ID: 1061039818

View in Genome Browser
Species Human (GRCh38)
Location 9:128133912-128133934
Sequence TCATCCAGGAGTGAAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061039814_1061039818 5 Left 1061039814 9:128133884-128133906 CCCTGCTTTCAATTCTCTCATGG No data
Right 1061039818 9:128133912-128133934 TCATCCAGGAGTGAAACTGCTGG No data
1061039816_1061039818 4 Left 1061039816 9:128133885-128133907 CCTGCTTTCAATTCTCTCATGGA No data
Right 1061039818 9:128133912-128133934 TCATCCAGGAGTGAAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061039818 Original CRISPR TCATCCAGGAGTGAAACTGC TGG Intergenic
No off target data available for this crispr