ID: 1061015990

View in Genome Browser
Species Human (GRCh38)
Location 9:127980998-127981020
Sequence GGCTAGGCGGGCGGCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061015990_1061015999 -3 Left 1061015990 9:127980998-127981020 CCCGCGCGGCCGCCCGCCTAGCC No data
Right 1061015999 9:127981018-127981040 GCCGCCGCCGAGCACGGCAGGGG No data
1061015990_1061015998 -4 Left 1061015990 9:127980998-127981020 CCCGCGCGGCCGCCCGCCTAGCC No data
Right 1061015998 9:127981017-127981039 AGCCGCCGCCGAGCACGGCAGGG No data
1061015990_1061016006 8 Left 1061015990 9:127980998-127981020 CCCGCGCGGCCGCCCGCCTAGCC No data
Right 1061016006 9:127981029-127981051 GCACGGCAGGGGCGGGGCGCCGG No data
1061015990_1061016003 1 Left 1061015990 9:127980998-127981020 CCCGCGCGGCCGCCCGCCTAGCC No data
Right 1061016003 9:127981022-127981044 CCGCCGAGCACGGCAGGGGCGGG No data
1061015990_1061016001 0 Left 1061015990 9:127980998-127981020 CCCGCGCGGCCGCCCGCCTAGCC No data
Right 1061016001 9:127981021-127981043 GCCGCCGAGCACGGCAGGGGCGG No data
1061015990_1061015995 -9 Left 1061015990 9:127980998-127981020 CCCGCGCGGCCGCCCGCCTAGCC No data
Right 1061015995 9:127981012-127981034 CGCCTAGCCGCCGCCGAGCACGG No data
1061015990_1061015997 -5 Left 1061015990 9:127980998-127981020 CCCGCGCGGCCGCCCGCCTAGCC No data
Right 1061015997 9:127981016-127981038 TAGCCGCCGCCGAGCACGGCAGG No data
1061015990_1061016004 2 Left 1061015990 9:127980998-127981020 CCCGCGCGGCCGCCCGCCTAGCC No data
Right 1061016004 9:127981023-127981045 CGCCGAGCACGGCAGGGGCGGGG No data
1061015990_1061016007 11 Left 1061015990 9:127980998-127981020 CCCGCGCGGCCGCCCGCCTAGCC No data
Right 1061016007 9:127981032-127981054 CGGCAGGGGCGGGGCGCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061015990 Original CRISPR GGCTAGGCGGGCGGCCGCGC GGG (reversed) Intergenic