ID: 1061023314

View in Genome Browser
Species Human (GRCh38)
Location 9:128031099-128031121
Sequence GGAGCCACTCACCTGTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061023301_1061023314 21 Left 1061023301 9:128031055-128031077 CCCATTGTGGGAGGGACACACCA No data
Right 1061023314 9:128031099-128031121 GGAGCCACTCACCTGTGGCTGGG No data
1061023309_1061023314 1 Left 1061023309 9:128031075-128031097 CCACACTGGGGTGTGGTGTGGGA No data
Right 1061023314 9:128031099-128031121 GGAGCCACTCACCTGTGGCTGGG No data
1061023302_1061023314 20 Left 1061023302 9:128031056-128031078 CCATTGTGGGAGGGACACACCAC No data
Right 1061023314 9:128031099-128031121 GGAGCCACTCACCTGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061023314 Original CRISPR GGAGCCACTCACCTGTGGCT GGG Intergenic
No off target data available for this crispr