ID: 1061038731

View in Genome Browser
Species Human (GRCh38)
Location 9:128127718-128127740
Sequence GTTCGCTCCGCCGGCGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061038724_1061038731 -1 Left 1061038724 9:128127696-128127718 CCACCCGCGCAGCCGGGTCCATG 0: 1
1: 0
2: 0
3: 7
4: 173
Right 1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1061038721_1061038731 5 Left 1061038721 9:128127690-128127712 CCCGCACCACCCGCGCAGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 234
Right 1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1061038718_1061038731 18 Left 1061038718 9:128127677-128127699 CCAGGCCACAGCGCCCGCACCAC 0: 1
1: 0
2: 1
3: 18
4: 248
Right 1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1061038726_1061038731 -5 Left 1061038726 9:128127700-128127722 CCGCGCAGCCGGGTCCATGTTCG 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1061038716_1061038731 22 Left 1061038716 9:128127673-128127695 CCCACCAGGCCACAGCGCCCGCA 0: 1
1: 0
2: 1
3: 29
4: 569
Right 1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1061038717_1061038731 21 Left 1061038717 9:128127674-128127696 CCACCAGGCCACAGCGCCCGCAC 0: 1
1: 0
2: 1
3: 31
4: 457
Right 1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1061038723_1061038731 4 Left 1061038723 9:128127691-128127713 CCGCACCACCCGCGCAGCCGGGT 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1061038719_1061038731 13 Left 1061038719 9:128127682-128127704 CCACAGCGCCCGCACCACCCGCG 0: 1
1: 0
2: 1
3: 20
4: 300
Right 1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1061038725_1061038731 -4 Left 1061038725 9:128127699-128127721 CCCGCGCAGCCGGGTCCATGTTC 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061038731 Original CRISPR GTTCGCTCCGCCGGCGCCGC GGG Exonic
900003572 1:29356-29378 TTCCGCTCTGCCGGAGCCGCTGG + Intergenic
900023292 1:199872-199894 TTCCGCTCTGCCGGAGCCGCTGG + Intergenic
900284063 1:1890902-1890924 GCGCGCTCCGCGGGCGCTGCGGG + Exonic
903446399 1:23424944-23424966 CTTCGGTCCCCCGGCGCCCCTGG - Intergenic
903652728 1:24931265-24931287 GTGCGCTCCGGCTGCGCCGCAGG + Intronic
904181396 1:28668986-28669008 GTGCGTGCCGCCGCCGCCGCCGG + Intronic
907136228 1:52142062-52142084 GCTCCTGCCGCCGGCGCCGCTGG - Intergenic
920805777 1:209232053-209232075 GTCAGCTGGGCCGGCGCCGCCGG + Intergenic
920924452 1:210328768-210328790 GTTTGCCCCGCCGGCGGCCCGGG - Intronic
921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG + Intronic
921177862 1:212609223-212609245 CTTCTCTCCGCCGACGGCGCTGG + Intronic
1064553116 10:16521722-16521744 GTGCCCGCCGCCGCCGCCGCTGG - Exonic
1065102057 10:22340890-22340912 TTTCGCTCCCTCCGCGCCGCGGG - Intergenic
1067147340 10:43703094-43703116 GCTCGCTCAGCAGGCGCGGCTGG + Intergenic
1074121767 10:110498525-110498547 GCTCGCCCCTCCGGCGCCCCCGG + Intronic
1079163179 11:18013015-18013037 GGACGCTCCGCCGGCGCTTCCGG + Exonic
1083778554 11:64906465-64906487 TTTCGCTCCCCCGGCTCAGCTGG - Exonic
1091376991 12:31410-31432 TTCCGCTCTGCCGGAGCCGCTGG + Intergenic
1094840038 12:34339019-34339041 GTTCGCGCCCCCGGAGCTGCTGG + Intergenic
1094841208 12:34343380-34343402 GTTCGCTCCACCAGAGCAGCTGG + Intergenic
1094841702 12:34345066-34345088 GTTCCCGCCGCCGGAGCTGCTGG - Intergenic
1094842878 12:34349324-34349346 GTTCGCACCACCGGAGCGGCTGG - Intergenic
1103407659 12:120687186-120687208 GGCCGCTCCGCCTGAGCCGCCGG - Exonic
1103828734 12:123762225-123762247 GCTCGCCCCGCCGACGGCGCCGG - Intergenic
1104882891 12:132084541-132084563 GTTCGCTCAGCCGGGGTCACCGG - Intronic
1112415356 13:99200160-99200182 GGTCGCTCCGCCGGGCTCGCCGG + Intergenic
1113378795 13:109785518-109785540 GGCGGCTCTGCCGGCGCCGCCGG - Exonic
1114659403 14:24334986-24335008 CTCCGCTGCGCCAGCGCCGCGGG - Exonic
1115985765 14:39102838-39102860 CTTCGCTCTGCCGGGGCCGGGGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122904586 14:104795843-104795865 GCGCGCTCCGCCCTCGCCGCCGG - Intergenic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1132449929 15:101961584-101961606 TTCCGCTCTGCCGGAGCCGCTGG - Intergenic
1132719798 16:1309948-1309970 GTCCGCGCTGCTGGCGCCGCTGG + Intronic
1136226505 16:28863904-28863926 GTTAGCTCCGGCGGCGGCGGCGG - Intronic
1136570682 16:31094745-31094767 GTTTTCTCCGCGGGCGCCTCGGG - Exonic
1138471961 16:57245143-57245165 GCGCGCGCCGCCGACGCCGCAGG - Exonic
1139761556 16:69187814-69187836 GCTCGCCCCGCCGGCGGGGCAGG - Intronic
1147150270 17:38510190-38510212 GGCCGCTCCTCCGGCGCCGCCGG - Exonic
1147285739 17:39401575-39401597 GTTGCGGCCGCCGGCGCCGCGGG - Exonic
1149610492 17:57955242-57955264 GTCCGCTCCGCGCGGGCCGCAGG + Exonic
1149685456 17:58532094-58532116 ACTCGCTCCGCCCCCGCCGCCGG - Intronic
1151746624 17:76015094-76015116 GCTCCCTCCGCTGGCGCTGCAGG + Exonic
1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG + Intergenic
1155152850 18:23136055-23136077 CCTCGCGCCGCAGGCGCCGCCGG - Exonic
1160635325 19:70963-70985 TTCCGCTCTGCCGGAGCCGCTGG + Intergenic
1160869252 19:1269527-1269549 GTCCGCCCCGCCGGCGGCGAGGG + Intronic
1161333745 19:3700184-3700206 GGTCGCTGCGGGGGCGCCGCCGG - Intronic
1162778758 19:12995920-12995942 GTCCCCTCCGCCCGCGCCGCCGG - Intronic
929174133 2:38960048-38960070 GTCCTCTCCGGCGGAGCCGCTGG + Exonic
930762306 2:55050027-55050049 CTTCGTGCCGCCGGCGCCCCGGG - Exonic
936566154 2:113584079-113584101 TTCCGCTCTGCCGGAGCCGCTGG - Intergenic
938058337 2:128233396-128233418 GGTCGCGCGGCCGTCGCCGCCGG - Intergenic
948933626 2:241148981-241149003 GCGGGCTCAGCCGGCGCCGCGGG - Intronic
1169204568 20:3732602-3732624 GGCCGCGCCGCCTGCGCCGCCGG - Intergenic
1175439480 20:58980994-58981016 GCTCGCAGAGCCGGCGCCGCAGG + Intergenic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1185313826 22:50170435-50170457 GGGCGCTCCGCCGCCGCCCCCGG - Intergenic
951543654 3:23806168-23806190 ACTCGCGCCGCCGGGGCCGCCGG + Intronic
952867192 3:37862004-37862026 GCTCCCGCCGCCGCCGCCGCTGG - Intronic
954663636 3:52239026-52239048 CTTCGCTCCGTCCGCGCCGTCGG + Exonic
968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG + Intergenic
973317844 4:48780102-48780124 CCTCGCTCCTCCAGCGCCGCCGG + Exonic
989744311 5:44809430-44809452 GCACGCGCCGCCTGCGCCGCAGG - Exonic
994043490 5:95284228-95284250 CTCGGCTCTGCCGGCGCCGCCGG + Exonic
997568194 5:134905280-134905302 GGTCCCTCAGCCGACGCCGCCGG - Intronic
1002926919 6:1610257-1610279 GCTGGCTCCTCCGGCGCCTCGGG - Exonic
1003108207 6:3231373-3231395 GGCAGCTCCGCCGGGGCCGCTGG - Intronic
1005532372 6:26721060-26721082 GTCCGTTCCGCCGGCGGGGCCGG - Intergenic
1005538423 6:26780605-26780627 GTCCGTTCCGCCGGCGGGGCCGG + Intergenic
1007448036 6:41921797-41921819 GTGCGTTCCCGCGGCGCCGCGGG - Exonic
1013155803 6:107490254-107490276 GCTCCCGCCGCCGCCGCCGCCGG - Exonic
1014205509 6:118651585-118651607 GTTCTCTCCGCCCCCTCCGCCGG + Intronic
1016272161 6:142301869-142301891 GTGCGCTCCGCCCGCGCTTCCGG - Intronic
1019667141 7:2257567-2257589 CTTCCCTCGGCCGGCTCCGCAGG - Intronic
1026941289 7:74289434-74289456 GCTGGCTCCGCTGGCTCCGCTGG + Intergenic
1026941292 7:74289443-74289465 GCTGGCTCCGCTGGCTCCGCGGG + Intergenic
1028621489 7:92833573-92833595 GCTCGCTCCTCCGGCGGCGGCGG - Exonic
1034264126 7:149773118-149773140 GGCCGCTCCGCCCGCGCCGCGGG + Exonic
1034448661 7:151126085-151126107 GGTCGTTCCGCCCGCGCCCCCGG + Intronic
1034977915 7:155458676-155458698 GCTCGCGCCGCCTTCGCCGCCGG - Exonic
1040981590 8:53251077-53251099 TTTCGCTCCCGCAGCGCCGCAGG - Exonic
1053946038 9:43311278-43311300 TTTCCCCCCGCCGTCGCCGCGGG + Intergenic
1055090997 9:72364836-72364858 GGTGGCGCCGCCGCCGCCGCGGG + Intronic
1056386247 9:86099470-86099492 GGTCGCTCTCCCGCCGCCGCCGG + Exonic
1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG + Exonic
1062592096 9:137278772-137278794 CTGTGCTCCGCCTGCGCCGCCGG + Exonic
1203589173 Un_KI270747v1:39858-39880 TTTCCCCCCGCCGTCGCCGCGGG + Intergenic
1187181460 X:16946988-16947010 GCGCGCTGTGCCGGCGCCGCGGG + Exonic
1192809493 X:74536415-74536437 GTTGGCTCCTCCCCCGCCGCGGG + Intergenic
1200107590 X:153723798-153723820 TTTCTCTCCGCGGGCGCCGTGGG - Exonic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic