ID: 1061028914

View in Genome Browser
Species Human (GRCh38)
Location 9:128068116-128068138
Sequence GACTGGCCTTCGGTGCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061028908_1061028914 -8 Left 1061028908 9:128068101-128068123 CCCATCCGAGCCTGTGACTGGCC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 90
1061028903_1061028914 0 Left 1061028903 9:128068093-128068115 CCCTCCTCCCCATCCGAGCCTGT 0: 1
1: 0
2: 3
3: 25
4: 370
Right 1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 90
1061028899_1061028914 8 Left 1061028899 9:128068085-128068107 CCGCCCCTCCCTCCTCCCCATCC 0: 1
1: 11
2: 167
3: 1552
4: 10854
Right 1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 90
1061028904_1061028914 -1 Left 1061028904 9:128068094-128068116 CCTCCTCCCCATCCGAGCCTGTG 0: 1
1: 0
2: 0
3: 41
4: 460
Right 1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 90
1061028909_1061028914 -9 Left 1061028909 9:128068102-128068124 CCATCCGAGCCTGTGACTGGCCT 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 90
1061028902_1061028914 3 Left 1061028902 9:128068090-128068112 CCTCCCTCCTCCCCATCCGAGCC 0: 1
1: 0
2: 8
3: 84
4: 937
Right 1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 90
1061028905_1061028914 -4 Left 1061028905 9:128068097-128068119 CCTCCCCATCCGAGCCTGTGACT 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 90
1061028898_1061028914 21 Left 1061028898 9:128068072-128068094 CCTTAGACAGGCTCCGCCCCTCC 0: 1
1: 0
2: 3
3: 16
4: 170
Right 1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 90
1061028900_1061028914 5 Left 1061028900 9:128068088-128068110 CCCCTCCCTCCTCCCCATCCGAG 0: 1
1: 0
2: 6
3: 97
4: 1074
Right 1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 90
1061028907_1061028914 -7 Left 1061028907 9:128068100-128068122 CCCCATCCGAGCCTGTGACTGGC 0: 1
1: 0
2: 0
3: 12
4: 101
Right 1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 90
1061028901_1061028914 4 Left 1061028901 9:128068089-128068111 CCCTCCCTCCTCCCCATCCGAGC 0: 1
1: 0
2: 5
3: 75
4: 730
Right 1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061028914 Original CRISPR GACTGGCCTTCGGTGCGCCC GGG Intronic
900166752 1:1247014-1247036 CCCTGGCCGTCGGGGCGCCCGGG - Intergenic
900225164 1:1529562-1529584 GACTGGCCTCCAGAGAGCCCCGG - Intronic
900375581 1:2353056-2353078 GCCTGGCCTGCAGTGCGTCCTGG - Intronic
900682278 1:3923690-3923712 GACTGGCCATGTGTGAGCCCTGG - Intergenic
915321942 1:155061151-155061173 GAATGGCCTTCCGTAGGCCCAGG + Intronic
920299637 1:204980675-204980697 GACTGGCAGTCGGTGGACCCTGG - Intronic
923000081 1:229999885-229999907 GACTGGCATGCGGTTCCCCCAGG - Intergenic
1069627336 10:69876465-69876487 GACAGGCCTTAGGTGGGCGCTGG - Intronic
1070835055 10:79442810-79442832 GACAGGCCTTTCCTGCGCCCAGG - Intronic
1072443436 10:95477448-95477470 GACTGGCTTTCTGGGCTCCCAGG - Intronic
1074874698 10:117604643-117604665 GACTAGCCTTTGGTGCCTCCGGG + Intergenic
1075482238 10:122791856-122791878 GAATGGACTTCTGTGCGCACTGG + Intergenic
1076627238 10:131829593-131829615 GAATGGCCTGCAGTGGGCCCAGG + Intergenic
1076664127 10:132076607-132076629 GACTGGCCTGCGGTGACCCTGGG + Intergenic
1076664148 10:132076681-132076703 GACTGGCCTGCGGTGGCCCCGGG + Intergenic
1076664156 10:132076718-132076740 GACTGGCCTGCAGTGTCCCCTGG + Intergenic
1076664165 10:132076755-132076777 GACTGGCCTGAGGTGGCCCCGGG + Intergenic
1076664175 10:132076788-132076810 GGCTGGCCTGCGGTGGCCCCAGG + Intergenic
1076664194 10:132076862-132076884 GGCTGGCCTGCGGTGTCCCCGGG + Intergenic
1076664215 10:132076939-132076961 GGCTGGCCTGCGGTGGCCCCGGG + Intergenic
1076815002 10:132910274-132910296 ACCTGGCCTCCAGTGCGCCCCGG + Intronic
1077364455 11:2155935-2155957 TCCAGGCCTTCGGTGCCCCCAGG + Intronic
1080857710 11:36126506-36126528 GATTGGCCTTCGGTGTGGTCAGG + Intronic
1082162486 11:48900541-48900563 GACTGGCCTTCCGTGGGGCGGGG + Intergenic
1083310647 11:61781877-61781899 GACTGGGCTGAGGTGGGCCCTGG - Intronic
1089985021 11:122804425-122804447 GCCTGGCCTTCTGTGCACACCGG - Intronic
1090238683 11:125166759-125166781 ACCCGGCCTTTGGTGCGCCCGGG + Intronic
1092605271 12:10111712-10111734 GACTCGCCCTCGGGGCGGCCTGG - Intergenic
1094480148 12:30875090-30875112 GCCTGGCCTCCTGTGGGCCCTGG + Intergenic
1104892798 12:132148523-132148545 GGCTGGGCTTCGGGGTGCCCTGG + Intronic
1104900759 12:132188520-132188542 GGCTGGCCGTCGCTGCGGCCTGG - Intergenic
1107958611 13:45540419-45540441 GACTGGCCTCCAGAGCTCCCTGG + Intronic
1108816718 13:54301543-54301565 TACGGGCCTTGGGTGAGCCCTGG - Intergenic
1113964758 13:114146607-114146629 GACTGAACTTCGGGGCTCCCTGG + Intergenic
1120249339 14:82043145-82043167 GCCTGGCCTTTGGTGGGCCATGG - Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1121205062 14:92157755-92157777 GACTGGCCTCTGGTGGGCCATGG - Exonic
1122692627 14:103538437-103538459 GCCTGCCCTTCGGGGCTCCCAGG + Intergenic
1127753381 15:62067786-62067808 GCCTGGCCTTGGCTGCGCTCCGG + Exonic
1132999519 16:2841934-2841956 GACTGGCCTGAGGTGGGCCCTGG - Intergenic
1142213363 16:88819049-88819071 GACTGGGCTTCAGTGGGTCCGGG - Intronic
1146594996 17:34160901-34160923 GACTGGCCTTAGGTTCCCCAGGG - Intronic
1160166951 18:76522228-76522250 GCCCGGCCTTCTGTGCGCACAGG - Intergenic
1160239730 18:77114655-77114677 GACTGGCCTTCGGATGGCACGGG + Intronic
1168283660 19:55320065-55320087 GACGGGTCTTCTGTGTGCCCTGG - Exonic
1168343640 19:55640405-55640427 GCCTGGCCTTCGCTGCGCTTCGG + Intronic
931855463 2:66298196-66298218 GACTGGCCTTTGGGGACCCCTGG + Intergenic
934564182 2:95329410-95329432 GACTGGCATTCGCTGGGCACTGG + Intronic
935787117 2:106559348-106559370 GACTGGTCTTAGGTGCACCCTGG + Intergenic
937062392 2:118990312-118990334 CACTGGCCTTCCCTGCCCCCCGG - Intronic
946195791 2:218032538-218032560 GACTGGCAGTGGGTGCGCCCTGG + Intergenic
948963191 2:241356195-241356217 GATTGGCCTGCGGGGCGCCAGGG - Intergenic
1178487458 21:33027893-33027915 GACTGGCCTGCGCTGGGCTCGGG + Exonic
1179533024 21:42033027-42033049 GAGTGGCCTGGGGTGCGGCCTGG - Intergenic
1180056735 21:45362812-45362834 GAGTGGCCTTTTGTGGGCCCTGG - Intergenic
1181514404 22:23402771-23402793 GCCTGGCCTGCAGCGCGCCCCGG - Intergenic
1182143027 22:27979068-27979090 GACTGGCGTCCGGGGAGCCCAGG - Exonic
1183343904 22:37296423-37296445 GACTGGCCCTCCCTGAGCCCAGG - Intronic
1183585463 22:38750729-38750751 GCCTGGCCTGCGGTGGCCCCTGG - Intronic
961793287 3:129391882-129391904 GGCTGGCCTTTGGTTCTCCCTGG - Intergenic
961807290 3:129498500-129498522 GGCTGGCCTTTGGTTCTCCCTGG - Intronic
987340462 5:16935516-16935538 GGCTGGCTCTCGGGGCGCCCTGG - Intronic
988919420 5:35926625-35926647 GACTTGTCTTTGGTGCTCCCTGG + Intronic
992557203 5:77915651-77915673 GAATGGCCTTCTGTGGGCCAGGG + Intergenic
1006579563 6:35068992-35069014 GTCTGGCCATTGGTGGGCCCAGG + Intronic
1015683128 6:135830194-135830216 GACTGGCCTTCTGTGCAGCAAGG - Intergenic
1018642551 6:165917720-165917742 GCCTGGCCTGGGGTGCTCCCCGG - Intronic
1020465349 7:8472508-8472530 GGCTGTCCTTCTGTGGGCCCAGG + Intronic
1037430969 8:18812805-18812827 CGCTGGCCTGCGGTGGGCCCTGG + Intronic
1040603191 8:48904348-48904370 AACTGCCCTCCGGTGTGCCCAGG + Intergenic
1053174016 9:35909575-35909597 GGCTGGCCTTTGGGGAGCCCAGG + Intergenic
1059094687 9:111399915-111399937 CACAGGCCTTGGGTGAGCCCTGG + Intronic
1061028914 9:128068116-128068138 GACTGGCCTTCGGTGCGCCCGGG + Intronic
1061915976 9:133754336-133754358 GGCTTGCCTTGGGTGGGCCCTGG + Intergenic
1061991288 9:134160076-134160098 GACTGTCCTGCGGGGCACCCTGG - Intergenic
1186503759 X:10073641-10073663 AACTGGCCTTGGGTGGGACCAGG + Intronic
1187276835 X:17823741-17823763 CACTGGCCTTGGGTGTGGCCTGG - Intronic
1187391024 X:18886785-18886807 GACAGGCCCTCTGTGCTCCCAGG + Intergenic
1192196848 X:69034264-69034286 GACTGGCCTTGGGTGGGCTGAGG - Intergenic
1200684269 Y:6245608-6245630 GGCTGGCCTCTGGTGTGCCCAGG + Intergenic
1200686908 Y:6265936-6265958 GGCTGGCCTCTGGTGTGCCCAGG + Intergenic
1200989786 Y:9336853-9336875 GGCTGGCCTCTGGTGTGCCCAGG + Intergenic
1200992454 Y:9357186-9357208 GGCTGGCCTCTGGTGTGCCCAGG + Intergenic
1200995106 Y:9377464-9377486 GGCTGGCCTCTGGTGTGCCCAGG + Intronic
1200997771 Y:9397810-9397832 GGCTGGCCTCTGGTGTGCCCAGG + Intergenic
1201000280 Y:9466343-9466365 GGCTGGCCTCTGGTGTGCCCAGG + Intergenic
1201002942 Y:9486656-9486678 GGCTGGCCTCTGGTGTGCCCAGG + Intronic
1201005600 Y:9506939-9506961 GGCTGGCCTCTGGTGTGCCCAGG + Intergenic
1201008261 Y:9527269-9527291 GGCTGGCCTCTGGTGTGCCCAGG + Intergenic
1201010860 Y:9547454-9547476 GGCTGGCCTCTGGTGTGCCCAGG + Intergenic
1201017860 Y:9623902-9623924 GGCTGGCCTCCCGTGTGCCCAGG - Intergenic
1201048365 Y:9908778-9908800 GGCTGGCCTCTGGTGTGCCCAGG - Intergenic
1201059804 Y:10035907-10035929 GGCTGGCCTCCCGTGTGCCCAGG - Intergenic
1201063680 Y:10069768-10069790 GGCTGGCCTCCAGTGTGCCCGGG - Intergenic
1202109398 Y:21405374-21405396 GGCTGGCCTCCCGTGTGCCCAGG - Intergenic