGCTAGAGGTGG + Intronic
1134478425 16:14596299-14596321 GAAGCTCCAATGGCCAAAGGTGG + Intronic
1135158018 16:20070953-20070975 GCCCCACCAGTGACCAGAGGAGG - Intronic
1135508308 16:23058734-23058756 GACCCTCCTGGGGTCAGAGGAGG - Intergenic
1137502271 16:49020538-49020560 GACACTACATTGGCCATAGTGGG + Intergenic
1138526492 16:57610772-57610794 GACACTCCAGTGACAAGCTGTGG - Intronic
1139532986 16:67552560-67552582 GAATCCCCAGGGGCCAGAGGGGG + Intergenic
1141786391 16:86203624-86203646 GACACTCCAGAGGACACCGGTGG + Intergenic
1142014811 16:87739666-87739688 TTCACTCCCGTGGCCAGATGAGG - Intronic
1142234235 16:88914271-88914293 GACAGCGCAGTGACCAGAGGGGG + Intronic
1142279693 16:89141451-89141473 GACAAGACACTGGCCAGAGGAGG + Intronic
1142337940 16:89502322-89502344 GACTCTAGAGAGGCCAGAGGTGG - Intronic
1142504167 17:352350-352372 AACACCCCAGTGGACAGAGATGG - Intronic
1143013544 17:3879551-3879573 AAGCCTCCAGTGGGCAGAGGAGG - Intronic
1143376916 17:6472415-6472437 CACACTCCTGTGGCCAGGGCTGG - Intronic
1143490106 17:7281322-7281344 GAAACTCCAGCGGCCTGAGACGG - Intergenic
1143723554 17:8830365-8830387 ACCACTCCAGTGGCCCGCGGTGG + Intronic
1145269727 17:21398347-21398369 AAGGCTCCAGTGGCCAGAGGAGG - Intronic
1145781956 17:27569255-27569277 GACACACCAGTGCCCAAAGCTGG + Intronic
1146629272 17:34458402-34458424 GACACCCCAGGGGCCAGAAATGG - Intergenic
1149443039 17:56691142-56691164 CACAGGCCAGTGGCCACAGGAGG + Intergenic
1150413816 17:64970532-64970554 CACACTTGATTGGCCAGAGGGGG - Intergenic
1150613750 17:66753358-66753380 TGCACTCCTGTGGCCAGTGGAGG + Intronic
1150797824 17:68253158-68253180 CACACTTGATTGGCCAGAGGGGG + Intronic
1151877969 17:76878108-76878130 GACAGTCCCGGGGCCAGTGGTGG + Intronic
1152153479 17:78617482-78617504 GAAACTCCAGAAGCCAGAGCTGG + Intergenic
1152883711 17:82835305-82835327 CACACGCCAGGGGCCAGGGGTGG + Intronic
1153577277 18:6535338-6535360 GACCCTCCAGTGGTTAGATGTGG - Intronic
1153925393 18:9831282-9831304 GAAACCCCAGTGGCCAAAGTTGG - Intronic
1156484441 18:37456039-37456061 GACACTCCAGAGGCCTCAGGAGG - Intronic
1157716810 18:49893683-49893705 GGATCTCCAGGGGCCAGAGGTGG - Intronic
1160623953 18:80190296-80190318 AACCCACCAGAGGCCAGAGGAGG + Intronic
1160782510 19:884112-884134 GACCCTGGAGTGGCCAGACGTGG - Intronic
1161143889 19:2665414-2665436 GACATTCCAGTTCCAAGAGGTGG - Intronic
1161553503 19:4927762-4927784 CACGGTCCAGTGCCCAGAGGGGG + Intronic
1162277085 19:9664461-9664483 GACAGTCCACTGGCCAGTGGTGG - Intronic
1162476413 19:10902671-10902693 GACACTGCAGTGAGCAGAGATGG - Intronic
1163603290 19:18261225-18261247 GACACCCCAGTGGCCTGAGATGG + Intronic
1163603331 19:18261381-18261403 GACACTCCAATGGTCTGAGATGG + Intronic
1163603492 19:18262083-18262105 GACACCTCAGTGGCCACAGATGG + Intronic
1164434702 19:28219319-28219341 GTCACTACATTGGCCAGAGGAGG + Intergenic
1164834639 19:31349556-31349578 ATCGCTCCAGAGGCCAGAGGAGG + Intergenic
1165232970 19:34398993-34399015 TACACACCAGTGGCCAGGCGCGG - Intronic
1165293973 19:34911212-34911234 GACACTCGAGAGGCTAGAGCAGG + Intergenic
1166141024 19:40805305-40805327 GTCACTGCAGTGGCAAGATGAGG - Intronic
1166701141 19:44882335-44882357 GACGCTGCAGGGGGCAGAGGAGG + Exonic
1167188375 19:47964505-47964527 GAGACTCCAGGGGTAAGAGGAGG - Intergenic
1168111672 19:54195563-54195585 AAAACTCCTGTGGCCAGATGTGG + Intergenic
925076485 2:1020347-1020369 GCCAGTCCAGGGGCCAGAAGTGG - Intronic
925865078 2:8220143-8220165 GACAGGACAGTGGGCAGAGGAGG + Intergenic
927697029 2:25245791-25245813 GACTCCCCAGTGGCCACAGAAGG - Intronic
927930316 2:27039659-27039681 GACACTACAGGGCCCAGAGCAGG - Intronic
930284748 2:49413799-49413821 TACACTCCAGTGGCTGGAGTTGG + Intergenic
932768554 2:74487069-74487091 GACACTGCTGTGGCTGGAGGAGG + Intronic
933979830 2:87540544-87540566 CACACTCCAGCTGCCAGAGGGGG + Intergenic
935359747 2:102237326-102237348 GTTAGTCAAGTGGCCAGAGGTGG + Intronic
936134734 2:109880451-109880473 GAACTTCCAGTGGCCAAAGGAGG - Intergenic
936209963 2:110491034-110491056 GAACTTCCAGTGGCCAAAGGAGG + Intergenic
936247245 2:110838933-110838955 GAAACTCCAGTGGACAGGGAGGG - Intronic
936313990 2:111410247-111410269 CACACTCCAGCTGCCAGAGGGGG - Intergenic
936429151 2:112446289-112446311 GAACTTCCAGTGGCCAAAGGAGG + Intergenic
937492091 2:122380502-122380524 GACAGTTCATTGGCCAGAAGTGG - Intergenic
940007721 2:149023369-149023391 GACAGTGCACTGCCCAGAGGAGG - Exonic
940763652 2:157766147-157766169 GACACTCCAGTACCCAGCTGTGG - Exonic
940788331 2:158005744-158005766 GACACTGCAGGGACCAGTGGGGG + Intronic
941579172 2:167273684-167273706 AAGACTCCAGGGCCCAGAGGAGG - Intergenic
941961161 2:171255227-171255249 GACATTCCAGTTTACAGAGGCGG - Intergenic
944668015 2:201972790-201972812 GACCTCCCAGGGGCCAGAGGAGG - Intergenic
945273257 2:207962770-207962792 GACAGTGCAGTGCCCAGAGCAGG + Intronic
946130387 2:217602020-217602042 GAGACTCCACTGGCAAGAGCAGG - Intronic
946808906 2:223501367-223501389 GACACCTCAGTGACCAGAGCTGG - Intergenic
947392759 2:229655986-229656008 GACACTCTAGGGTCTAGAGGAGG - Intronic
948826065 2:240573950-240573972 GACACCCCAGGGGTCAGACGAGG - Intronic
948862869 2:240761360-240761382 CACAGTCCAGTGGACAGAGCGGG - Exonic
949035703 2:241814878-241814900 GGCACCCCACTGCCCAGAGGAGG - Exonic
1169102746 20:2965725-2965747 GGCAGGCCAGTGGCCAGGGGTGG + Intronic
1169811027 20:9609466-9609488 GACACTCAAGGGGACAGAGCAGG + Intronic
1172524747 20:35592623-35592645 GACCCTCCAAAGGCCAGAGGAGG + Intergenic
1173846012 20:46189228-46189250 GCCACTCCAGTGATTAGAGGGGG + Intronic
1173868815 20:46329456-46329478 GAGAGTCCTGAGGCCAGAGGGGG + Intergenic
1174806857 20:53611604-53611626 AACACTTAAGAGGCCAGAGGTGG - Intergenic
1177975283 21:27841818-27841840 GACACACCAGTGCCTATAGGGGG - Intergenic
1178715156 21:34957732-34957754 CACAATCAAATGGCCAGAGGAGG - Intronic
1179093797 21:38293336-38293358 CACACTCCATTGGCCAAAGCAGG + Intronic
1180750178 22:18119129-18119151 GACACTGGAGAGGCCCGAGGGGG - Intronic
1181316682 22:21975127-21975149 ACCACCCCAGTGGCCAGAGTTGG + Intronic
1181685589 22:24525622-24525644 TGCCCTCCAGTGGCAAGAGGTGG + Intronic
1182298834 22:29326961-29326983 GACACCACAGAGGTCAGAGGTGG + Intergenic
1183083304 22:35471102-35471124 GACACACCATTGGCCAGAACTGG + Intergenic
1183305780 22:37082323-37082345 GCGACTCCATTTGCCAGAGGCGG - Intronic
1183989598 22:41589325-41589347 GACACACCAGTGGTCGGAGCTGG - Intronic
1184615969 22:45639130-45639152 GCCAGCCCAGTGGCCAGATGAGG + Intergenic
1184644394 22:45888411-45888433 GGCACCCCAGTTCCCAGAGGAGG + Intergenic
951415923 3:22420986-22421008 GACAATGCAGTGGCCAGCAGTGG + Intergenic
952743346 3:36755990-36756012 TACAGTCCAGTGGCCAGAGCTGG + Intergenic
954726274 3:52613632-52613654 GAAAGTACAGTGGCCAGGGGTGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
955929812 3:64045268-64045290 GGCACTCAAATGGCCAGAGAAGG - Intergenic
955959166 3:64321153-64321175 GATACTCTAATAGCCAGAGGGGG - Intronic
961000176 3:123368785-123368807 GACACAACAGTGAGCAGAGGAGG - Intronic
966681161 3:182643539-182643561 GAAACTCCCATGGCCAGAGATGG + Intergenic
968286113 3:197509928-197509950 AACCCTCCAGAGCCCAGAGGGGG - Exonic
968427549 4:533672-533694 GACACACGTGTGGTCAGAGGTGG - Intronic
968838178 4:2980779-2980801 GAGACTTCTGTGGCCAGTGGCGG + Intronic
969365408 4:6691233-6691255 GACACTCCAGTGGCCTGAACGGG + Intergenic
969391598 4:6894956-6894978 GAGACTCTGGTGGCAAGAGGAGG - Intergenic
969434772 4:7182159-7182181 GACACTTCAGTTGCCAGAAAGGG + Intergenic
969540878 4:7788046-7788068 GACCCTCCAGTGGGGAGAGCAGG - Intronic
969581605 4:8068649-8068671 AGCTCTCCAGTGGGCAGAGGAGG - Intronic
969995478 4:11307974-11307996 GAGGCTCCAGTGTCCACAGGTGG - Intergenic
970925101 4:21442691-21442713 GACACTCAAGTGTTGAGAGGCGG - Intronic
972177024 4:36420319-36420341 GGGACTCCAGTGTCCAGATGAGG - Intergenic
972517723 4:39824071-39824093 GACCCTACAGTGGACAGTGGGGG + Exonic
973988068 4:56375198-56375220 GCTACTCCAGTGGCCAAAGCAGG - Intronic
974561191 4:63521314-63521336 CACATTCCAGAGGCCACAGGGGG - Intergenic
978617664 4:110612571-110612593 GACACCAAAGTGGACAGAGGTGG - Intergenic
979353162 4:119669861-119669883 GACACACCATTTGCCAGAGTAGG - Intergenic
985666462 5:1183862-1183884 CACACACCGCTGGCCAGAGGGGG - Intergenic
985868926 5:2538514-2538536 GACACTCTTGTGGCAAGAAGCGG + Intergenic
988656440 5:33217084-33217106 GTACATCCAGTGGCCAGAGGAGG + Intergenic
994496166 5:100516763-100516785 GAGACTCCAGTGGCCATGGAGGG + Intergenic
994548838 5:101205727-101205749 GAGATTTCAGAGGCCAGAGGTGG + Intergenic
997301299 5:132807560-132807582 GAGACACCAGGGGGCAGAGGTGG + Intergenic
997508866 5:134439408-134439430 GCCTCTCCAGTTGCCAGAGGAGG + Intergenic
999012282 5:148056075-148056097 GACACTCCAGTGGCTGAAGGGGG + Intronic
999215639 5:149932818-149932840 GACCCTCCTGTGGGCGGAGGGGG - Intronic
999646144 5:153718807-153718829 GACTTTCCTCTGGCCAGAGGTGG - Intronic
999872213 5:155764632-155764654 GATGTCCCAGTGGCCAGAGGGGG + Intergenic
1000014223 5:157263753-157263775 AACTCTCCAGTGGCCGGAGAGGG - Intergenic
1000439314 5:161248296-161248318 GACACTCAAGAGGCCAGTGCGGG + Intergenic
1001743233 5:174070737-174070759 GACCCTACAGAGCCCAGAGGAGG - Intronic
1002133989 5:177097129-177097151 GACACTCCACTAGGCTGAGGAGG - Intronic
1002980234 6:2128818-2128840 AACACTCCAGAGCTCAGAGGAGG + Intronic
1003400310 6:5785209-5785231 GACACAGCAGTGACCAGAGATGG - Intergenic
1007083826 6:39128500-39128522 GACACTTGAGTGCCCAGTGGGGG + Intergenic
1007290089 6:40779080-40779102 GAAACTCTTGTGGCCAGAGCAGG - Intergenic
1007720323 6:43881336-43881358 GAGACGCCTGTGGCTAGAGGAGG - Intergenic
1011370308 6:86630037-86630059 GACACAACAGTGGACAGAGTGGG + Intergenic
1013185346 6:107752776-107752798 GACATTCTAATGGCCAGCGGGGG + Intronic
1014937074 6:127397491-127397513 CACATTCCAGTGGCCACAAGGGG - Intergenic
1015648941 6:135431963-135431985 GTTACTCCAGTGGGTAGAGGTGG - Intronic
1017098966 6:150830907-150830929 GACAATCCTGTGACCAGAGCTGG - Exonic
1017410487 6:154162646-154162668 AACACTCCAGTGAGAAGAGGTGG - Intronic
1017484824 6:154892767-154892789 TCCACTCCAGAGGTCAGAGGTGG + Intronic
1017487696 6:154918201-154918223 GACTCTCCAGTGGCCATAGATGG - Intronic
1017818085 6:158029216-158029238 CACATTCCAGGGGCCAGGGGTGG - Intronic
1018039623 6:159910455-159910477 GAAACCCCAGTGGGCAGGGGAGG - Exonic
1019413312 7:916043-916065 GCCACTCCAGGGGCCAGAGGCGG + Intronic
1019468086 7:1201497-1201519 GACACACAGGTGGCCAGAGGTGG + Intergenic
1019697149 7:2452231-2452253 CACAGTCCAGTGGGCTGAGGTGG + Intergenic
1019803464 7:3105342-3105364 GAGGCTCCGGTGGCCAGAGTGGG - Intergenic
1022356543 7:29620443-29620465 GGCACTCCTGGGGCTAGAGGGGG - Intergenic
1022806070 7:33823992-33824014 GAAACTCCAGTGGCAGGAAGAGG + Intergenic
1023729419 7:43176522-43176544 GACTCTGCAGAGGCCTGAGGTGG + Intronic
1024880323 7:54078463-54078485 GAAGCTCCAGTGCCCAGAGCTGG - Intergenic
1025012699 7:55410613-55410635 GAAAAATCAGTGGCCAGAGGCGG + Intronic
1027774340 7:82444650-82444672 GGCAGGCCAGTGGCCAGAGCAGG - Intergenic
1028595689 7:92545154-92545176 GACACTCCTGTTCCCAGACGGGG + Intergenic
1028984370 7:96998280-96998302 GTCACTCAAGCGGCCAGAGAGGG + Intergenic
1030079530 7:105765267-105765289 GACGTTGCAGTGACCAGAGGTGG + Intronic
1030129873 7:106190110-106190132 CAGACTCCAGAGGGCAGAGGAGG + Intergenic
1030912639 7:115270927-115270949 GACACCCCACTGACCAGAGCTGG - Intergenic
1031226125 7:119040468-119040490 GACTCTGCAGAGTCCAGAGGTGG - Intergenic
1032384349 7:131511202-131511224 AACACTACCGTGGCTAGAGGAGG - Exonic
1032694158 7:134319473-134319495 GAGAACCCAGTGGTCAGAGGAGG - Intergenic
1033322891 7:140356391-140356413 AACACTCAAGTGGCCAGGCGAGG + Intronic
1035666037 8:1380043-1380065 GACACAGCAGTGGGCAGAGCAGG - Intergenic
1037816894 8:22117109-22117131 GACTTTCCAGAGGCCAGGGGTGG + Intronic
1037888193 8:22606132-22606154 GACAGTTCTGTGGCCACAGGAGG - Exonic
1038247029 8:25867985-25868007 TACATTTCAGTGGGCAGAGGGGG - Intronic
1039446520 8:37637553-37637575 GTCATTCCAGTGTCCAGAGAAGG - Intergenic
1041009066 8:53523801-53523823 GAGACTCCAGAGGCCAGGGAAGG - Intergenic
1043277689 8:78420404-78420426 GAAAATTCAGTGGCCAGTGGTGG - Intergenic
1043745229 8:83866946-83866968 AACTCACCAGTGGCCAGAAGAGG - Intergenic
1045490331 8:102663268-102663290 GACACTCCTGTGGACAGAAGCGG - Intergenic
1045518132 8:102879144-102879166 GACTCTGCAGTGTCCTGAGGTGG - Intronic
1045866958 8:106878285-106878307 CAGACTCCAGAGGCCAGCGGGGG + Intergenic
1046179089 8:110619147-110619169 GACAGTCAATTGGCCAGTGGTGG - Intergenic
1049409572 8:142466475-142466497 AGCCCTCCAGTGGCCCGAGGAGG + Intronic
1049556854 8:143286831-143286853 GACACACCAGTGGCCCTAAGAGG - Intergenic
1049671071 8:143870111-143870133 GAGGCTCAAGTGGCCACAGGAGG - Exonic
1052832044 9:33223562-33223584 GCCACTGCAGAGGTCAGAGGAGG - Intronic
1056923823 9:90815334-90815356 GGCACCCCAGTGAGCAGAGGTGG + Intronic
1059461156 9:114431108-114431130 CACACTCCACTGGCCACACGGGG - Intronic
1060018651 9:120109422-120109444 GACACTGCAGTAGACAGGGGCGG + Intergenic
1060126879 9:121055827-121055849 GACACTCTACTGGCCACAGCTGG - Intergenic
1060145927 9:121252340-121252362 AAGACTCCTGTGGCCAGTGGTGG + Intronic
1060259579 9:122062206-122062228 GACACTGCACTGATCAGAGGAGG + Intronic
1060530415 9:124344379-124344401 GCAACTCCGGTGGCCACAGGAGG - Intronic
1061012191 9:127962266-127962288 GACACTCCAGTGGCCAGAGGTGG - Intronic
1062460219 9:136659840-136659862 GACCTTCCAGTGCCCAGATGAGG + Intronic
1185764063 X:2710225-2710247 GAAACTCCAGTGTCAGGAGGTGG - Intronic
1188957128 X:36446826-36446848 GACATTCTACTGACCAGAGGTGG - Intergenic
1190583699 X:51915546-51915568 GACACTGCAGAGTCCCGAGGCGG - Intergenic
1192084936 X:68086747-68086769 ACCACTACAGTGTCCAGAGGAGG - Intronic
1192118562 X:68433765-68433787 GACACTGCAGCGGGAAGAGGAGG + Exonic
1193851958 X:86547987-86548009 TTCACTCGAGTGGCCAGAAGAGG - Intronic
1196129052 X:112132871-112132893 TACACTCCAGTGCCCACTGGCGG + Intergenic