ID: 1061029005

View in Genome Browser
Species Human (GRCh38)
Location 9:128068423-128068445
Sequence CCCGCAGATAGCGCCGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 50}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061029005_1061029013 4 Left 1061029005 9:128068423-128068445 CCTGCGGCGGCGCTATCTGCGGG 0: 1
1: 0
2: 1
3: 0
4: 50
Right 1061029013 9:128068450-128068472 CGGACCACCGGCTGCGCCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061029005_1061029010 -8 Left 1061029005 9:128068423-128068445 CCTGCGGCGGCGCTATCTGCGGG 0: 1
1: 0
2: 1
3: 0
4: 50
Right 1061029010 9:128068438-128068460 TCTGCGGGGGCCCGGACCACCGG 0: 1
1: 0
2: 0
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061029005 Original CRISPR CCCGCAGATAGCGCCGCCGC AGG (reversed) Exonic
903184709 1:21622532-21622554 ATCGCAGGCAGCGCCGCCGCCGG - Intronic
906960935 1:50419173-50419195 CCCCCAGATAAGGCCGCCGTGGG - Exonic
1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG + Intronic
1064380688 10:14838768-14838790 CCCGGAGACAGCGGGGCCGCTGG + Intronic
1074182349 10:111076391-111076413 CCCGCAGACAGCATCGCGGCTGG + Intergenic
1076875986 10:133215739-133215761 CCCTCAGGCAGGGCCGCCGCAGG - Intronic
1077065057 11:637356-637378 CCCGCAGATGCCCCCGCGGCCGG - Exonic
1078659607 11:13276903-13276925 GCAGCAGAGAGCGCTGCCGCGGG + Intronic
1103528000 12:121580319-121580341 CCCCCAAATAGCCCGGCCGCGGG - Intronic
1103828731 12:123762219-123762241 CCCGCCGACGGCGCCGGCGCTGG - Intergenic
1115175655 14:30559077-30559099 CCCACAGCCAGCGCCTCCGCGGG + Intergenic
1116821710 14:49633877-49633899 CCCGGAGGTGGCGCCTCCGCCGG - Exonic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1122905765 14:104800793-104800815 CCACCAGATGCCGCCGCCGCCGG - Intronic
1134849860 16:17470862-17470884 CCCGCAGCTCCCGCGGCCGCCGG + Exonic
1139512780 16:67436856-67436878 CCTGCAGGAAGCGGCGCCGCAGG - Exonic
1139534449 16:67562808-67562830 CCCGGCGCCAGCGCCGCCGCCGG + Intronic
1141132387 16:81445032-81445054 CCCGCAGGAAGCGCCGAGGCCGG + Intergenic
1142130749 16:88430535-88430557 CCCGCAGCTCCCGGCGCCGCCGG + Exonic
1143544705 17:7589230-7589252 CCCCCAGAGCGGGCCGCCGCTGG + Exonic
1148119253 17:45197977-45197999 CCCGCAGAGAGGGCCCCAGCCGG - Intergenic
1152505350 17:80746205-80746227 CCCGCAGAAAGCACCGCTGTGGG - Intronic
1152505361 17:80746242-80746264 CCCGCAGAAAGCACCGCTGTGGG - Intronic
1152505372 17:80746279-80746301 CCCGCAGAAAGCACCGCTGTGGG - Intronic
1152505383 17:80746316-80746338 CCCGCAGAAAGCACCGCTGTGGG - Intronic
1153201905 18:2655732-2655754 CCCGCGACCAGCGCCGCCGCCGG - Exonic
1160684525 19:427389-427411 CCCTCAGGTAGCTCCGCGGCAGG - Intronic
1161707266 19:5828026-5828048 CCCGCCGCAGGCGCCGCCGCTGG - Exonic
1162033188 19:7925998-7926020 CCCTGAGAGAGCGCGGCCGCCGG - Exonic
1162435374 19:10654783-10654805 CCCGCGCGTGGCGCCGCCGCCGG - Intronic
1162559260 19:11406442-11406464 CCCGCAGAGGGCGCAGCGGCTGG - Exonic
1164952170 19:32345811-32345833 CCCGCTGTTAGCGCCGCCGCCGG + Intronic
1166230411 19:41423088-41423110 TCAGCAGATAGTGCCGCAGCCGG - Exonic
1167149803 19:47702083-47702105 CCCGCAGCCAGCGCCGCCCAAGG + Exonic
945225833 2:207530366-207530388 CCCGCCATGAGCGCCGCCGCTGG - Intronic
948394168 2:237632345-237632367 CCCGCAGAGAGCTCCGGAGCAGG - Intronic
1183578272 22:38706223-38706245 CCCGCGGACAGGGCGGCCGCTGG - Intronic
1185315636 22:50178122-50178144 CACGCTGATCGCGCCGCTGCTGG + Exonic
968477443 4:818688-818710 GCGGCAGATGGCGCAGCCGCCGG - Intronic
975444379 4:74445354-74445376 CCCGCTGCTACCGCCGGCGCCGG + Exonic
977810031 4:101347378-101347400 TCCACACAGAGCGCCGCCGCTGG + Exonic
984928522 4:184826565-184826587 CCCGCAGCTCGCGCCGGTGCAGG + Exonic
997990754 5:138542973-138542995 CACAGAGTTAGCGCCGCCGCTGG + Intronic
1000319030 5:160119163-160119185 CCCGCCGCCACCGCCGCCGCCGG - Exonic
1011054843 6:83193655-83193677 CCCACAGTGAGCGCCGCCGGCGG + Intronic
1019461372 7:1160563-1160585 CCCGCAGGATGCGCGGCCGCGGG - Intronic
1020257676 7:6510968-6510990 CCCGCAGGGAGCTCCGCGGCTGG + Exonic
1058153549 9:101487026-101487048 CCCGGAGATGGCGCCTCCACCGG - Intronic
1061029005 9:128068423-128068445 CCCGCAGATAGCGCCGCCGCAGG - Exonic
1186426106 X:9465255-9465277 CCCGGAGAGAGCGCGGGCGCTGG - Exonic
1192331271 X:70177293-70177315 CCCACAGCTAGAGCCGCCCCAGG + Intergenic
1198533373 X:137565931-137565953 CCCGCTGATTGGGCAGCCGCCGG - Intergenic