ID: 1061012979

View in Genome Browser
Species Human (GRCh38)
Location 9:127966258-127966280
Sequence GTCTGAATCCTGCTGCTCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061012978_1061012979 -3 Left 1061012978 9:127966238-127966260 CCAGAGTCAGACACATCTAGGTC 0: 1
1: 0
2: 3
3: 6
4: 99
Right 1061012979 9:127966258-127966280 GTCTGAATCCTGCTGCTCACCGG No data
1061012977_1061012979 -2 Left 1061012977 9:127966237-127966259 CCCAGAGTCAGACACATCTAGGT 0: 1
1: 1
2: 3
3: 16
4: 147
Right 1061012979 9:127966258-127966280 GTCTGAATCCTGCTGCTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061012979 Original CRISPR GTCTGAATCCTGCTGCTCAC CGG Intronic
No off target data available for this crispr