ID: 1061038775

View in Genome Browser
Species Human (GRCh38)
Location 9:128127898-128127920
Sequence AGAGCCGCAGAGGCCCGCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061038768_1061038775 -2 Left 1061038768 9:128127877-128127899 CCCAAGTTCGAAACGCCCGCCAG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1061038775 9:128127898-128127920 AGAGCCGCAGAGGCCCGCTCGGG 0: 1
1: 0
2: 1
3: 10
4: 143
1061038769_1061038775 -3 Left 1061038769 9:128127878-128127900 CCAAGTTCGAAACGCCCGCCAGA 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1061038775 9:128127898-128127920 AGAGCCGCAGAGGCCCGCTCGGG 0: 1
1: 0
2: 1
3: 10
4: 143
1061038766_1061038775 5 Left 1061038766 9:128127870-128127892 CCCGGCGCCCAAGTTCGAAACGC 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1061038775 9:128127898-128127920 AGAGCCGCAGAGGCCCGCTCGGG 0: 1
1: 0
2: 1
3: 10
4: 143
1061038767_1061038775 4 Left 1061038767 9:128127871-128127893 CCGGCGCCCAAGTTCGAAACGCC 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1061038775 9:128127898-128127920 AGAGCCGCAGAGGCCCGCTCGGG 0: 1
1: 0
2: 1
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061038775 Original CRISPR AGAGCCGCAGAGGCCCGCTC GGG Exonic