ID: 1061027000

View in Genome Browser
Species Human (GRCh38)
Location 9:128056265-128056287
Sequence TGACAAAGGCTGAGCCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061026992_1061027000 24 Left 1061026992 9:128056218-128056240 CCTGGCCACAAGCCTACATGTGA No data
Right 1061027000 9:128056265-128056287 TGACAAAGGCTGAGCCTGGCAGG No data
1061026995_1061027000 -8 Left 1061026995 9:128056250-128056272 CCCAACCAGAAGCAATGACAAAG No data
Right 1061027000 9:128056265-128056287 TGACAAAGGCTGAGCCTGGCAGG No data
1061026994_1061027000 12 Left 1061026994 9:128056230-128056252 CCTACATGTGATCTCTCAGTCCC No data
Right 1061027000 9:128056265-128056287 TGACAAAGGCTGAGCCTGGCAGG No data
1061026993_1061027000 19 Left 1061026993 9:128056223-128056245 CCACAAGCCTACATGTGATCTCT No data
Right 1061027000 9:128056265-128056287 TGACAAAGGCTGAGCCTGGCAGG No data
1061026996_1061027000 -9 Left 1061026996 9:128056251-128056273 CCAACCAGAAGCAATGACAAAGG No data
Right 1061027000 9:128056265-128056287 TGACAAAGGCTGAGCCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061027000 Original CRISPR TGACAAAGGCTGAGCCTGGC AGG Intergenic
No off target data available for this crispr