ID: 1061035717

View in Genome Browser
Species Human (GRCh38)
Location 9:128113362-128113384
Sequence ATGCTACTTACTTTCATTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061035714_1061035717 0 Left 1061035714 9:128113339-128113361 CCCCGGCACTTTTCAAGTCAATT No data
Right 1061035717 9:128113362-128113384 ATGCTACTTACTTTCATTGCCGG No data
1061035713_1061035717 15 Left 1061035713 9:128113324-128113346 CCATCTTCTCTTTCTCCCCGGCA No data
Right 1061035717 9:128113362-128113384 ATGCTACTTACTTTCATTGCCGG No data
1061035716_1061035717 -2 Left 1061035716 9:128113341-128113363 CCGGCACTTTTCAAGTCAATTAT No data
Right 1061035717 9:128113362-128113384 ATGCTACTTACTTTCATTGCCGG No data
1061035711_1061035717 19 Left 1061035711 9:128113320-128113342 CCATCCATCTTCTCTTTCTCCCC No data
Right 1061035717 9:128113362-128113384 ATGCTACTTACTTTCATTGCCGG No data
1061035715_1061035717 -1 Left 1061035715 9:128113340-128113362 CCCGGCACTTTTCAAGTCAATTA No data
Right 1061035717 9:128113362-128113384 ATGCTACTTACTTTCATTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061035717 Original CRISPR ATGCTACTTACTTTCATTGC CGG Intergenic
No off target data available for this crispr