ID: 1061013151

View in Genome Browser
Species Human (GRCh38)
Location 9:127967184-127967206
Sequence TTAGGAAGTCCCAAGTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061013147_1061013151 -1 Left 1061013147 9:127967162-127967184 CCTGCTGGTGTTGGGGACCATGT 0: 1
1: 0
2: 1
3: 13
4: 136
Right 1061013151 9:127967184-127967206 TTAGGAAGTCCCAAGTTAGGAGG No data
1061013143_1061013151 8 Left 1061013143 9:127967153-127967175 CCGTCAAGACCTGCTGGTGTTGG 0: 1
1: 0
2: 1
3: 26
4: 140
Right 1061013151 9:127967184-127967206 TTAGGAAGTCCCAAGTTAGGAGG No data
1061013141_1061013151 14 Left 1061013141 9:127967147-127967169 CCAAATCCGTCAAGACCTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1061013151 9:127967184-127967206 TTAGGAAGTCCCAAGTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061013151 Original CRISPR TTAGGAAGTCCCAAGTTAGG AGG Intronic
No off target data available for this crispr