ID: 1061041382

View in Genome Browser
Species Human (GRCh38)
Location 9:128142753-128142775
Sequence CTGTGTAGACAGCTGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061041382_1061041388 -2 Left 1061041382 9:128142753-128142775 CCCAGCTGCAGCTGTCTACACAG No data
Right 1061041388 9:128142774-128142796 AGGCGGGGCTGCCCATGACCCGG No data
1061041382_1061041389 -1 Left 1061041382 9:128142753-128142775 CCCAGCTGCAGCTGTCTACACAG No data
Right 1061041389 9:128142775-128142797 GGCGGGGCTGCCCATGACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061041382 Original CRISPR CTGTGTAGACAGCTGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr