ID: 1061038704

View in Genome Browser
Species Human (GRCh38)
Location 9:128127620-128127642
Sequence TGCGTGGGTAGCAGCGGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1719
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 1679}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061038688_1061038704 7 Left 1061038688 9:128127590-128127612 CCCGCCGCCCCCGCGAAGCCAGC 0: 1
1: 0
2: 1
3: 24
4: 232
Right 1061038704 9:128127620-128127642 TGCGTGGGTAGCAGCGGCTGGGG 0: 1
1: 0
2: 1
3: 38
4: 1679
1061038693_1061038704 -1 Left 1061038693 9:128127598-128127620 CCCCGCGAAGCCAGCCCGGCTCT 0: 1
1: 0
2: 1
3: 11
4: 116
Right 1061038704 9:128127620-128127642 TGCGTGGGTAGCAGCGGCTGGGG 0: 1
1: 0
2: 1
3: 38
4: 1679
1061038695_1061038704 -3 Left 1061038695 9:128127600-128127622 CCGCGAAGCCAGCCCGGCTCTGC 0: 1
1: 0
2: 0
3: 27
4: 224
Right 1061038704 9:128127620-128127642 TGCGTGGGTAGCAGCGGCTGGGG 0: 1
1: 0
2: 1
3: 38
4: 1679
1061038690_1061038704 3 Left 1061038690 9:128127594-128127616 CCGCCCCCGCGAAGCCAGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 232
Right 1061038704 9:128127620-128127642 TGCGTGGGTAGCAGCGGCTGGGG 0: 1
1: 0
2: 1
3: 38
4: 1679
1061038692_1061038704 0 Left 1061038692 9:128127597-128127619 CCCCCGCGAAGCCAGCCCGGCTC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1061038704 9:128127620-128127642 TGCGTGGGTAGCAGCGGCTGGGG 0: 1
1: 0
2: 1
3: 38
4: 1679
1061038694_1061038704 -2 Left 1061038694 9:128127599-128127621 CCCGCGAAGCCAGCCCGGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1061038704 9:128127620-128127642 TGCGTGGGTAGCAGCGGCTGGGG 0: 1
1: 0
2: 1
3: 38
4: 1679
1061038686_1061038704 24 Left 1061038686 9:128127573-128127595 CCACGGGGCTCGGGCCGCCCGCC 0: 1
1: 0
2: 1
3: 37
4: 300
Right 1061038704 9:128127620-128127642 TGCGTGGGTAGCAGCGGCTGGGG 0: 1
1: 0
2: 1
3: 38
4: 1679
1061038687_1061038704 10 Left 1061038687 9:128127587-128127609 CCGCCCGCCGCCCCCGCGAAGCC 0: 1
1: 0
2: 5
3: 51
4: 511
Right 1061038704 9:128127620-128127642 TGCGTGGGTAGCAGCGGCTGGGG 0: 1
1: 0
2: 1
3: 38
4: 1679
1061038689_1061038704 6 Left 1061038689 9:128127591-128127613 CCGCCGCCCCCGCGAAGCCAGCC 0: 1
1: 0
2: 2
3: 38
4: 340
Right 1061038704 9:128127620-128127642 TGCGTGGGTAGCAGCGGCTGGGG 0: 1
1: 0
2: 1
3: 38
4: 1679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061038704 Original CRISPR TGCGTGGGTAGCAGCGGCTG GGG Exonic
900154147 1:1197391-1197413 TGAGTGGGGGGCAGAGGCTGGGG - Intronic
900366870 1:2315062-2315084 TGCGGGGGTCTCAGAGGCTGCGG + Intergenic
900422589 1:2562040-2562062 TGCGTGGGCAGGGGTGGCTGAGG - Intronic
900699979 1:4040795-4040817 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
900762131 1:4480321-4480343 TGCGTGGGTAGCACTGCCAGTGG + Intergenic
901026220 1:6280035-6280057 TGCGTGGGGAGCAGACGCCGCGG + Intronic
901128203 1:6944037-6944059 TGCAGGGGTGCCAGCGGCTGGGG - Intronic
901191814 1:7417038-7417060 TGCCTGGGTATCAGCAGCAGTGG + Intronic
901966600 1:12873471-12873493 TGCCTGGGTATCAGCAGCAGAGG + Intronic
901970778 1:12905969-12905991 TGCCTGGGTATCAGCAGCAGAGG - Intronic
901981994 1:13043720-13043742 TGCCTGGGTATCAGCAGCAGAGG + Intronic
902000089 1:13185193-13185215 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
902014387 1:13295801-13295823 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
902019340 1:13330960-13330982 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
902501432 1:16914100-16914122 GGCCTCGGCAGCAGCGGCTGCGG + Intronic
904435812 1:30494255-30494277 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
904878253 1:33672824-33672846 TGCCTGGGTATCAGCAGCGGTGG - Intronic
905352215 1:37355869-37355891 AGCATGGGCAGCAGAGGCTGTGG - Intergenic
905840902 1:41177102-41177124 TGCCTGGGTATCAGCAGCGGAGG - Intronic
905981665 1:42234677-42234699 TGCCTGGGTATCAGCAGCAGAGG + Intronic
906080841 1:43087189-43087211 AGGGTGGGGAGCAGAGGCTGAGG - Intergenic
906196876 1:43935093-43935115 TGGGTGGGCAGCACAGGCTGAGG + Intronic
906374664 1:45285410-45285432 TGCCTGGGTATCAGCAGCGGAGG - Intronic
906522170 1:46474111-46474133 GGCCTGGGCAGCAGTGGCTGTGG + Intergenic
906556603 1:46719037-46719059 GGCGTTGGTGGCGGCGGCTGCGG + Exonic
906589148 1:47007289-47007311 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
906878727 1:49566577-49566599 TGCCTGGGTATCAGCAGCAGTGG + Intronic
906881693 1:49598494-49598516 TGCCTGGGTATCAGCAGCGGTGG + Intronic
906908011 1:49915946-49915968 TGCCTGGGTATCAGCAGCGGAGG - Intronic
906909794 1:49935699-49935721 TGCCTGGGTATCAGCAGCGGTGG - Intronic
907038335 1:51236356-51236378 GGCGGGGGCAGCAGCAGCTGAGG + Exonic
907057682 1:51386488-51386510 TGCCTGGGTATCAGCAGCGGTGG - Intronic
907580357 1:55567102-55567124 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
907756885 1:57319288-57319310 TGCATTGGTACCAGCAGCTGAGG + Intronic
907958202 1:59251660-59251682 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
908099050 1:60771528-60771550 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
908099655 1:60777808-60777830 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
908639256 1:66204126-66204148 TGCCTGGGTATCAGCAGCGGTGG + Intronic
908691108 1:66781031-66781053 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
908816739 1:68042961-68042983 TGCGTGGGCAGCAGGAGGTGGGG - Intergenic
908876790 1:68686772-68686794 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
908976993 1:69910463-69910485 TGCCTGGGTATCAGCAGCGGTGG + Intronic
908978668 1:69928083-69928105 TGCCTGGGTATCAGCAGCGGTGG + Intronic
909422016 1:75477116-75477138 TGCCTGGGTACCAGCAGCGGTGG - Intronic
909514083 1:76488005-76488027 TGCCTGGGTATCAGCAGCGGAGG + Intronic
910200192 1:84690727-84690749 TGCGGGCGCAGCTGCGGCTGCGG + Intronic
910381654 1:86633234-86633256 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
910398489 1:86814614-86814636 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
910709833 1:90167690-90167712 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
910785990 1:90998407-90998429 TGCCTGGGTATCAGCAGCGGAGG - Intronic
910822595 1:91367466-91367488 TGCCTGGGTATCAGCAGCGGTGG - Intronic
911022914 1:93407235-93407257 TGCGTGGGTATCAGCAGTGGAGG + Intergenic
911074187 1:93856584-93856606 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
911394304 1:97287205-97287227 TGCCTGGGTATCAGCAGCGGTGG + Intronic
911822939 1:102442927-102442949 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
911851568 1:102827340-102827362 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
911867804 1:103050880-103050902 TGCCTGGGTATCAGCAGCAGAGG + Intronic
912097531 1:106164008-106164030 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
912297854 1:108487326-108487348 TGCCTGGGTAACAGCAGCGGTGG - Intergenic
912463301 1:109851892-109851914 TGCTTGGGTATCACCAGCTGAGG - Intergenic
912741688 1:112204426-112204448 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
912960001 1:114187907-114187929 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
912999128 1:114562209-114562231 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
913285077 1:117218442-117218464 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
913394335 1:118349611-118349633 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
913418588 1:118638600-118638622 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
913467327 1:119156551-119156573 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
913503975 1:119498515-119498537 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
913721744 1:121603450-121603472 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
913942827 1:125123796-125123818 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
914374983 1:147064773-147064795 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
914408687 1:147403238-147403260 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
915011585 1:152691752-152691774 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
915026098 1:152831089-152831111 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
915589259 1:156861299-156861321 TGCTAGGGCAGCGGCGGCTGCGG - Intronic
915851019 1:159323667-159323689 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
915872291 1:159574233-159574255 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
915875188 1:159604600-159604622 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
916154719 1:161833117-161833139 TGCCTGGGTATCAGCAGCGGTGG - Intronic
916377085 1:164166774-164166796 TGCCTGGGTATCACCAGCTGAGG - Intergenic
916381500 1:164216878-164216900 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
916445056 1:164864398-164864420 TCCGTGGGCAACAGAGGCTGGGG - Intronic
916467433 1:165085813-165085835 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
916580315 1:166101054-166101076 TGCCTGGGTATCAGCAGCGGAGG - Intronic
916596744 1:166251353-166251375 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
916830475 1:168485669-168485691 TGCCTGGGTATCACCGGCAGAGG - Intergenic
917010439 1:170464721-170464743 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
917175555 1:172231306-172231328 TGCCTGGGTATCAGCAGCAGAGG - Intronic
917252213 1:173074796-173074818 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
917259803 1:173154590-173154612 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
917383128 1:174436931-174436953 TGCCTGGGTATCAGCAGCGGTGG - Intronic
917397985 1:174615354-174615376 TGCCTGGGTATCAGCAGCAGTGG + Intronic
917699365 1:177564451-177564473 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
917710193 1:177677079-177677101 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
917987375 1:180334377-180334399 TGCCTGGGTATCAGCAGCGGCGG - Intronic
918169677 1:181984761-181984783 TGCCTGGGATGCAGAGGCTGTGG + Intergenic
918351358 1:183658919-183658941 TGCCTGGGTACCAGCAGCGGTGG - Intronic
918398017 1:184135847-184135869 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
918408472 1:184234533-184234555 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
918548112 1:185708241-185708263 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
918973313 1:191448049-191448071 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
919623232 1:199886227-199886249 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
919654754 1:200186213-200186235 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
920631900 1:207660361-207660383 TGCGTGGGTATCACCAGCGGAGG - Intronic
920646967 1:207811047-207811069 TGTGTGGGTAGGAGCCCCTGGGG - Intergenic
920890250 1:209978484-209978506 TGCCTGGGTATCAGCAGCAGAGG + Intronic
920995559 1:210987562-210987584 TGCCTGGGTATCAGCAGCGGTGG + Intronic
920996457 1:210996880-210996902 TGCCTGGGTATCAGCAGCGGTGG - Intronic
921043260 1:211454230-211454252 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
921149882 1:212391303-212391325 TGCCTGGGTATCAGCAGCGGAGG - Intronic
921184645 1:212658868-212658890 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
921258080 1:213360837-213360859 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
921842207 1:219840185-219840207 TGCCTGGGTACCAGCAGCGGTGG - Intronic
921846391 1:219887555-219887577 TGCCTGGGTATCAGCAGCGGAGG - Intronic
921993019 1:221388340-221388362 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
922374314 1:224945769-224945791 TGCCTGGGTATCAGCAGCAGAGG + Intronic
922387946 1:225107156-225107178 TGCCTGGGTATCAGCAGCGGAGG + Intronic
922396887 1:225210834-225210856 TGCCTGGGTATCAGCAGCGGAGG - Intronic
922826614 1:228525966-228525988 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
923599157 1:235387076-235387098 TGCCTGGGTATCAGCAGCAGTGG + Intronic
923875437 1:238042394-238042416 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
924130303 1:240900573-240900595 TGCCTGGGTATCACCAGCTGAGG + Intronic
924351148 1:243115719-243115741 TGCCTGGGCAGCTGGGGCTGCGG - Intergenic
924872946 1:248068360-248068382 TGCCTGGGTACCAGCAGCAGTGG - Intronic
1062776284 10:150929-150951 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1062858937 10:794744-794766 TGTATGGGTAGGAGTGGCTGTGG - Intergenic
1063148496 10:3317833-3317855 TGCGTGGGCAGCAGCGGGGTAGG + Intergenic
1063148514 10:3317901-3317923 TGCGTGGGCAGCAGCGGGGTAGG + Intergenic
1063148532 10:3317969-3317991 TGCGTGGGCAGCAGCGGGGTAGG + Intergenic
1063148552 10:3318037-3318059 TGCGTGGGCAGCAGCGGGGTAGG + Intergenic
1063148570 10:3318105-3318127 TGCGTGGGCAGCAGCGGGATAGG + Intergenic
1063148587 10:3318173-3318195 TGTGTGGGCAGCAGCGGCATAGG + Intergenic
1063796758 10:9520729-9520751 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1064905247 10:20339125-20339147 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1064916521 10:20464952-20464974 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1064919472 10:20500907-20500929 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1065054997 10:21835189-21835211 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1065222511 10:23511207-23511229 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1065230621 10:23595068-23595090 TGCGTGGGTATCAGCAGCGGTGG + Intergenic
1065254879 10:23856290-23856312 TGCCTGGGTATCAGCAGCAGTGG + Intronic
1065274011 10:24067422-24067444 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1065276825 10:24094510-24094532 TGCCTGGGTATCAGCAGCAGTGG + Intronic
1065463624 10:25995782-25995804 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1066001807 10:31111662-31111684 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1066139305 10:32487764-32487786 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1066152789 10:32641931-32641953 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1066168618 10:32816698-32816720 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1066502477 10:36007568-36007590 TGGGTGGGGAGGAGTGGCTGAGG + Intergenic
1066582645 10:36898207-36898229 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1066584109 10:36913317-36913339 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1066709425 10:38217117-38217139 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1066746451 10:38606463-38606485 TGAGTGGGTTTCAGGGGCTGGGG + Intergenic
1066785089 10:38994890-38994912 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1067006216 10:42665990-42666012 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1067084580 10:43231048-43231070 TGCGTGGTATGCAGCGCCTGTGG + Intronic
1067144021 10:43680612-43680634 GGAGTGGGTACCAGGGGCTGGGG - Intergenic
1067149421 10:43717548-43717570 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1067181717 10:43992321-43992343 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1067195177 10:44112011-44112033 TGCCTGGGTATCAGCAGCTATGG + Intergenic
1067333455 10:45342327-45342349 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1067812603 10:49441657-49441679 TCTGTGGGTGGCAGCGGGTGCGG + Intergenic
1067987352 10:51164260-51164282 TGCCTGGGTAACAGCAGCGGTGG - Intronic
1067996658 10:51281141-51281163 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1068085138 10:52365465-52365487 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1068256297 10:54515859-54515881 TGCCTGGGTATCAGCAGCAGTGG - Intronic
1068394815 10:56447359-56447381 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1068642645 10:59427320-59427342 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1068940590 10:62677490-62677512 TGCCTGGGTAACAGCAGCGGTGG + Intergenic
1069066740 10:63949924-63949946 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1069110574 10:64441647-64441669 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1069161752 10:65101482-65101504 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1069284149 10:66691824-66691846 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1069353724 10:67559352-67559374 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1069761816 10:70816274-70816296 GGCGTGGGCACCAGCCGCTGAGG + Intronic
1070094594 10:73324198-73324220 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1070202211 10:74217734-74217756 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1070231552 10:74573282-74573304 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1070477825 10:76847071-76847093 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1070844666 10:79512527-79512549 TGCCTGGGTAGAGGCGGCGGCGG + Intergenic
1070893098 10:79957013-79957035 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1070929137 10:80247781-80247803 TGCCTGGGTAGAGGCGGCGGCGG - Intergenic
1071005759 10:80882313-80882335 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1071323688 10:84491019-84491041 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1071448341 10:85770189-85770211 TGCCTGGGTACCAGCAGCGGTGG - Intronic
1071763323 10:88633879-88633901 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1071999125 10:91177185-91177207 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1072243728 10:93521807-93521829 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1072382848 10:94893205-94893227 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1072388710 10:94959905-94959927 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1072397859 10:95063908-95063930 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1072726970 10:97820341-97820363 TGAGTGGTTACCAGAGGCTGGGG - Intergenic
1072859144 10:98984354-98984376 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1072895274 10:99360936-99360958 TGTGTGGCTAGCAGAAGCTGTGG - Exonic
1072901660 10:99412808-99412830 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1073016912 10:100407177-100407199 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1073587493 10:104725255-104725277 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1073661384 10:105480288-105480310 TGCCTGGGTAACAGCAGCGGTGG + Intergenic
1073684436 10:105736569-105736591 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
1073925026 10:108505248-108505270 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1074027703 10:109653208-109653230 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1074179298 10:111043988-111044010 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1074464904 10:113672264-113672286 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1075490848 10:122867653-122867675 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1075973553 10:126674947-126674969 AGAGTGGGTAGCTGAGGCTGTGG + Intergenic
1077450388 11:2639491-2639513 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1077468502 11:2745622-2745644 TGCGGGGCTGGCAGAGGCTGGGG + Intronic
1077835040 11:5919179-5919201 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1077861026 11:6179976-6179998 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1078485230 11:11716570-11716592 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1078535908 11:12173711-12173733 TGAGAGGGTAGCAGGGGCTGAGG - Intronic
1078681498 11:13480799-13480821 TGCCTGGGTAGCACCAGCAGAGG - Intergenic
1078695570 11:13628366-13628388 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1078726692 11:13938644-13938666 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1078802635 11:14662170-14662192 TGCCTGGGTAACAGCAGCGGTGG - Intronic
1078817910 11:14845201-14845223 TGCCTGGGTACCAGCAGCGGTGG - Intronic
1079037482 11:17033781-17033803 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1079213259 11:18483035-18483057 TGTGTGTGTAGCAGGGGGTGGGG + Intronic
1079337782 11:19586658-19586680 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1079865033 11:25724016-25724038 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1080059297 11:27939922-27939944 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1080082487 11:28237882-28237904 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1080209616 11:29770954-29770976 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1080245986 11:30179270-30179292 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1080253958 11:30268415-30268437 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1080378442 11:31741608-31741630 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1080490948 11:32763457-32763479 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1080712602 11:34764115-34764137 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1080811002 11:35703624-35703646 TGCCTGGGTACCAGCAGCGGTGG - Intronic
1081039476 11:38192597-38192619 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
1081087598 11:38821558-38821580 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1081161568 11:39755888-39755910 TGCCTGGGTGTCAGCAGCTGTGG - Intergenic
1081257169 11:40911408-40911430 TGCCTGGGTATCAGCGTCAGAGG - Intronic
1081389774 11:42515494-42515516 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1081405119 11:42688867-42688889 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1081442917 11:43100278-43100300 TGCCTGGGTACCAGCAGCTGTGG + Intergenic
1081454324 11:43206511-43206533 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1081697670 11:45127615-45127637 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1082112593 11:48293286-48293308 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1082117903 11:48346844-48346866 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1082134592 11:48533188-48533210 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1082135722 11:48547182-48547204 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1082137545 11:48566858-48566880 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1082141699 11:48617035-48617057 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1082147142 11:48683867-48683889 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1082155375 11:48803705-48803727 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1082174423 11:49045477-49045499 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1082577878 11:54832510-54832532 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1082578544 11:54838715-54838737 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1082606298 11:55238104-55238126 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1082647671 11:55748280-55748302 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1082744568 11:56948139-56948161 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1082787511 11:57324897-57324919 GGCGGCGGTAGCAGCGGCGGCGG - Intronic
1082906000 11:58309417-58309439 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1082970581 11:59016092-59016114 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1083006217 11:59349445-59349467 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1083009842 11:59386927-59386949 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1083264924 11:61542269-61542291 TGCCTGGGTTGGAGCGGCTGCGG + Intronic
1083443650 11:62692804-62692826 GGGGTGGGAAGCAGAGGCTGGGG + Intronic
1083494712 11:63041566-63041588 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1083498227 11:63078233-63078255 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1083513653 11:63235922-63235944 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1083521147 11:63313847-63313869 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1084796850 11:71511888-71511910 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1085155976 11:74294724-74294746 TGCCTGGGTATCAGCAGCAGTGG + Intronic
1085222681 11:74888284-74888306 TGCCTGGGTATCAGCGGTGGAGG - Intronic
1085248054 11:75120130-75120152 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1085657088 11:78325669-78325691 TACGTGGGTAGTAGTTGCTGTGG - Intronic
1086012369 11:82120804-82120826 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1086142776 11:83517800-83517822 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1086175362 11:83884809-83884831 TGCCTGGGTACCAGCAGCGGTGG - Intronic
1086422558 11:86651456-86651478 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1086440979 11:86829767-86829789 TGCCTGGGTACCAGCAGCGGTGG + Intronic
1086455366 11:86955093-86955115 ATCGGGGGTAGCAGCGGCAGCGG + Exonic
1086481683 11:87247131-87247153 TGCCTGGGTACCAGCAGCCGTGG + Intronic
1086544456 11:87951676-87951698 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1086565668 11:88223487-88223509 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1086567323 11:88241325-88241347 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1086586900 11:88463124-88463146 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1086691352 11:89790611-89790633 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1086714452 11:90049045-90049067 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1086765458 11:90690967-90690989 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1086874025 11:92073382-92073404 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1086967415 11:93043763-93043785 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1087101711 11:94371218-94371240 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1087103253 11:94385060-94385082 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1087616279 11:100489546-100489568 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1087722577 11:101683680-101683702 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1087859930 11:103141482-103141504 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1087878857 11:103391776-103391798 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1087916717 11:103820086-103820108 TGCTTGGGTATCAGCAGCGGAGG + Intergenic
1088305558 11:108403869-108403891 TGCGAGGATAGCAGTGGCTGGGG + Intronic
1088370449 11:109083346-109083368 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
1088790853 11:113224795-113224817 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1088974810 11:114806057-114806079 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1089101721 11:115967787-115967809 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1089106028 11:116005763-116005785 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1089247497 11:117132946-117132968 TGTGTGGGTAACAGAGACTGAGG - Intergenic
1090902773 11:131047162-131047184 TGGGTGGGTAGGAGAGGCTGAGG + Intergenic
1091045343 11:132319978-132320000 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1091052373 11:132384268-132384290 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1091323967 11:134670437-134670459 TGCCTGGGTAGCATGGGCAGTGG - Intergenic
1091326473 11:134692919-134692941 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1091593364 12:1858553-1858575 TGGGTCGGTACCAGGGGCTGAGG - Intronic
1091845776 12:3655398-3655420 AGCTTGGGTAGCAGCAGCAGTGG + Intronic
1092383609 12:8018773-8018795 TTAGTGGGTCCCAGCGGCTGCGG - Intergenic
1093217626 12:16382417-16382439 TGCCTGGGTATCAGCAGCAGTGG + Intronic
1093265545 12:16999166-16999188 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1093309736 12:17564372-17564394 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1093314160 12:17627806-17627828 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1093344550 12:18024644-18024666 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1093404337 12:18786067-18786089 TGCCTGGGTAACAGCAGCCGTGG - Intergenic
1093501338 12:19815355-19815377 TGCCTGGGTATCAGCAGCGGCGG - Intergenic
1093673026 12:21900171-21900193 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1094162438 12:27405460-27405482 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1094333660 12:29323609-29323631 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1094561175 12:31555333-31555355 TGCCTGGGTATCAGCAGCAGTGG + Intronic
1094805270 12:34084089-34084111 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1095060494 12:37682463-37682485 TGCCTGGGTACCAGCTGCGGTGG - Intergenic
1095165624 12:38968741-38968763 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1095416038 12:41978459-41978481 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1095423337 12:42048767-42048789 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1095424857 12:42063832-42063854 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1095428983 12:42111999-42112021 TGCCTGGGTATCAGCAGCAGTGG - Intronic
1095483350 12:42658647-42658669 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1095490123 12:42725089-42725111 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1095661534 12:44742172-44742194 TGCCTGGGTATCAGCAGCAGTGG - Intronic
1095677109 12:44932555-44932577 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1095816255 12:46426206-46426228 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1095854892 12:46849413-46849435 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1095867906 12:46992661-46992683 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1095873725 12:47057573-47057595 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1096032741 12:48434624-48434646 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1096112403 12:49037358-49037380 TGGGTGGGCATCAGTGGCTGGGG + Exonic
1096433742 12:51570924-51570946 TGCCTGGGTACCAGCAGCAGCGG + Intergenic
1096529890 12:52235919-52235941 TGCGAGGGCCGCAGAGGCTGAGG + Intronic
1096926767 12:55156724-55156746 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1096931150 12:55211279-55211301 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1096954293 12:55509981-55510003 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1097344531 12:58476684-58476706 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1097409007 12:59227600-59227622 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
1097569721 12:61317580-61317602 TGCCTGGGTATCAGCTGCGGAGG - Intergenic
1097578106 12:61420249-61420271 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1097740886 12:63241234-63241256 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1098015459 12:66100009-66100031 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1098057395 12:66522397-66522419 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1098421639 12:70304481-70304503 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1098586045 12:72155671-72155693 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1098642558 12:72856710-72856732 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1098722897 12:73924993-73925015 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1099114673 12:78609330-78609352 TGCTTGGGTATCAGCAGCGGAGG - Intergenic
1099238844 12:80115404-80115426 TGCCTGGGTATCACCCGCTGAGG + Intergenic
1099313875 12:81061524-81061546 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1099486162 12:83232128-83232150 TGCCTGGGTATCAGCTGCTGAGG + Intergenic
1099512387 12:83554394-83554416 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1099538229 12:83871819-83871841 TGCCTAGGTATCAGCAGCTGTGG - Intergenic
1099677938 12:85786261-85786283 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1099720615 12:86357183-86357205 TGCCTGGGTAGCACCAGCAGAGG - Intronic
1099764958 12:86971239-86971261 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1099880935 12:88466509-88466531 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1100238272 12:92683478-92683500 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1100291968 12:93224234-93224256 TGTGTGTGTTGCAGGGGCTGGGG + Intergenic
1100653030 12:96611249-96611271 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1100896350 12:99186571-99186593 TGCCTGGGTATCAGCGGCAGAGG - Intronic
1101028994 12:100642098-100642120 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1101768203 12:107722965-107722987 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1102111137 12:110366505-110366527 TGGGTGGGGAGCAGCCTCTGAGG - Intergenic
1103627457 12:122230877-122230899 TGCAGGAGTAGCAGCAGCTGTGG + Exonic
1103971774 12:124677212-124677234 TGCCTGGGGAGCAGGGGCTTGGG - Intergenic
1104694731 12:130854619-130854641 TGTGTGGGTATCACAGGCTGCGG + Intergenic
1104737191 12:131143013-131143035 TGGATGGGTGGCACCGGCTGAGG - Intergenic
1105283563 13:18984567-18984589 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1105311458 13:19215999-19216021 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1105351095 13:19617018-19617040 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1105420089 13:20244127-20244149 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1105598287 13:21861032-21861054 TGCCTGGGTAGCAGCAGCGGTGG + Intergenic
1105789153 13:23780316-23780338 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1106169627 13:27277910-27277932 AGCCTGGGTAGCAGAGGTTGCGG - Intergenic
1106445698 13:29828954-29828976 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1106640883 13:31583769-31583791 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1106991613 13:35427412-35427434 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1107764225 13:43716338-43716360 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1107973670 13:45669344-45669366 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
1108137262 13:47378977-47378999 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1108187963 13:47907376-47907398 AGCCTGGGAAGCAGAGGCTGCGG + Intergenic
1108553311 13:51567874-51567896 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1108562007 13:51653685-51653707 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1108627793 13:52248367-52248389 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1108658269 13:52558086-52558108 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1109113394 13:58351836-58351858 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1109972065 13:69783040-69783062 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1110001573 13:70209568-70209590 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1110152359 13:72270756-72270778 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1110415370 13:75246443-75246465 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1110813931 13:79840516-79840538 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1110949334 13:81464857-81464879 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1111004453 13:82229865-82229887 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1111322665 13:86650887-86650909 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
1111680715 13:91438440-91438462 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1111746857 13:92281609-92281631 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1111765077 13:92517543-92517565 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1112232453 13:97602704-97602726 TGCCTGGGTATCACCAGCTGAGG - Intergenic
1112745539 13:102522875-102522897 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1113021221 13:105889657-105889679 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1113107057 13:106783527-106783549 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1113311757 13:109139960-109139982 TGGGTGGGTAGCAGCAGAAGTGG + Intronic
1113513652 13:110874613-110874635 TGGGAGGGTAGCGGGGGCTGCGG - Intergenic
1113749930 13:112769899-112769921 TGCCTGTGAAGCAGCAGCTGTGG - Intronic
1113897765 13:113776646-113776668 CGCCTGGTTAGCAGGGGCTGGGG + Intronic
1114171913 14:20280894-20280916 TGCCTGGGTATCAGCAGCAGTGG - Intronic
1114386475 14:22260847-22260869 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1114432823 14:22677319-22677341 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1114749232 14:25184269-25184291 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1114801068 14:25776598-25776620 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1114964432 14:27939765-27939787 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1115368230 14:32583268-32583290 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1115412266 14:33088887-33088909 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1115477148 14:33826321-33826343 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1115512460 14:34150927-34150949 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1115624801 14:35180013-35180035 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1115723252 14:36185404-36185426 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
1115743557 14:36412560-36412582 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1115792674 14:36897813-36897835 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1115968817 14:38922521-38922543 TGCCTGGGTATCAGCCGCAGAGG - Intergenic
1116036953 14:39638802-39638824 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1116198257 14:41757036-41757058 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1116209136 14:41910875-41910897 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1116405024 14:44556915-44556937 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1116474600 14:45325516-45325538 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1116618777 14:47172511-47172533 TGCTTGGGTATCAGCAGCGGTGG - Intronic
1116711277 14:48371535-48371557 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1116773034 14:49149267-49149289 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1116871533 14:50073168-50073190 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1117115181 14:52503435-52503457 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1117204243 14:53424592-53424614 TGCCTGGGTATCACCGGCGGAGG - Intergenic
1117280406 14:54234733-54234755 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
1117358517 14:54948867-54948889 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1117807961 14:59514028-59514050 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1118146585 14:63144262-63144284 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1118439363 14:65798851-65798873 TGCGATGGTGGCAGTGGCTGTGG + Intergenic
1118973521 14:70657320-70657342 TGCGTGGGAAGCAGCAGCTCTGG + Intronic
1119699703 14:76745125-76745147 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1119967545 14:78933937-78933959 TGGGTGGGTACCAGAAGCTGGGG - Intronic
1120084234 14:80250963-80250985 TGCCTGGGTATCAGCAGCAGTGG + Intronic
1120670741 14:87360002-87360024 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1120675658 14:87418833-87418855 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1120709690 14:87780731-87780753 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1120778190 14:88460988-88461010 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1121298955 14:92853671-92853693 TGCCTGGGTATCAGCAGCTGAGG - Intergenic
1121376693 14:93418298-93418320 TGCCTGGGTACCAGCAGCGGTGG + Intronic
1122153624 14:99737758-99737780 TGGGTGGGTGACAGCCGCTGAGG + Intronic
1122628338 14:103095658-103095680 TCCGAGGGCAGCAGCGGCTCAGG + Intergenic
1122789768 14:104179273-104179295 AGCGCAGGCAGCAGCGGCTGCGG + Exonic
1123001927 14:105300481-105300503 TTCGTGGAGAGCAGCGGCGGCGG - Exonic
1202876721 14_KI270722v1_random:9329-9351 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1202928069 14_KI270725v1_random:11252-11274 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1123822435 15:24044040-24044062 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1123877541 15:24639211-24639233 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1123978023 15:25570996-25571018 ATCGTGGCTAGCAGGGGCTGGGG + Intergenic
1124056431 15:26244471-26244493 TGCGCGGGAAGCAGCCTCTGGGG - Intergenic
1124257804 15:28160012-28160034 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1124561323 15:30776001-30776023 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1124669209 15:31623043-31623065 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1125058506 15:35391121-35391143 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1125290568 15:38141973-38141995 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1125358331 15:38840216-38840238 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1125456042 15:39859786-39859808 TGGGTGGTTAACGGCGGCTGGGG + Intronic
1126052030 15:44694895-44694917 TGTGTGGGTAACAGCAGCTAAGG - Intronic
1126057079 15:44740093-44740115 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1126248707 15:46541516-46541538 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1126324437 15:47461328-47461350 TGTGTGTGTGGCAGTGGCTGTGG - Intronic
1126722084 15:51591778-51591800 TGCCTGGGTATCAGCAGCTGAGG - Intronic
1126862811 15:52903220-52903242 TGCCTGGGTATCACCAGCTGAGG - Intergenic
1126889046 15:53184086-53184108 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1127016996 15:54699667-54699689 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1128416693 15:67453504-67453526 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1128677459 15:69622299-69622321 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1128853780 15:70989910-70989932 TGCCTGGGTACCAGCAGCGGTGG + Intronic
1128854092 15:70992662-70992684 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1129548740 15:76425892-76425914 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1129564554 15:76608296-76608318 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1129581809 15:76819448-76819470 TGCCTGGGTATCAGCAGCAGTGG - Intronic
1129631055 15:77260984-77261006 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1129821947 15:78608443-78608465 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1130261134 15:82355264-82355286 GGCGGCGGCAGCAGCGGCTGCGG - Intergenic
1130280101 15:82513754-82513776 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130390039 15:83447369-83447391 TGCGAGTGTGACAGCGGCTGTGG + Exonic
1130432415 15:83861485-83861507 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1130450187 15:84043251-84043273 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1130471476 15:84229940-84229962 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130478970 15:84344511-84344533 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130492800 15:84443620-84443642 GGCGGCGGCAGCAGCGGCTGCGG - Intergenic
1130593770 15:85234567-85234589 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130653498 15:85775784-85775806 TGCCTGGGTTGCAGAGGCTGTGG + Intronic
1130737443 15:86565410-86565432 TGCCTGGGTATCAGCAGCAGGGG + Intronic
1131546370 15:93319317-93319339 GGCGGGGGTAGCAGAGGGTGGGG - Intergenic
1131555505 15:93395235-93395257 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1131595429 15:93793078-93793100 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1131929009 15:97418589-97418611 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1131930307 15:97433547-97433569 TGCCTGGGCATCAGCGGCAGTGG - Intergenic
1132139658 15:99381810-99381832 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1132625022 16:887575-887597 GGCGTGGGTGGGAGTGGCTGAGG - Intronic
1132627143 16:896682-896704 TGCGGGGGGAGCAGTGGCGGTGG - Intronic
1133432439 16:5750145-5750167 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1134093508 16:11404004-11404026 TGCATGTGGAGCAGCAGCTGCGG - Intronic
1134765025 16:16750313-16750335 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1134767524 16:16774047-16774069 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1134879645 16:17734000-17734022 TGCATGGGTATCAGCAGCGGAGG - Intergenic
1134898038 16:17907258-17907280 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1134981028 16:18608898-18608920 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1135025492 16:18996145-18996167 GGGTTGGGGAGCAGCGGCTGAGG + Intronic
1136127279 16:28193258-28193280 TGCCGGGGTGGCAGCTGCTGGGG + Intronic
1136220118 16:28823296-28823318 TGCGTGGGGGGCGGCTGCTGGGG - Exonic
1136297121 16:29309919-29309941 TGGCTGGGAAGCAGAGGCTGCGG - Intergenic
1136606652 16:31338731-31338753 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1136652904 16:31688053-31688075 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1136736610 16:32473179-32473201 TGAGTGGGTGTCAGAGGCTGGGG - Intergenic
1137083679 16:36097188-36097210 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1137224587 16:46490702-46490724 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1137326102 16:47438547-47438569 TGCCTGGGTATCAGCAGCAGTGG - Intronic
1137347969 16:47683043-47683065 TGCCTGGGTATCAGCAGCAGTGG + Intronic
1137437191 16:48465501-48465523 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1137877653 16:52012893-52012915 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1137907132 16:52334257-52334279 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1138324794 16:56155362-56155384 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1139257029 16:65551973-65551995 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
1139376027 16:66496830-66496852 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1140179029 16:72695658-72695680 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1140984101 16:80141592-80141614 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1140991881 16:80220548-80220570 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1141641278 16:85342992-85343014 GGAGTGGGGAGCAGAGGCTGTGG + Intergenic
1142114454 16:88348991-88349013 TGCGTGGGAGGCAGGGGCCGAGG - Intergenic
1142356737 16:89604937-89604959 GGGGTGGGGAGCAGCGGCTGCGG + Intergenic
1203016458 16_KI270728v1_random:356398-356420 TGAGTGGGTGTCAGAGGCTGGGG + Intergenic
1203034793 16_KI270728v1_random:629556-629578 TGAGTGGGTGTCAGAGGCTGGGG + Intergenic
1142538628 17:639694-639716 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1143257655 17:5573678-5573700 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1143422673 17:6807747-6807769 TGCCTGGGTATCAGCTGCGGAGG + Intronic
1144746857 17:17621695-17621717 TGCGTGGGTTGCAGCAGCCTGGG + Intergenic
1145396695 17:22502217-22502239 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1145690751 17:26736564-26736586 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1145716674 17:27029445-27029467 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1145861288 17:28212393-28212415 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1146561987 17:33877970-33877992 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1146740007 17:35275217-35275239 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1147159969 17:38563977-38563999 TGCTTGGGGAGAAGGGGCTGTGG + Intronic
1147702784 17:42406307-42406329 TGGGTGGGTAGGTGCAGCTGTGG - Intronic
1148557039 17:48584948-48584970 TGCGTGAGTGGGAGCGGCGGAGG - Intronic
1148782617 17:50130170-50130192 TGCGCGGGTGGGAGCGGCTCCGG + Intergenic
1148848394 17:50542077-50542099 GGCGTGGGCAGCAGCGGCTGCGG - Exonic
1149365547 17:55939810-55939832 TGCCTGGGTAGCACCAGCAGAGG - Intergenic
1149371963 17:56003245-56003267 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1149408689 17:56381150-56381172 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1150611560 17:66737630-66737652 TGGGTGTGTAGCAGTGGCCGCGG + Intronic
1150934123 17:69617224-69617246 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1151960366 17:77402509-77402531 TGCGTCGGTGGCAGGGGCAGTGG - Exonic
1152696770 17:81801531-81801553 CCTGTGGGTAGCAGAGGCTGAGG + Intergenic
1152764118 17:82126655-82126677 TGGGTGGGTGGCGGAGGCTGAGG + Intronic
1152860934 17:82696990-82697012 TGCGGGGGCAGCGGCGCCTGGGG + Intronic
1153221388 18:2865489-2865511 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1153541909 18:6164542-6164564 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1153790863 18:8578499-8578521 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1154060823 18:11058165-11058187 TGCCTGGGTAACAGCAGCGGAGG - Intronic
1154181083 18:12140626-12140648 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1154403532 18:14065832-14065854 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1156280116 18:35628429-35628451 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1156296016 18:35791458-35791480 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1156308190 18:35898328-35898350 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1156532522 18:37832042-37832064 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1156725231 18:40119340-40119362 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1156908284 18:42381037-42381059 TGTGTGGGTATCACCAGCTGAGG + Intergenic
1156932433 18:42661252-42661274 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1157217669 18:45799343-45799365 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1157355300 18:46928364-46928386 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1157632008 18:49107685-49107707 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1157920058 18:51705891-51705913 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1158177078 18:54669459-54669481 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1158347106 18:56526418-56526440 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1158647204 18:59257492-59257514 TGCTTGGGTATCAGCAGCAGAGG - Intergenic
1158834427 18:61315862-61315884 TGCCTGGGTAACAGCAGCGGTGG + Intergenic
1159126574 18:64231607-64231629 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1159155192 18:64573388-64573410 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1159635026 18:70795084-70795106 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1160345368 18:78127932-78127954 GGCATGGGAAGCAGAGGCTGAGG - Intergenic
1160830519 19:1102762-1102784 TGCGTGGGCAGCTGCCCCTGGGG + Intergenic
1161135017 19:2614457-2614479 TGTGTGGGTGCCAGGGGCTGGGG - Intronic
1161374224 19:3930996-3931018 CGCGTGGGTGCCAGGGGCTGGGG - Intergenic
1161402234 19:4071966-4071988 TGCGTGGTTGTCAGAGGCTGGGG + Intergenic
1161562279 19:4980243-4980265 TGTGTGGGTACCAGCAGATGGGG - Intronic
1162311991 19:9913411-9913433 TGCGGCGGCGGCAGCGGCTGTGG + Intronic
1162399793 19:10438471-10438493 AGAGTGGGTGCCAGCGGCTGGGG - Intronic
1163777937 19:19228684-19228706 GGCTTGGGGAGCAGGGGCTGGGG + Intronic
1163881084 19:19923213-19923235 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1163940789 19:20491162-20491184 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1163955317 19:20633064-20633086 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1164157794 19:22607083-22607105 TGTGTGAGTGGCAGCGGCTTGGG + Intergenic
1164307582 19:24018616-24018638 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1164357902 19:27463692-27463714 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1165261911 19:34625981-34626003 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1165607413 19:37117333-37117355 TGCCTGGGTATCAGCAGCAGTGG - Intronic
1165755155 19:38288618-38288640 TCGGTGGGTAGCAGCTGCCGGGG - Intronic
1165980560 19:39719223-39719245 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1166022292 19:40043181-40043203 TGCCTGGGTATCAGCAGCAGTGG + Intronic
1166171921 19:41033911-41033933 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1166446539 19:42862809-42862831 TGTGTGGGTACCAGCAGCGGTGG + Intronic
1166613895 19:44226043-44226065 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1166731908 19:45064125-45064147 TGCTGCGGCAGCAGCGGCTGCGG - Exonic
1168437903 19:56336862-56336884 TGCCTGGGTATCAGCAGCAGTGG + Intronic
1202670412 1_KI270709v1_random:44671-44693 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1202673946 1_KI270710v1_random:23490-23512 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
925116959 2:1387989-1388011 TGCCTGGGTATCAGCAGCAGAGG + Intronic
925793699 2:7520240-7520262 TGCGTAAGTGGCAGCGGCAGTGG - Intergenic
925989000 2:9238610-9238632 TGCATGGGGAGGAGAGGCTGAGG + Intronic
926068285 2:9861808-9861830 TGCCTGGGTATCAGCAGCAGTGG - Intronic
926338792 2:11886737-11886759 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
926534994 2:14099997-14100019 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
926568693 2:14506734-14506756 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
926992703 2:18697467-18697489 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
927058359 2:19389244-19389266 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
927301994 2:21526248-21526270 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
927634743 2:24805604-24805626 TGCCTGGGTATCAGCAGCGGAGG + Intronic
927638701 2:24833668-24833690 TGCGTGGGGATCAAGGGCTGGGG - Intronic
928492277 2:31796174-31796196 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
928628989 2:33170873-33170895 TGCCTGGGTACCAGCAGCGGTGG - Intronic
928795426 2:35013294-35013316 TGCCTGGGTAACAGCAGCGGAGG - Intergenic
928818198 2:35325034-35325056 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
928852598 2:35767297-35767319 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
928881150 2:36097860-36097882 TGCCTGGGTAGCAGCAGCGGTGG - Intergenic
929038937 2:37723999-37724021 TGCCTGGGTATCAGCAGCAGAGG - Intronic
929068958 2:38009990-38010012 TGCCTGGGTATCAGCAGCAGAGG + Intronic
929082738 2:38137726-38137748 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
929233111 2:39580293-39580315 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
929256048 2:39812981-39813003 TGCCTGGGTAGCACCAGCAGAGG + Intergenic
929638258 2:43548144-43548166 TGCCTGGGTACCAGCAGCGGTGG + Intronic
929843972 2:45502151-45502173 TGCCTGGGTATCAGCAGCAGAGG - Intronic
930276033 2:49312285-49312307 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
930289940 2:49481198-49481220 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
930801071 2:55442953-55442975 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
930868101 2:56142416-56142438 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
930911614 2:56636519-56636541 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
931043700 2:58326188-58326210 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
931194263 2:60035710-60035732 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
931475741 2:62586129-62586151 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
931477700 2:62606084-62606106 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
931574722 2:63707906-63707928 TGCCTGGGTATCAGCAGCGGTGG + Intronic
931822668 2:65968348-65968370 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
931860742 2:66352158-66352180 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
931888841 2:66647875-66647897 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
931928269 2:67098868-67098890 TGCGTGGGTATCAGCAGCGGAGG - Intergenic
931935768 2:67195086-67195108 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
931950575 2:67356921-67356943 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
932170173 2:69548061-69548083 TGAGTGGTTATCAGGGGCTGTGG + Intronic
932642325 2:73461317-73461339 TGCCTGGGTATCAGCAGCGGTGG - Intronic
932649450 2:73539246-73539268 TGCCTGGGTATCAGCAGCAGAGG - Intronic
932702938 2:74003278-74003300 TGTGTGTGTAGCAGCAGCTGAGG + Intronic
932935330 2:76095928-76095950 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
933016631 2:77136339-77136361 TGCCTGGGTATCAGCAGCGGAGG - Intronic
933023156 2:77220068-77220090 TGCCTGGGTATCAGCAGCGGTGG - Intronic
933257522 2:80098285-80098307 TGCCTGGGTATCAGCAGCGGTGG + Intronic
933269212 2:80215541-80215563 TGCCTGGGTAACACCAGCTGAGG + Intronic
933579129 2:84104861-84104883 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
933593955 2:84263217-84263239 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
933618574 2:84510853-84510875 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
934187764 2:89762296-89762318 TGAGTGGGTGTCAGGGGCTGGGG - Intergenic
934251022 2:90355614-90355636 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
934258541 2:91447796-91447818 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
934308853 2:91845652-91845674 TGAGTGGGTGTCAGGGGCTGGGG + Intergenic
934576192 2:95402954-95402976 TGTGTGGTCAGAAGCGGCTGGGG - Intronic
934693445 2:96379825-96379847 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
934831142 2:97526266-97526288 TGCCTGGGTATCAGCAGCGGTGG - Intronic
934962975 2:98694078-98694100 TGGGTGGGTGGCTGGGGCTGGGG - Intronic
934997510 2:98978668-98978690 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
935118198 2:100156940-100156962 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
935369054 2:102325214-102325236 TGCCTGGGTATCAGCAGCAGAGG - Intronic
935421976 2:102879305-102879327 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
936032054 2:109080274-109080296 TGGCTGGGCAGCAGAGGCTGGGG + Intergenic
936036448 2:109116910-109116932 TGCCTGGGTAACAGCAGCGGTGG + Intergenic
936172931 2:110191869-110191891 TGCCTGGGTATCAGCAGCAGAGG - Intronic
937301889 2:120847744-120847766 TGCGTGGGGGGCAGGGGCGGGGG + Intronic
937741325 2:125358181-125358203 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
937780056 2:125826381-125826403 TGCCTGGGTAACAGCAGCGGTGG - Intergenic
938567233 2:132529715-132529737 TGCCTGGGTATCAGCAGCGGTGG - Intronic
938720255 2:134061116-134061138 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
938975131 2:136469526-136469548 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
938987863 2:136596899-136596921 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
939031027 2:137075865-137075887 TGCCTGGGTATCAGCAGCGGTGG + Intronic
939074820 2:137587615-137587637 TGCCTGGGTATCAGCAGCGGAGG + Intronic
939479326 2:142728710-142728732 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
939943479 2:148380832-148380854 TGCCTGGGTATCAGCAGCGGTGG - Intronic
940055215 2:149506520-149506542 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
940059568 2:149550355-149550377 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
940067164 2:149643152-149643174 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
940080504 2:149795885-149795907 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
940095233 2:149966580-149966602 TGCTTGGGTATCAGCAGCGGAGG - Intergenic
940325331 2:152419522-152419544 TGAGTGGTTACCAGGGGCTGGGG + Intronic
940379365 2:152996570-152996592 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
940417392 2:153439099-153439121 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
940695084 2:156967615-156967637 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
940992880 2:160115374-160115396 TGCCTGGGTATCAGCAGCGGTGG - Intronic
941056824 2:160798181-160798203 TGCCTGGGTAACAGCAGCGGTGG - Intergenic
941623896 2:167809563-167809585 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
941776612 2:169400028-169400050 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
942411820 2:175717431-175717453 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
942790647 2:179757242-179757264 TGCCTGGGTATCAGCAGCGGAGG + Intronic
942859347 2:180590888-180590910 TGCTTGGGTATCAGCAGCAGAGG + Intergenic
943020354 2:182565332-182565354 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
943031176 2:182687395-182687417 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
943125365 2:183789471-183789493 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
943136302 2:183916616-183916638 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
943303480 2:186231178-186231200 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
943946633 2:194073736-194073758 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
944077145 2:195744717-195744739 TGCCTGGGTAACAGCAGCGGTGG - Intronic
944307790 2:198197093-198197115 TGCCTGGGTATCAGCAGCGGAGG - Intronic
944599791 2:201291388-201291410 TGCCTGGGTATCAGCAGCGGAGG - Intronic
945343481 2:208685645-208685667 TGCCTGGGTATCAGCAGCAGAGG + Intronic
945349537 2:208760980-208761002 TGCCTGGGTATCAGCAGCAGAGG - Intronic
945669515 2:212785975-212785997 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
945873599 2:215253817-215253839 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
946455023 2:219818783-219818805 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
946782516 2:223205821-223205843 TGCGTGGGTGCCAGCAGCAGTGG - Intergenic
947056315 2:226108099-226108121 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
947259470 2:228204430-228204452 TGCCTGGGTAACAGCAGCGGTGG + Intergenic
947841382 2:233209946-233209968 TTCGTGGGTGGCAGTGTCTGTGG - Intergenic
948516091 2:238504717-238504739 TGTGTGGGAAGCAGGGGCGGTGG + Intergenic
949026425 2:241768383-241768405 TGCGTGGGCAGCAGGGGGCGTGG + Exonic
1170514983 20:17120063-17120085 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
1170719753 20:18866492-18866514 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1171065477 20:22010282-22010304 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
1171068722 20:22045738-22045760 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
1171075185 20:22115478-22115500 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1171140363 20:22735503-22735525 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1171168267 20:22992852-22992874 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1171191343 20:23161723-23161745 GGGGTGGGGTGCAGCGGCTGTGG + Intergenic
1171357247 20:24557584-24557606 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1171407668 20:24922573-24922595 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1171514529 20:25718943-25718965 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1171772205 20:29331332-29331354 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1173543783 20:43876416-43876438 TGCCTGGGTATCACCGGCGGAGG + Intergenic
1174166615 20:48587985-48588007 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1175026184 20:55905523-55905545 TGCCTGGGTAACAGCAGCAGTGG + Intergenic
1175142582 20:56872050-56872072 TGCAAGGGTGGCAGCCGCTGGGG - Intergenic
1175177994 20:57125179-57125201 TTCGTGGTTACCAGGGGCTGGGG + Intergenic
1175509609 20:59514996-59515018 TGTGTGGAAAGCAGCAGCTGTGG + Intergenic
1176145062 20:63561878-63561900 CCCGTGGGGAGAAGCGGCTGGGG - Exonic
1176266442 20:64211965-64211987 TGTGTGGGGAGCACAGGCTGAGG - Intronic
1176359461 21:5982828-5982850 TGGGTGGGTCGCAGCGGTGGTGG + Intergenic
1176420980 21:6515053-6515075 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1176431521 21:6579172-6579194 TGCGGGGGTAGCAGAGGGTTCGG - Intergenic
1176590094 21:8639913-8639935 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1176637981 21:9266771-9266793 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1177132216 21:17272153-17272175 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1178044479 21:28677759-28677781 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1178965202 21:37109923-37109945 TGCCTGGGTATCAGCAGCAGTGG - Intronic
1179301024 21:40110278-40110300 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1179696471 21:43123372-43123394 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1179706915 21:43186634-43186656 TGCGGGGGTAGCAGAGGGTTCGG - Intergenic
1179764057 21:43555722-43555744 TGGGTGGGTCGCAGCGGTGGTGG - Intronic
1179903588 21:44407617-44407639 TTCGTGGGTGGCTGTGGCTGAGG - Intronic
1179943451 21:44654530-44654552 CGGGTGGGTAGCAGGTGCTGGGG + Exonic
1180272924 22:10616906-10616928 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1180370981 22:12036638-12036660 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1180422020 22:12874268-12874290 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1180523912 22:16235898-16235920 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1180535936 22:16392740-16392762 TGAGTGGGTGTCAGGGGCTGGGG + Intergenic
1180575259 22:16767221-16767243 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1180637066 22:17269793-17269815 TGGGTGGGTAGAAGTGGCAGGGG - Intergenic
1181082418 22:20424190-20424212 TGCGGGGGGTGCAGAGGCTGCGG - Intergenic
1181169429 22:21000003-21000025 AGCGGCGGGAGCAGCGGCTGCGG - Exonic
1181175521 22:21032632-21032654 TGGGTGTGTGGCAGCGGGTGGGG - Intronic
1181822772 22:25488382-25488404 TGCGTGGGCAGCAGTGGAGGTGG + Intergenic
1181935222 22:26433582-26433604 TGGGGGGGAAGGAGCGGCTGGGG - Exonic
1182165084 22:28164506-28164528 TGCCTGGGTATCAGCAGCAGTGG - Intronic
1182167661 22:28192151-28192173 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1182789893 22:32942308-32942330 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1182996523 22:34817637-34817659 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1183039572 22:35166516-35166538 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1183741322 22:39670186-39670208 GGCGTGAGGAGAAGCGGCTGCGG + Exonic
1184886680 22:47350798-47350820 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1185213936 22:49587741-49587763 TGGGTTGGTGGCAGCTGCTGTGG - Intronic
1203236092 22_KI270732v1_random:2581-2603 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
949137187 3:581774-581796 TGCCTGGGTACCAGCCGCAGTGG + Intergenic
949173785 3:1034432-1034454 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
949209276 3:1478329-1478351 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
949308651 3:2671877-2671899 TGCCTGGGTATCAGCAGCGGAGG + Intronic
949423441 3:3890929-3890951 TGCCTGGGTATCACCGGCAGAGG + Intronic
949443588 3:4110203-4110225 TGCCTGGGTATCAGCAGCGGAGG + Intronic
949468311 3:4366996-4367018 TGCCTGGGTGTCAGCGGCGGTGG + Intronic
949532157 3:4966584-4966606 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
949717471 3:6950335-6950357 TGCCTGGGTATCAGCAGCAGTGG + Intronic
950420052 3:12893031-12893053 TGCGTGGGGTGCAGGGGTTGGGG - Intergenic
950597146 3:13994996-13995018 TGCCTGGGTATCAGCAGCGGAGG + Intronic
950605036 3:14070945-14070967 TGCCTGGGTATCAGCAGCAGAGG - Intronic
950781502 3:15396765-15396787 TGCCTGGGTATCAGCAGCAGAGG + Intronic
950835122 3:15912517-15912539 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
950919294 3:16677470-16677492 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
951042629 3:18004967-18004989 TGCCTGGGTATCAGCAGCAGAGG + Intronic
951672866 3:25204704-25204726 TGCCTGGGTATCAGCAGCAGAGG + Intronic
951769923 3:26244343-26244365 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
951861919 3:27263096-27263118 TGCCTGGGTATCAGCAGCGGAGG + Intronic
952290620 3:32011303-32011325 TGCCTGGGTATCAGCAGCGGAGG - Intronic
952319555 3:32263314-32263336 TGCCTGGGTATCAGCAGCGGAGG - Intronic
952574996 3:34763934-34763956 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
952837654 3:37618241-37618263 TGCCTGGGTATCAGCAGCGGAGG + Intronic
953001057 3:38933086-38933108 TGCCTGGGTACCAGCAGCGGTGG - Intronic
953105768 3:39877621-39877643 TGCCTGGGTAACAGCAGCGGTGG + Intronic
953116249 3:39994900-39994922 TGCCTGGGTATCAGCAGCAGAGG - Intronic
953130691 3:40134745-40134767 TGCCTGGGTATCAGCAGCGGTGG - Intronic
953145693 3:40272226-40272248 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
953289436 3:41647472-41647494 TGCCTGGGTATCAGCAGCGGTGG + Intronic
953354057 3:42239346-42239368 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
953470749 3:43163948-43163970 TGTGTGGGTAGCAGGAGGTGAGG + Intergenic
954548222 3:51456775-51456797 TGCCTGGGTATCAGCAGCGGTGG - Intronic
954633409 3:52058820-52058842 TGCCTGGGTAGTGGGGGCTGGGG - Intergenic
955030306 3:55209978-55210000 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
955423487 3:58763817-58763839 TGCCTGGGTATCAGCAGCGGAGG + Intronic
955478075 3:59360082-59360104 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
955481674 3:59395998-59396020 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
955652474 3:61210091-61210113 TGCCTGGGTATCAGCAGCCGTGG + Intronic
955652763 3:61211869-61211891 TGCCTGGGTATCAGCAGCAGTGG - Intronic
955669840 3:61391950-61391972 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
955854323 3:63256431-63256453 TGCCTGGGTATCAGCAGCAGAGG - Intronic
956215443 3:66843645-66843667 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
956222183 3:66916151-66916173 CGCCTGGGTATCAGCAGCTGAGG - Intergenic
956265758 3:67393884-67393906 TGCCTGGGTATCAGTGGCGGTGG - Intronic
956301810 3:67780889-67780911 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
956394537 3:68811034-68811056 TGCCTGGGTATCAGCAGCGGAGG - Intronic
956926228 3:73991556-73991578 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
956954279 3:74318618-74318640 TGCCTGGGTATCAGCAGCGGTGG + Intronic
957088857 3:75708329-75708351 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
957324583 3:78676038-78676060 TGCCTGGGTACCAGCAGCGGTGG - Intronic
957565486 3:81878973-81878995 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
957867170 3:86039945-86039967 TGCCTGGGTATCAGCAGCAGAGG - Intronic
957942052 3:87017955-87017977 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
957948753 3:87097523-87097545 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
958176010 3:89996821-89996843 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
958512332 3:95065082-95065104 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
958569507 3:95861235-95861257 TGCGTGAGTATCAGCAGCAGAGG - Intergenic
958624440 3:96606619-96606641 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
958651459 3:96941877-96941899 TGCCTGGGTACCAGCAGCGGTGG + Intronic
958749204 3:98174949-98174971 TGCCTGGGTATCAGCAGCGGTGG - Intronic
958835473 3:99140324-99140346 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
959100972 3:102009051-102009073 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
959358999 3:105366933-105366955 AGCGGTGGTAGCAGCGGCAGCGG - Exonic
959504769 3:107144942-107144964 TGCCTGGGTAACAGCAGCGGTGG - Intergenic
959953786 3:112212068-112212090 TGCCTGGGTATCAGCAGCAGAGG - Intronic
959955981 3:112238736-112238758 TGCCTGGGTATCAGCAGCAGAGG + Intronic
960074873 3:113472648-113472670 TGCCTGGGTATCAGCAGCGGTGG - Intronic
960558411 3:119055040-119055062 TGCCTGGGTATCAGCAGCAGTGG - Intronic
960568855 3:119165354-119165376 TGCCTGGGTATCAGCAGCGGTGG - Intronic
960612505 3:119568455-119568477 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
960715871 3:120573869-120573891 TGCCTGGGTAACAGCAGCGGTGG - Intergenic
960827967 3:121812107-121812129 TGCCTGGGTATCAGCAGCAGAGG - Intronic
960919729 3:122733737-122733759 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
961958850 3:130832666-130832688 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
962004296 3:131332329-131332351 TGCCTGGGTAACAGCAGCGGTGG - Intronic
962301883 3:134250631-134250653 TGCGTGGGGCGGCGCGGCTGGGG - Exonic
962460258 3:135605080-135605102 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
962643575 3:137413330-137413352 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
962657030 3:137557629-137557651 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
962666769 3:137661429-137661451 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
962690929 3:137897456-137897478 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
962761452 3:138518544-138518566 TGCCTGGGTATCAGCAGCAGAGG - Intronic
963050654 3:141140610-141140632 TGCCTGGGTATCAGCAGCGGTGG + Intronic
963070413 3:141300819-141300841 TGCTTGGGTATCAGCAGCGGAGG + Intergenic
963109113 3:141670756-141670778 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
963159905 3:142140673-142140695 TGCCTGGGTATCAGCAGCAGAGG + Intronic
963191681 3:142480366-142480388 TGCCTGGGTATCAGCAGCGGAGG + Intronic
963281808 3:143391313-143391335 TGCCTGGGTATCAGCAGCGGAGG - Intronic
963303231 3:143621477-143621499 TGCCTGGGTATCAGCAGCGGAGG - Intronic
963387867 3:144619903-144619925 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
963567303 3:146945950-146945972 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
963678818 3:148348116-148348138 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
963825229 3:149945779-149945801 TGCCTGGGTATCAGCAGCGGAGG - Intronic
963978558 3:151510337-151510359 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
964100340 3:152981055-152981077 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
964155981 3:153584832-153584854 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
964173450 3:153797653-153797675 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
964189762 3:153988672-153988694 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
964228859 3:154438852-154438874 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
964325658 3:155542750-155542772 TGCCTGGGTACCAGCAGCAGTGG - Intronic
964463767 3:156966990-156967012 TGCCTGGGTATCAGCAGCGGAGG - Intronic
964588053 3:158329516-158329538 TGCCTGGGTATCAGCAGCAGAGG + Intronic
964696206 3:159510747-159510769 TGCCTGGGTATCAGCAGCAGAGG + Intronic
964860405 3:161195589-161195611 TGCCTGGGTATCAGCAGCAGAGG + Intronic
964902056 3:161671388-161671410 TGCCCGGGTAGCAGCTGCTGTGG + Intergenic
965025585 3:163297598-163297620 TGCGTGGGTATCACCAGCGGAGG - Intergenic
965137327 3:164787655-164787677 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
965271145 3:166618285-166618307 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
965370724 3:167858932-167858954 AGAGTGGTTATCAGCGGCTGGGG + Intergenic
965717799 3:171625714-171625736 TGCCTGGGTACCAGCAGCGGTGG - Intronic
965886329 3:173451339-173451361 TGCCTGGGTATCAGCAGCGGCGG + Intronic
965973208 3:174588656-174588678 TGCCTGGGTATCAGCAGCAGAGG + Intronic
965974593 3:174606032-174606054 TGCCTGGGTATCAGCAGCGGTGG - Intronic
966136656 3:176706400-176706422 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
966493816 3:180557134-180557156 TGCCTGAGTATCAGCAGCTGAGG - Intergenic
967797111 3:193610315-193610337 TGCCTGGGTATCAGCAGCGGAGG + Intronic
967862266 3:194160977-194160999 TGAGTGTGTAGCAGTGGGTGTGG + Intergenic
968211060 3:196849189-196849211 TGCGTGGGGAACAGCAGCTAGGG - Intergenic
968272102 3:197410768-197410790 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1202748914 3_GL000221v1_random:138250-138272 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
968487679 4:871695-871717 TGGGTGGGGAGCAGGGGCAGGGG + Intronic
968691401 4:1992170-1992192 TGCCTGGGCAGCAGGGGGTGGGG + Intronic
969005722 4:4018837-4018859 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
970022230 4:11582650-11582672 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
970278258 4:14425819-14425841 TGCCTGGGTAACAGCAGCGGTGG + Intergenic
970496351 4:16629463-16629485 TGCGTGGGTATCACCAGCAGAGG - Intronic
970611580 4:17729627-17729649 TGCCTGGGTATCAGCAGCAGTGG - Intronic
970623329 4:17849388-17849410 TGCCTGGGTAACAGCAGCGGTGG - Intronic
970643315 4:18091081-18091103 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
971053871 4:22891431-22891453 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
971186538 4:24383059-24383081 TGCGTGGGTATCACCAGCTGAGG - Intergenic
971247127 4:24939256-24939278 TGCCTGGGTATCAGCAGCAGTGG - Intronic
971441778 4:26694755-26694777 TGCCTGGGTATCAGCAGCGGAGG - Intronic
971586151 4:28407644-28407666 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
972119484 4:35682439-35682461 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
972173657 4:36377344-36377366 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
972317814 4:37944114-37944136 TGCCTGGGTATCAGCAGCAGAGG + Intronic
972376598 4:38477331-38477353 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
972677587 4:41275699-41275721 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
972921815 4:43951793-43951815 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
973009376 4:45052404-45052426 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
973124612 4:46567968-46567990 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
973347145 4:49068704-49068726 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
973546687 4:51989685-51989707 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
973559613 4:52122260-52122282 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
973564469 4:52170492-52170514 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
973569433 4:52223502-52223524 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
973592163 4:52453460-52453482 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
973592847 4:52459814-52459836 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
973671073 4:53218917-53218939 TGCCTGGGTATCAGCAGCGGAGG + Intronic
973679235 4:53298807-53298829 TGCCTGGGTATCAGCAGCGGTGG - Intronic
973683054 4:53340822-53340844 TGCCTGGGTATCAGCAGCGGAGG - Intronic
973731646 4:53828912-53828934 TGCCTGGGTATCAGCAGCGGTGG + Intronic
973776267 4:54244430-54244452 TGCCTGGGTACCAGCAGCAGTGG - Intronic
973923045 4:55708500-55708522 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
973935562 4:55842592-55842614 TGCCTGGGTAACAGCAGCGGTGG - Intergenic
973986984 4:56363584-56363606 TGCCTGGGTATCAGCAGCGGTGG - Intronic
974112051 4:57537127-57537149 TGCTTGGGTATCAGCAGCAGAGG + Intergenic
974426087 4:61744577-61744599 TGCCTGGGTACCAGCAGCGGTGG - Intronic
974427507 4:61759950-61759972 TGCCTGGGTATCAGCAGCGGAGG + Intronic
974470277 4:62310106-62310128 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
974723454 4:65771419-65771441 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
974917373 4:68194910-68194932 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
975092750 4:70423188-70423210 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
975150228 4:71012628-71012650 TGCCTGGGTATCAGCAGCGGAGG - Intronic
975250125 4:72169049-72169071 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
975277570 4:72520117-72520139 TGCCTGGGTATCAGCAGCGGTGG + Intronic
975287392 4:72636622-72636644 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
975305112 4:72840804-72840826 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
975309219 4:72884018-72884040 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
975348457 4:73320255-73320277 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
975751957 4:77533313-77533335 TGCCTGGGTATCAGCAGCAGAGG + Intronic
975821569 4:78276594-78276616 TGCCTGGGTATCAGCAGCGGAGG + Intronic
975887337 4:78981721-78981743 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
976170818 4:82302825-82302847 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
976682245 4:87769932-87769954 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
976794821 4:88920413-88920435 TGCCTGGGTATCAGCAGCGGTGG - Intronic
976924880 4:90484651-90484673 TGCCTGGGTATCAGCAGCGGTGG + Intronic
976998292 4:91463220-91463242 TGCCTGGGTATCAGCAGCGGAGG - Intronic
977029438 4:91863597-91863619 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
977218762 4:94314418-94314440 TGCCTGGGTATCAGCAGCGGAGG + Intronic
977333326 4:95664567-95664589 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
977343752 4:95792225-95792247 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
977478050 4:97537906-97537928 TGCCTGGGTATCAGCAGCGGAGG - Intronic
977480196 4:97565712-97565734 TGCCTGGGTACCAGCAGCGGTGG + Intronic
977516140 4:98023296-98023318 TGCCTGGGTATCAGCAGCGGTGG + Intronic
977617093 4:99099137-99099159 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
977653257 4:99492976-99492998 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
977775736 4:100917025-100917047 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
977897351 4:102380031-102380053 TGCCTGGGTATCAGCAGCGGAGG + Intronic
977960769 4:103082664-103082686 TGCTTGGGAAGCTGAGGCTGGGG - Intronic
977973992 4:103243353-103243375 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
978004758 4:103602668-103602690 TGCCTGGGTATCAGCAGCAGTGG + Intronic
978140459 4:105312522-105312544 TGCCTGGGTATCAGCTGCAGAGG + Intergenic
978231655 4:106407725-106407747 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
978336324 4:107672923-107672945 TGCCTGGGTATCAGCAGCGGAGG - Intronic
978412457 4:108440697-108440719 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
978418497 4:108503978-108504000 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
978548508 4:109899582-109899604 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
978632440 4:110762758-110762780 TGCCTGGGTAACAGCTGCGGTGG + Intergenic
978658904 4:111099919-111099941 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
978663111 4:111152328-111152350 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
978680839 4:111378769-111378791 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
978694932 4:111565986-111566008 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
978756537 4:112309027-112309049 TGCCTGGGTAACAGCAGCAGAGG + Intronic
978782957 4:112576140-112576162 TGCCTGGGTATCAGCAGCGGAGG - Intronic
978859256 4:113429831-113429853 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
979074704 4:116257185-116257207 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
979236358 4:118404539-118404561 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
979445033 4:120802568-120802590 TGCCTGGGTATCAGCAGCAGAGG - Intronic
979592262 4:122493766-122493788 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
979599706 4:122574464-122574486 TGCGTGGATATCAGCAGCGGCGG + Intergenic
979726899 4:123973334-123973356 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
979739406 4:124131094-124131116 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
979803099 4:124936487-124936509 TGCATGGTTAGCAGCAACTGTGG - Intergenic
980018246 4:127677463-127677485 TGCCTGGGTACCAGCAGCGGTGG - Intronic
980090337 4:128436781-128436803 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
980139347 4:128896386-128896408 TGCCTGGGTATCAGCAGCAGAGG - Intronic
980149136 4:129024411-129024433 TGCCTGGGTAACAGCAGCAGTGG - Intronic
980217920 4:129876019-129876041 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
980413797 4:132458630-132458652 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
981109177 4:140915908-140915930 TGCCTGGGTATCAGCAGCGGTGG - Intronic
981131666 4:141163636-141163658 TGCCTGGGTATCAGCAGCAGTGG - Intronic
981150970 4:141378630-141378652 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
981161949 4:141509171-141509193 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
981165293 4:141550160-141550182 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
981299169 4:143167310-143167332 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
981338474 4:143593514-143593536 TGCCTGGGTATCAGCAGCGGTGG + Intronic
981387917 4:144153184-144153206 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
981407864 4:144392409-144392431 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
981556679 4:146003025-146003047 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
981607726 4:146558200-146558222 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
981684203 4:147434875-147434897 TGCCTGGGTAACAGCAGCAGTGG - Intergenic
981687481 4:147471079-147471101 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
981914917 4:150023211-150023233 TGCGTCAGTAGGAGAGGCTGGGG - Intergenic
981958120 4:150503415-150503437 TGCGTGGGTGTCAGCAGCGGTGG - Intronic
982328054 4:154149857-154149879 TGCCTGGGTATCAGCTGCGGAGG + Intergenic
982675213 4:158367825-158367847 TGCCTGGGTACCAGCAGCGGTGG + Intronic
982691181 4:158549729-158549751 TGCCTGGGTATCAGCAGCAGTGG + Intronic
982881098 4:160717316-160717338 TGAGTGGGTAGCTGTGGTTGAGG + Intergenic
983173751 4:164563990-164564012 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
983326656 4:166266254-166266276 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
983364572 4:166769466-166769488 TGCCTGGGTATCAGCAGCAGAGG + Intronic
983385507 4:167056166-167056188 TGCCTGGGTACCAGCAGCGGTGG - Intronic
983598723 4:169499679-169499701 TGCCTGGGTATCAGCAGCGGAGG + Intronic
983655188 4:170075759-170075781 TGAGTGGTTACCAGGGGCTGGGG - Intronic
983978683 4:173968172-173968194 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
984259181 4:177424084-177424106 TGAGTGGTTATCAGCGGCTGAGG - Intergenic
984324960 4:178241058-178241080 TGTGTGAGTAGCAGTGGCGGTGG + Intergenic
984383884 4:179030798-179030820 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1202752878 4_GL000008v2_random:25188-25210 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
985841964 5:2313294-2313316 TGGGTGGGAAGAAGCGGGTGTGG - Intergenic
986379719 5:7171408-7171430 TGCCTGGGTACCAGCAGCTGCGG - Intergenic
986530512 5:8731704-8731726 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
986655118 5:10003246-10003268 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
986838741 5:11672089-11672111 TGCCTGGGTATCACCGGCAGAGG + Intronic
988416117 5:30948597-30948619 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
988646499 5:33101178-33101200 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
988871660 5:35396941-35396963 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
988880348 5:35495094-35495116 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
988945133 5:36189499-36189521 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
989072257 5:37523342-37523364 TGCCTGGGTATCAGCAGCGGAGG - Intronic
989248502 5:39281018-39281040 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
989284866 5:39687803-39687825 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
989449437 5:41569811-41569833 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
989508785 5:42259515-42259537 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
989528691 5:42482160-42482182 TGCCTGGGTATCAGCAGCGGTGG + Intronic
989569574 5:42932578-42932600 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
989616501 5:43341616-43341638 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
989787368 5:45347229-45347251 TGCCTGGGTATCAGCAGCGGTGG - Intronic
989816894 5:45748340-45748362 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
989942807 5:50174092-50174114 TGCCTGGGTAGCAGCAGAGGTGG + Intergenic
990127273 5:52534087-52534109 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
990135716 5:52642196-52642218 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
990226871 5:53665107-53665129 TGCCTGGGTATCAGCAGCGGAGG + Intronic
990239649 5:53803633-53803655 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
990340132 5:54813810-54813832 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
990360477 5:55013697-55013719 TGCCTGGGTATCAGCAGCGGAGG - Intronic
990366897 5:55080647-55080669 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
990437528 5:55808596-55808618 TGCCTGGGTATCAGCAGCGGAGG + Intronic
990653033 5:57923704-57923726 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
990710388 5:58573643-58573665 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
990721287 5:58699237-58699259 TGCCTGGGTAGCATCAGCAGAGG + Intronic
990887963 5:60616004-60616026 TGCCTGGGTATCAGCAGCAGAGG - Intronic
990955032 5:61332342-61332364 GGCGGGGGCAGCAGCGGCGGCGG + Exonic
991086974 5:62656467-62656489 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
991089213 5:62678084-62678106 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
991241861 5:64470046-64470068 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
991242762 5:64477949-64477971 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
991402032 5:66262137-66262159 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
991421718 5:66449561-66449583 TGCGTGGGTATCAGCAGCGGTGG + Intergenic
991529860 5:67603603-67603625 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
991535534 5:67666112-67666134 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
991538895 5:67704521-67704543 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
992016296 5:72578161-72578183 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
992197011 5:74350363-74350385 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
992287973 5:75255266-75255288 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
992336407 5:75774829-75774851 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
992525875 5:77609519-77609541 TGCCTGGGTATCAGCAGCAGTGG - Intronic
992576541 5:78119053-78119075 TGCCTGGGTATCAGCAGCGGTGG - Intronic
992631240 5:78682800-78682822 TGCCTGGGTATCAGCAGCGGAGG - Intronic
992634143 5:78710598-78710620 TGCCTGGGTATCAGCAGCAGTGG - Intronic
992650294 5:78853335-78853357 TGCCTGGGTATCAGCAGCGGTGG + Intronic
992755686 5:79903150-79903172 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
993142439 5:84051175-84051197 TGCCTGGGTATCAGCAGCGGAGG - Intronic
993341565 5:86731098-86731120 TGCCTGGGTACCAGCAGCGGAGG + Intergenic
993446148 5:88014750-88014772 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
993471531 5:88313283-88313305 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
993688555 5:90970567-90970589 TGCCTGGGTATCAGCAGCAGAGG - Intronic
993917630 5:93761918-93761940 TGCCTGGGTATCAGCAGCAGAGG - Intronic
994316995 5:98343845-98343867 TGCCTGGGTAACAGCAGCAGTGG - Intergenic
994405889 5:99344895-99344917 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
994538420 5:101061038-101061060 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
994565285 5:101438259-101438281 TTGGTGGTTAGCAGGGGCTGGGG - Intergenic
994572285 5:101529737-101529759 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
994664202 5:102688705-102688727 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
994973758 5:106776259-106776281 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
995203993 5:109458103-109458125 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
995467472 5:112466013-112466035 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
995665353 5:114535931-114535953 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
995692723 5:114845264-114845286 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
995905396 5:117117068-117117090 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
996085307 5:119299386-119299408 TGCCTGGGTATCAGCAGCGGTGG + Intronic
996162346 5:120181308-120181330 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
996320041 5:122205265-122205287 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
996356042 5:122597806-122597828 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
996420354 5:123256197-123256219 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
996455789 5:123679837-123679859 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
996500829 5:124214016-124214038 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
996773319 5:127108379-127108401 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
996788678 5:127268950-127268972 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
997094793 5:130898394-130898416 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
997107177 5:131033994-131034016 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
997112265 5:131088003-131088025 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
997744846 5:136290004-136290026 TGCCTGGGTATCAGCAGCGGTGG - Intronic
997797772 5:136828292-136828314 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
997861607 5:137423064-137423086 TGCCTGGGTATCAGCAGCAGAGG + Intronic
997874463 5:137535963-137535985 TGCCTGGGTATCAGCAGCGGAGG - Intronic
998009574 5:138683958-138683980 TGCTTGGGTATCAGCAGCAGTGG + Intronic
998241784 5:140452582-140452604 TGCCTGGGTATCAGCAGCGGAGG - Intronic
998645291 5:144055194-144055216 TGCCTGGGTAACAGCAGCAGAGG + Intergenic
998685395 5:144518161-144518183 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
998694977 5:144629111-144629133 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
998780552 5:145651618-145651640 TGCCTGGGTATCAGCAGCAGAGG - Intronic
999133764 5:149304038-149304060 TTGGTGGTTAGCAGGGGCTGGGG - Intronic
999415748 5:151394681-151394703 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
999612248 5:153382237-153382259 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
999646690 5:153724108-153724130 TGCCTGGGTAACAGCAGCGGTGG - Intronic
999815261 5:155169192-155169214 TGCGTGGGTATCAGCAGCAGTGG - Intergenic
1000032715 5:157418338-157418360 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1000144807 5:158444078-158444100 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1000377188 5:160593280-160593302 TGCCTGGGTAACAGCAGCAGTGG - Intronic
1000553553 5:162696045-162696067 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1000565807 5:162846127-162846149 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1000648003 5:163781473-163781495 TGCCTGGGTATCAGCAGCGGGGG - Intergenic
1001212245 5:169820482-169820504 TGCCTGGGTACCAGCAGCAGAGG - Intronic
1001348758 5:170935590-170935612 TGCCTGGGTATCACCAGCTGAGG + Intronic
1001359091 5:171063439-171063461 TGCCTGGGTATCAGCAGCAGTGG + Intronic
1001583956 5:172820321-172820343 TGCGTGGGTGGCACCGTGTGTGG - Intergenic
1001591571 5:172869118-172869140 TGGGTGACTAGCAGAGGCTGAGG + Intronic
1002657434 5:180761948-180761970 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1003225695 6:4203790-4203812 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1003819786 6:9883161-9883183 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1004095534 6:12550040-12550062 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1004593310 6:17074266-17074288 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1004807675 6:19221689-19221711 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1005100865 6:22171637-22171659 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1005202618 6:23364250-23364272 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1005263249 6:24083697-24083719 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1005663210 6:28021613-28021635 TGCCTGGGTAACAGCAGCGGTGG - Intergenic
1005723133 6:28622085-28622107 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1005846188 6:29780612-29780634 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1005924528 6:30431129-30431151 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1007858796 6:44885478-44885500 TGCCTGGGTAACAGCAGCGGTGG - Intronic
1007892419 6:45307480-45307502 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1008361158 6:50620704-50620726 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1008406352 6:51122291-51122313 TGCCTGGGTAACAGCAGCGGTGG - Intergenic
1008425134 6:51348614-51348636 TGCCTGGGTATCACCAGCTGAGG + Intergenic
1008491951 6:52096227-52096249 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1008566728 6:52776504-52776526 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1008635323 6:53405349-53405371 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1008796641 6:55311390-55311412 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1008874054 6:56307002-56307024 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1008961758 6:57273906-57273928 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1009045381 6:58231879-58231901 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1009056449 6:58342021-58342043 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1009221200 6:60986209-60986231 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1009230197 6:61052683-61052705 TGCCTGGGTAACAGCAGCGGTGG + Intergenic
1009282504 6:61770048-61770070 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1009322834 6:62312879-62312901 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1009410532 6:63360935-63360957 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1009476359 6:64097031-64097053 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1009497917 6:64373949-64373971 TGCCTGGCTATCAGCAGCTGGGG + Intronic
1009519042 6:64658633-64658655 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1009662461 6:66631682-66631704 TGCCTGGGTAACAGCAGCGGTGG - Intergenic
1009665418 6:66671652-66671674 TGCCTGGGTAACAGCAGCGGTGG + Intergenic
1009873853 6:69481057-69481079 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1010093089 6:72007186-72007208 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1010281652 6:74029953-74029975 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1010310400 6:74378311-74378333 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1010334139 6:74660852-74660874 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1010352260 6:74888554-74888576 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1010553577 6:77252368-77252390 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1010652190 6:78468052-78468074 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1010667531 6:78647590-78647612 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1010688395 6:78878358-78878380 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1010728984 6:79368174-79368196 TGCCTGGGTATCAGCTGCAGAGG + Intergenic
1010851621 6:80783880-80783902 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1010876832 6:81117328-81117350 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1010901619 6:81434204-81434226 TGCCTGGGTATCAGCCGCAGTGG - Intergenic
1011251666 6:85378046-85378068 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1011306705 6:85935720-85935742 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1011317935 6:86057093-86057115 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1011358457 6:86497387-86497409 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1011392908 6:86873682-86873704 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1011397214 6:86922020-86922042 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
1011432439 6:87301891-87301913 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1011711099 6:90054835-90054857 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1011949936 6:92952719-92952741 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1011953405 6:92996020-92996042 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1011956744 6:93032866-93032888 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1012317237 6:97795483-97795505 TGCCTGGGTATCAGCTGCAGAGG - Intergenic
1012481830 6:99676081-99676103 TTCCTGGGTATCAGCAGCTGAGG + Intergenic
1012504637 6:99931115-99931137 TGCATGGGTACCAGCAGCGGTGG + Intronic
1012739917 6:103003742-103003764 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1012844784 6:104375455-104375477 TGCCTGGGTATCAGCGGCGGTGG - Intergenic
1012941076 6:105415839-105415861 TGCCTGGGTAGCACCAGCGGAGG - Intergenic
1013124437 6:107169757-107169779 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1013258315 6:108411617-108411639 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1013906233 6:115222923-115222945 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1014145780 6:117996644-117996666 TGCCTGGGTATCAGCAGCTGTGG - Intronic
1014185308 6:118427659-118427681 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1014424342 6:121285850-121285872 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1014449971 6:121571308-121571330 TGCCTGGGTAACAGCAGCGGTGG + Intergenic
1014529495 6:122542462-122542484 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1014849817 6:126327452-126327474 TGCCTGGGTATCAGCAGCTGTGG - Intergenic
1014871265 6:126599102-126599124 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1014979291 6:127927048-127927070 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1015081184 6:129227607-129227629 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1015191453 6:130476367-130476389 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1015261189 6:131240186-131240208 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1016018554 6:139211342-139211364 TGCCTGGGTATCAGCAGCGGGGG - Intergenic
1016245042 6:141970381-141970403 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1016296452 6:142577850-142577872 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
1016365070 6:143307478-143307500 TGCCTGGGTAACAGCAGCGGTGG + Intronic
1017226616 6:152029003-152029025 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1017470443 6:154733426-154733448 AGCGCTGGCAGCAGCGGCTGCGG - Exonic
1017671963 6:156777686-156777708 CGCGCGGGCAGCAGCGGCGGCGG + Intergenic
1018783010 6:167086214-167086236 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1019073774 6:169370595-169370617 AGGGTGGGAAGCAGAGGCTGGGG - Intergenic
1019753002 7:2744381-2744403 TGCTTGGGTATCAGCAGCGGTGG - Intronic
1019785868 7:2977100-2977122 TTCGTGGGTACCAGGGACTGGGG + Intronic
1019805706 7:3122400-3122422 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1020330284 7:7011082-7011104 TGCCTGGGTATCAGCTGCGGAGG + Intergenic
1020418034 7:7968814-7968836 GGAGTGGGTAGAAGCGGCGGCGG + Exonic
1020430472 7:8112326-8112348 AGGGTGGGGAGCAGAGGCTGAGG + Intergenic
1020539047 7:9437240-9437262 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1020600705 7:10271062-10271084 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1021082713 7:16383271-16383293 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1021373796 7:19882919-19882941 TGCTTGGGTATCAGCAGCAGTGG + Intergenic
1021446811 7:20742994-20743016 TTTGTGGGGAGCAGCGGCTGTGG + Exonic
1021661685 7:22925044-22925066 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1021765870 7:23948021-23948043 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1022406784 7:30098105-30098127 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1022654815 7:32308611-32308633 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1022666577 7:32416582-32416604 TGGGTGGGTGGCAGGGGATGAGG - Intergenic
1022696282 7:32708857-32708879 TGCCTGGATAGCAGCAGCAGTGG - Intergenic
1022782857 7:33603330-33603352 TGCGGTGGTGGCAGGGGCTGAGG - Intronic
1022880029 7:34576646-34576668 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1022994839 7:35744471-35744493 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1023065985 7:36378386-36378408 TGCCTGGGTATCACCAGCTGAGG + Intronic
1023143014 7:37120987-37121009 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1023419747 7:39966891-39966913 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1023511012 7:40953731-40953753 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1023607144 7:41941467-41941489 AGGGTGGGGAGCCGCGGCTGGGG - Intergenic
1023794179 7:43778420-43778442 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1024031781 7:45467774-45467796 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1024460105 7:49650585-49650607 TGCGTGGGTATCAGCAGTGGTGG - Intergenic
1024892424 7:54218973-54218995 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1025184069 7:56843656-56843678 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1025479230 7:60961326-60961348 TGCTTGGGTATCAGCAGCGGTGG - Intergenic
1025524394 7:61786467-61786489 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1025547754 7:62198685-62198707 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1025552818 7:62271487-62271509 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1025640772 7:63366190-63366212 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1025737228 7:64161371-64161393 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1025874650 7:65469767-65469789 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1026019718 7:66697665-66697687 GGCGGGGGTAGCTGGGGCTGGGG + Intronic
1027330681 7:77089818-77089840 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1027792436 7:82650702-82650724 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1028065280 7:86376216-86376238 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1028395451 7:90364413-90364435 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1028436236 7:90807329-90807351 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1028458189 7:91061679-91061701 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1028499902 7:91507585-91507607 TGCCTGGGTACCAGCAGCTGTGG - Intergenic
1028646996 7:93109161-93109183 TGACTGGGTATCAGCGGCAGAGG - Intronic
1028836490 7:95380065-95380087 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1028851587 7:95543743-95543765 TGTGTGGGGAGCAGAGGATGAGG + Intergenic
1028886552 7:95941077-95941099 TGCCTGGGTACCAGCAGCGGTGG + Intronic
1028918910 7:96289119-96289141 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1029785083 7:102781522-102781544 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1029875108 7:103742128-103742150 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1030132038 7:106209570-106209592 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1030255950 7:107508759-107508781 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1030269077 7:107651612-107651634 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1030467753 7:109924364-109924386 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1030476098 7:110035407-110035429 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1030510123 7:110473066-110473088 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1030534123 7:110744580-110744602 TGCCTGGGTAGCACCAGCGGAGG - Intronic
1030592673 7:111500685-111500707 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1030817588 7:114055780-114055802 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1030997112 7:116372097-116372119 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1031314535 7:120240110-120240132 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1031344645 7:120650894-120650916 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1031527128 7:122835146-122835168 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1031548900 7:123084608-123084630 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1031664501 7:124468010-124468032 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1031848163 7:126830982-126831004 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1032445901 7:131983615-131983637 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1032603619 7:133326487-133326509 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1032764420 7:134976821-134976843 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1032771923 7:135067601-135067623 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1033371574 7:140713887-140713909 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1033844719 7:145418237-145418259 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1034028757 7:147737302-147737324 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1034188802 7:149198167-149198189 TGAGTGGGTAGCTGTTGCTGGGG + Intronic
1034369174 7:150579752-150579774 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1034379603 7:150679204-150679226 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1034583267 7:152065720-152065742 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1034780024 7:153870929-153870951 TGCTTGGGTATCAGCAGCAGTGG + Intergenic
1034994507 7:155569703-155569725 TGTGTGGGCACCAGGGGCTGGGG - Intergenic
1035533204 8:371844-371866 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1035900631 8:3455591-3455613 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1036549580 8:9804645-9804667 AGGGTGGGGAGCAGAGGCTGAGG - Intergenic
1037197195 8:16204984-16205006 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1037546757 8:19931009-19931031 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1037641061 8:20743540-20743562 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1037887907 8:22604772-22604794 GGCGGCGGCAGCAGCGGCTGTGG + Exonic
1037999432 8:23379215-23379237 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1038140572 8:24840421-24840443 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1038318536 8:26508274-26508296 CTCATGGGTAGCAGGGGCTGAGG + Exonic
1038655795 8:29450051-29450073 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1038846640 8:31236544-31236566 TGCTTGGGTATCAGCAGCAGAGG + Intergenic
1038929038 8:32172208-32172230 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1039127134 8:34215786-34215808 TGCCTGGGTACCAGTGGCGGTGG - Intergenic
1039245612 8:35605323-35605345 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1039300111 8:36200525-36200547 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1039423103 8:37461134-37461156 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1039898039 8:41730197-41730219 AGCGGGGTCAGCAGCGGCTGGGG - Intronic
1040062008 8:43111783-43111805 TGCCTGGGTATCAGCAGCGGGGG - Intronic
1040062219 8:43113889-43113911 TGCCTGGGTACCAGCAGCGGTGG + Intronic
1040086604 8:43349717-43349739 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1040329192 8:46377273-46377295 TGGGTGGGTGGCAGGGACTGAGG + Intergenic
1040363762 8:46692644-46692666 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1040369682 8:46757384-46757406 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1040389999 8:46941559-46941581 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1040390203 8:46943006-46943028 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1040403471 8:47076359-47076381 TGCCTGGGTATCAGCAGCAGCGG - Intergenic
1040427369 8:47302724-47302746 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1040438970 8:47421890-47421912 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1040445178 8:47485716-47485738 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1040553905 8:48462493-48462515 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1040608476 8:48959164-48959186 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1040651013 8:49448759-49448781 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1040686610 8:49880398-49880420 TGCCTGGGTAACAGCAGCGGTGG + Intergenic
1040708090 8:50153682-50153704 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1040756550 8:50782982-50783004 TGCCTGGGTACCAGCAGCGGTGG + Intronic
1041027307 8:53700436-53700458 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1041035532 8:53785817-53785839 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1041120963 8:54586276-54586298 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1041302767 8:56429946-56429968 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1041338204 8:56811856-56811878 TGCCTGGGTAACAGCAGCGGTGG + Intergenic
1041387532 8:57319959-57319981 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1041518303 8:58726846-58726868 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1041637619 8:60161218-60161240 TGCCTGGGTAACAGCAGCGGTGG - Intergenic
1041750330 8:61254199-61254221 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1041771718 8:61479862-61479884 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1041805999 8:61850279-61850301 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1041845315 8:62321608-62321630 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1041885363 8:62801481-62801503 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1042115543 8:65427203-65427225 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1042204897 8:66318653-66318675 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1042394581 8:68277149-68277171 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1042620638 8:70700461-70700483 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1042630383 8:70809157-70809179 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1042686970 8:71452631-71452653 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1042720430 8:71821108-71821130 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1042731385 8:71939125-71939147 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1042763119 8:72291892-72291914 TGCCTGGGTATCAGCAGCTGAGG - Intergenic
1043123527 8:76360854-76360876 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1043177678 8:77042704-77042726 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1043236899 8:77879761-77879783 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1043272446 8:78351355-78351377 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1043409960 8:79983136-79983158 TGCCTGGGTACCAGCAGCGGTGG - Intronic
1043411741 8:80004348-80004370 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1043480786 8:80650025-80650047 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1044061911 8:87648868-87648890 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1044156952 8:88859908-88859930 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
1044178844 8:89163718-89163740 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1044195780 8:89374763-89374785 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1044225070 8:89709031-89709053 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1044278910 8:90334088-90334110 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1044455260 8:92385957-92385979 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1044909739 8:97044763-97044785 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1045036146 8:98178014-98178036 TGCCAGAGTAGCAGGGGCTGGGG + Intergenic
1045083241 8:98651204-98651226 TGCCTGGGTACCAGCAGCGGTGG - Intronic
1045087183 8:98699641-98699663 TGCCTGGGTACCAGCAGCGGTGG + Intronic
1045090678 8:98739457-98739479 TGCCTGGGTACCAGCAGCGGTGG - Intronic
1045125669 8:99086736-99086758 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1045143468 8:99313447-99313469 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1045177346 8:99739684-99739706 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1045386098 8:101671916-101671938 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1045419601 8:102000738-102000760 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1045788777 8:105956517-105956539 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1045939064 8:107717206-107717228 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1046043163 8:108931291-108931313 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1046682975 8:117192278-117192300 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1046879564 8:119292889-119292911 TGCCTGGGTAACAGCAGCAGTGG - Intergenic
1047077366 8:121418735-121418757 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1047841738 8:128760703-128760725 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1047845639 8:128802080-128802102 TGCCTGGGTATCAGCAGCTGAGG - Intergenic
1047885608 8:129247074-129247096 TTGGTGGGTAGCAGAGCCTGAGG - Intergenic
1048090641 8:131236888-131236910 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1048093221 8:131262959-131262981 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1048156564 8:131960923-131960945 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1048408387 8:134146176-134146198 TGCCTGGGTAGCAGCTGAGGTGG - Intergenic
1048540378 8:135336245-135336267 TGCCTGGGTAACAGCAGCGGTGG - Intergenic
1048594505 8:135852609-135852631 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1048858523 8:138704486-138704508 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1049074471 8:140383025-140383047 TGCCTGGGTATCAGCAGCGGAGG - Intronic
1049197162 8:141322241-141322263 TGAGTGGGGAGCAGGGGGTGAGG - Intergenic
1049472848 8:142783994-142784016 AGCGTGGGTGGCAGCTGGTGAGG - Intergenic
1049685645 8:143938242-143938264 TGTGGGGACAGCAGCGGCTGAGG + Intronic
1049747842 8:144270539-144270561 TGCACCGGTAGCAGCGGCCGAGG + Intronic
1049907766 9:235176-235198 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1049964701 9:767571-767593 TGCGTGGGTATCACCAGCGGAGG - Intergenic
1050047192 9:1559280-1559302 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1050083125 9:1936344-1936366 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1050091253 9:2017429-2017451 TGCGTCGGGAGCAGCGGCTCGGG + Intronic
1050305247 9:4299644-4299666 TGCGAGGGCAGCGGCGGCAGGGG + Exonic
1050370836 9:4920322-4920344 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1050374084 9:4952986-4953008 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1050381239 9:5032608-5032630 TGCCTGGGTACCAGCAGCAGTGG - Intronic
1050442806 9:5683425-5683447 TGCCTGGGTATCAGCAGCAGTGG + Intronic
1050689001 9:8204254-8204276 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1050774493 9:9243120-9243142 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1050887040 9:10779129-10779151 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1051299104 9:15628893-15628915 TGCCTGGGTACCAGCAGCGGTGG - Intronic
1051327563 9:15989289-15989311 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1051456824 9:17268315-17268337 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1051707477 9:19895802-19895824 TGCTTGGGTTGCAGCTGGTGTGG + Intergenic
1051790905 9:20801127-20801149 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1051905949 9:22095091-22095113 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1051913187 9:22177872-22177894 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1051915272 9:22200202-22200224 AGCATTGGTAGCAGCAGCTGTGG + Intergenic
1051917470 9:22225609-22225631 TGCCTGGGTATCAGCAGCAGCGG + Intergenic
1051984764 9:23070724-23070746 CGAGTGGGTACCAGAGGCTGAGG + Intergenic
1052115394 9:24644030-24644052 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1052149942 9:25102848-25102870 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1052197297 9:25732988-25733010 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1052441134 9:28497937-28497959 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1052632659 9:31061348-31061370 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1052640428 9:31160227-31160249 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1052645557 9:31229791-31229813 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1052978734 9:34431342-34431364 TGTGTGTGCAGCAGCTGCTGAGG - Intronic
1052992849 9:34531822-34531844 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1053038729 9:34850877-34850899 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
1053167255 9:35853522-35853544 TGGGTGGGTAGCAGTGCCGGCGG - Exonic
1053442488 9:38127748-38127770 TGCGTGGGTTGCAGCAGCTATGG + Intergenic
1053521097 9:38780235-38780257 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1053700015 9:40680957-40680979 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1054193256 9:62004228-62004250 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1054311306 9:63480355-63480377 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1054410088 9:64804508-64804530 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1054645151 9:67584463-67584485 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1054811639 9:69440062-69440084 TGCCTGGGTATCAGCAGCAGTGG + Intronic
1054887191 9:70211907-70211929 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1055338618 9:75258975-75258997 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1055548632 9:77409158-77409180 TGCGTGGGTATCAGCAGCGGAGG - Intronic
1055827622 9:80345729-80345751 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1055866184 9:80816706-80816728 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1055899489 9:81218006-81218028 TGCCTGGGTACCAGCAGCTATGG - Intergenic
1055918570 9:81433146-81433168 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1056230204 9:84535722-84535744 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1056582607 9:87902978-87903000 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1056861943 9:90193036-90193058 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1056997679 9:91478953-91478975 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1057163073 9:92905196-92905218 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
1057359376 9:94359275-94359297 TTGGTGGGTACCAGGGGCTGGGG + Intergenic
1057648388 9:96898315-96898337 TTGGTGGGTACCAGGGGCTGGGG - Intronic
1057682838 9:97206005-97206027 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1058034493 9:100236666-100236688 TGCGTGGGTATCACCAGCAGAGG + Intronic
1058072777 9:100618919-100618941 TGCCTGGGTATCACCGGCAGAGG + Intergenic
1058134485 9:101291653-101291675 TGCCTGGGTACCAGCAGCAGTGG - Intronic
1058211363 9:102173969-102173991 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1058224032 9:102338070-102338092 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1058366997 9:104220594-104220616 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1058490559 9:105494779-105494801 TGCCTGGGTACCAGCAGCGGTGG + Intronic
1058517357 9:105790353-105790375 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1058563918 9:106260638-106260660 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1058595015 9:106605833-106605855 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1058750130 9:108031865-108031887 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1058795985 9:108498629-108498651 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1058943651 9:109836241-109836263 TGCCTGGGTATCAGCAGCCGAGG - Intronic
1058988776 9:110235044-110235066 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1059005180 9:110394219-110394241 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1059513451 9:114870541-114870563 TGCCTGGGTATCACCAGCTGAGG - Intergenic
1059673465 9:116514280-116514302 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1059675642 9:116536635-116536657 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1060339373 9:122759865-122759887 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1060389819 9:123268298-123268320 TGCGTCCTTAGCAGCGGCGGCGG - Intronic
1060430635 9:123548450-123548472 TAAGTGGGTAGCAGTGTCTGTGG - Intronic
1061038704 9:128127620-128127642 TGCGTGGGTAGCAGCGGCTGGGG + Exonic
1061322371 9:129839388-129839410 TGTGTGGGCAGCAGAGACTGTGG + Intronic
1061375093 9:130219536-130219558 AGGGTGGGGAGCAGAGGCTGGGG - Intronic
1061390446 9:130314750-130314772 TGGGTGGGAGGCAGAGGCTGGGG + Intronic
1062380474 9:136284473-136284495 TGCCTGGGAAGCAGCTGCTCAGG + Intronic
1203440994 Un_GL000219v1:8658-8680 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1203717555 Un_KI270742v1:168340-168362 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1203533672 Un_KI270743v1:9893-9915 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1203620107 Un_KI270749v1:118566-118588 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
1186571140 X:10715907-10715929 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1186702588 X:12107261-12107283 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1186775769 X:12863574-12863596 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1186956497 X:14688080-14688102 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1186968105 X:14810028-14810050 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1186993012 X:15089260-15089282 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1187113218 X:16322502-16322524 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1187130543 X:16498207-16498229 TGCCTGGGTAACAGCAGCGGTGG - Intergenic
1187326470 X:18295182-18295204 TGCTTGGGTGGCAGCAGCAGTGG - Intronic
1187453291 X:19417904-19417926 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1187784407 X:22867513-22867535 TGCCTGGGTATCACCAGCTGAGG - Intergenic
1187835476 X:23428570-23428592 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1187848431 X:23565943-23565965 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1187857429 X:23650976-23650998 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1188036001 X:25318209-25318231 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1188075531 X:25771605-25771627 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1188289181 X:28367361-28367383 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1188525345 X:31082598-31082620 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1188940757 X:36234894-36234916 TGCCTGGGTACCAGCAGCGGTGG + Intronic
1189026299 X:37398343-37398365 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1189045547 X:37587075-37587097 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1189049871 X:37633708-37633730 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1189062534 X:37769457-37769479 TGCCTGGGTACCAGCAGCGGAGG - Intronic
1189199964 X:39185641-39185663 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1189598043 X:42590512-42590534 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1189697079 X:43675720-43675742 TGCCTGGGTATCAGCAGCAGTGG + Intronic
1189764503 X:44356504-44356526 TTCGTGGTTGGCAGGGGCTGGGG + Intergenic
1189939323 X:46104708-46104730 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1190109745 X:47582373-47582395 GGCGGGGGTGGCAGCGGGTGCGG - Exonic
1190271667 X:48868985-48869007 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1190358133 X:49625333-49625355 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1190422669 X:50301413-50301435 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1190606645 X:52150413-52150435 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1190607606 X:52160768-52160790 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1190608714 X:52171627-52171649 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1190621649 X:52292631-52292653 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1190720816 X:53145861-53145883 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1190800554 X:53784199-53784221 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1190811550 X:53889143-53889165 TGCCTGGGTATCAGCGGCAGAGG - Intergenic
1191016022 X:55811327-55811349 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1191048187 X:56162049-56162071 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1191064158 X:56330271-56330293 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
1191068024 X:56370976-56370998 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1191138280 X:57090278-57090300 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1191144479 X:57152031-57152053 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1191160792 X:57328118-57328140 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1191176037 X:57502595-57502617 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1191187085 X:57624423-57624445 TGCCTGGGTATCAGCAGTTGTGG - Intergenic
1191192854 X:57685116-57685138 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1191194836 X:57709379-57709401 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1191196607 X:57730649-57730671 TGCCTGGGTATCAGCTGCGGAGG + Intergenic
1191203530 X:57810300-57810322 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1191208921 X:57864019-57864041 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1191273537 X:58511217-58511239 TGCCTGGGTACCAGCAGCTGTGG - Intergenic
1191589845 X:62870497-62870519 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1191602038 X:63018734-63018756 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1191608921 X:63090505-63090527 TGCCTGGGTAACAGCAGCGGTGG - Intergenic
1191649401 X:63519975-63519997 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
1191680987 X:63839494-63839516 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1191726215 X:64283686-64283708 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1191745603 X:64483648-64483670 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1191748311 X:64513816-64513838 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1191799154 X:65058355-65058377 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1191824242 X:65347135-65347157 TGCGTGGGTATCAGTAGCAGAGG - Intergenic
1191941935 X:66490042-66490064 TGCCTGGGTATCACCAGCTGAGG - Intergenic
1191969112 X:66794315-66794337 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1191974594 X:66858272-66858294 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1191990238 X:67027029-67027051 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1192004146 X:67191705-67191727 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1192071316 X:67943382-67943404 TGTCTGGGTATCAGCAGCTGTGG - Intergenic
1192136239 X:68603107-68603129 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1192154896 X:68737098-68737120 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1192335412 X:70215674-70215696 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1192352447 X:70368528-70368550 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1192376653 X:70569685-70569707 TGCCTGGGTACCAGCAGCGGTGG + Intronic
1192412074 X:70943237-70943259 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1192532601 X:71902346-71902368 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1192598996 X:72441399-72441421 TGCCTGGGTACCAGCAGCGGTGG - Intronic
1192660444 X:73036959-73036981 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1192662891 X:73060518-73060540 TGCCTGGGTAGCAGCAGCGGTGG - Intergenic
1192667018 X:73099214-73099236 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1192674948 X:73185694-73185716 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1192716077 X:73644146-73644168 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1192802466 X:74479763-74479785 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1192850848 X:74954106-74954128 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1192987488 X:76415600-76415622 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1193009965 X:76665551-76665573 TGCCTGGGTACCTGCAGCTGTGG + Intergenic
1193050093 X:77090122-77090144 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1193088774 X:77471479-77471501 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1193156157 X:78176309-78176331 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1193157526 X:78189704-78189726 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1193189206 X:78549514-78549536 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1193216131 X:78866741-78866763 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
1193229900 X:79031866-79031888 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1193391790 X:80937417-80937439 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1193457055 X:81744003-81744025 TGCTTGGGTATCAGCAGCGGTGG - Intergenic
1193544309 X:82808069-82808091 TGCATGGGTACCAGCAGCAGTGG + Intergenic
1193582670 X:83285115-83285137 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1193612973 X:83654875-83654897 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1193785618 X:85756991-85757013 TGCCTGGGTACCAGCAGCAGTGG + Intergenic
1193787033 X:85772165-85772187 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1194021347 X:88695348-88695370 TGCCTGGGTATCACCAGCTGAGG - Intergenic
1194028776 X:88786693-88786715 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1194191045 X:90837071-90837093 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1194303627 X:92215917-92215939 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1194648507 X:96487290-96487312 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1194813574 X:98415844-98415866 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1194826156 X:98565369-98565391 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1194879663 X:99235461-99235483 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1194924310 X:99806044-99806066 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1194944551 X:100051626-100051648 TGCCTGGGTATCAGCAGCTGTGG - Intergenic
1194962960 X:100256335-100256357 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1194981987 X:100450394-100450416 TGCCTGGCTAGCAGCAGCAGGGG - Intergenic
1195088903 X:101440256-101440278 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1195103975 X:101585315-101585337 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1195126010 X:101810962-101810984 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1195167558 X:102235757-102235779 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1195191300 X:102451330-102451352 TGCCTGGGTATCAGCAGCAGTGG - Intronic
1195261106 X:103132242-103132264 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1195294180 X:103459826-103459848 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1195395710 X:104408513-104408535 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1195417474 X:104636122-104636144 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1195452767 X:105034503-105034525 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1195553497 X:106194820-106194842 TGCCTGGGTATCAGCAGCGGTGG + Intronic
1195587160 X:106578421-106578443 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1195723504 X:107890397-107890419 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1195733636 X:107991349-107991371 TGCCTGGGTATCAGCAGCAGGGG + Intergenic
1195764138 X:108277854-108277876 TGCCTGGGTACCAGCAGCGGTGG - Intronic
1195787878 X:108547388-108547410 TGCATGGGTATCAGCAGCAGAGG + Intronic
1195912234 X:109900759-109900781 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1196016343 X:110944404-110944426 TGCTTCGGTGGCAGCTGCTGAGG - Intronic
1196112673 X:111963686-111963708 TGCCTGGGTATCAGCAGCGGTGG - Intronic
1196137886 X:112229808-112229830 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1196252646 X:113480118-113480140 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1196380623 X:115085725-115085747 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1196464420 X:115958248-115958270 TGCCTGGGGAGGAGCGGCTTGGG - Intergenic
1196473164 X:116052052-116052074 TGCTTGGGTATCAGCAGCGGTGG + Intergenic
1196478863 X:116122046-116122068 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1196481974 X:116160052-116160074 TGCTTGGGTATCAGCAGCGGTGG - Intergenic
1196596984 X:117556522-117556544 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1196658310 X:118242548-118242570 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1196863691 X:120051649-120051671 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1196879408 X:120184681-120184703 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1196887617 X:120262901-120262923 TCTGTGGGCAGCAGCTGCTGTGG + Intronic
1196896841 X:120345098-120345120 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1196914596 X:120519581-120519603 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1197239611 X:124109679-124109701 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1197284853 X:124583398-124583420 TGCCTGGGTACCAGCAGCAGTGG - Intronic
1197299091 X:124756769-124756791 TGCCTGGGTACCAGCAGCAGTGG + Intronic
1197389213 X:125839711-125839733 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1197489849 X:127103066-127103088 TGCCTGGGTATCACCAGCTGAGG - Intergenic
1197543035 X:127789631-127789653 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1197574921 X:128199784-128199806 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1197667773 X:129241703-129241725 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1197678105 X:129352665-129352687 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1197722705 X:129755918-129755940 CGAGTGGGTAGGAGGGGCTGGGG - Intronic
1197811925 X:130452786-130452808 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1197909249 X:131462441-131462463 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1197915065 X:131525328-131525350 TGCCTGGGTATCAGCAGCGGGGG - Intergenic
1197917686 X:131553539-131553561 TGCCTGGGTACCAGCAGCGGTGG - Intergenic
1197988181 X:132289754-132289776 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1198168444 X:134080309-134080331 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1198270375 X:135051416-135051438 TGGGTTGGCAGCAGCGGCTGTGG + Exonic
1198311983 X:135433301-135433323 AGCTTGCGCAGCAGCGGCTGAGG + Intergenic
1198474429 X:136982403-136982425 TGCCTGGGTATCAGCAGCGGAGG + Intergenic
1198489378 X:137123270-137123292 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1198553447 X:137768594-137768616 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1198704765 X:139436542-139436564 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1199484176 X:148330740-148330762 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1199663003 X:150071387-150071409 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1199718724 X:150526426-150526448 TAAGTGGTTACCAGCGGCTGTGG + Intergenic
1199772490 X:150983716-150983738 TGTTTGGGCAGCTGCGGCTGCGG + Intronic
1199936866 X:152582746-152582768 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1200077591 X:153559205-153559227 TGAGTGGGTGCCAGGGGCTGGGG - Intronic
1200138499 X:153886153-153886175 TGCTGCGGCAGCAGCGGCTGTGG + Intronic
1200248048 X:154536198-154536220 TGTGTGGTTAGAAGTGGCTGGGG + Intronic
1200288461 X:154848065-154848087 TGCCTGGGTATCAGCAGCAGAGG + Intronic
1200297796 X:154939877-154939899 TGCCTGGGTATCAGCAGCAGAGG - Intronic
1200318742 X:155162698-155162720 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1200390077 X:155935979-155936001 TGCCTGGGTATCAGCAGCGGAGG + Intronic
1200537701 Y:4419494-4419516 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1200778716 Y:7195250-7195272 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1200831265 Y:7690252-7690274 TGCAAGTGCAGCAGCGGCTGTGG + Intergenic
1200879191 Y:8194318-8194340 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1201053661 Y:9966884-9966906 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1201067492 Y:10112231-10112253 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1201171712 Y:11273278-11273300 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1201258681 Y:12135709-12135731 TGCCTGGGTACCAGCAGCAGTGG - Intergenic
1201431809 Y:13910116-13910138 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1201435378 Y:13952674-13952696 TGCCTGGGTAACAGCAGCAGTGG - Intergenic
1201450177 Y:14102990-14103012 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1201527608 Y:14953611-14953633 TGCCTGGGTATCAGCAGCAGTGG - Intergenic
1201541893 Y:15113964-15113986 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1201545540 Y:15158180-15158202 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1201620003 Y:15946237-15946259 TTCCTGGGTAGCAGCAGCGGAGG + Intergenic
1201739911 Y:17312486-17312508 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1201779909 Y:17709210-17709232 TGCCTGGGTATCAGCAGCGGTGG - Intergenic
1201821646 Y:18196782-18196804 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1201915145 Y:19173343-19173365 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1201923079 Y:19255288-19255310 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1201945847 Y:19509360-19509382 TGCCTGGGTATCAGCAGCAGAGG + Intergenic
1201967379 Y:19753241-19753263 TGCCTGGGTACCAGCAGCGGTGG + Intergenic
1202014433 Y:20385834-20385856 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1202026495 Y:20529047-20529069 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1202064573 Y:20925122-20925144 TGCCTGGGTATCAGCAGCAGTGG + Intergenic
1202085135 Y:21128780-21128802 TGCCTGGGTATCAGCAGCAGGGG + Intergenic
1202089236 Y:21172040-21172062 TGCCTGGGTATCAGCAGCGGTGG + Intergenic
1202105091 Y:21355261-21355283 TGCCTGGGTATCAGCAGCAGAGG - Intergenic
1202272612 Y:23085790-23085812 TGGGTGGGTGGGAGCGGTTGGGG + Intergenic
1202281715 Y:23198134-23198156 TTCGCGGCTAGCAGCTGCTGGGG - Intronic
1202284176 Y:23220385-23220407 TTCGCGGCTAGCAGCTGCTGGGG + Intronic
1202293414 Y:23334892-23334914 TGGGTGGGTGGGAGCGGTTGGGG - Intergenic
1202331432 Y:23757128-23757150 TGCCTGGGTATCAGCAGCGGAGG - Intergenic
1202425609 Y:24719534-24719556 TGGGTGGGTGGGAGCGGTTGGGG + Intergenic
1202433387 Y:24812519-24812541 TTCGCGGCTAGCAGCTGCTGGGG - Intronic
1202435852 Y:24834771-24834793 TTCGCGGCTAGCAGCTGCTGGGG + Intronic
1202445180 Y:24950551-24950573 TGGGTGGGTGGGAGCGGTTGGGG - Intergenic
1202539338 Y:25912932-25912954 TGCCTGGGTATCAGCAGCGGAGG + Intergenic