ID: 1061042121

View in Genome Browser
Species Human (GRCh38)
Location 9:128146316-128146338
Sequence TCCCTGGACCCCGGGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061042121_1061042131 28 Left 1061042121 9:128146316-128146338 CCAAGAGCCCCGGGGTCCAGGGA No data
Right 1061042131 9:128146367-128146389 CTTGTGTACCCTCATTGGCTAGG No data
1061042121_1061042132 29 Left 1061042121 9:128146316-128146338 CCAAGAGCCCCGGGGTCCAGGGA No data
Right 1061042132 9:128146368-128146390 TTGTGTACCCTCATTGGCTAGGG No data
1061042121_1061042130 23 Left 1061042121 9:128146316-128146338 CCAAGAGCCCCGGGGTCCAGGGA No data
Right 1061042130 9:128146362-128146384 GAACACTTGTGTACCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061042121 Original CRISPR TCCCTGGACCCCGGGGCTCT TGG (reversed) Intergenic
No off target data available for this crispr