ID: 1061048043

View in Genome Browser
Species Human (GRCh38)
Location 9:128177992-128178014
Sequence ATGGGGAAACAGACTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061048032_1061048043 4 Left 1061048032 9:128177965-128177987 CCACTCATCCCACCCCTTGTATG 0: 1
1: 0
2: 0
3: 22
4: 203
Right 1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG No data
1061048038_1061048043 -8 Left 1061048038 9:128177977-128177999 CCCCTTGTATGACAGATGGGGAA 0: 1
1: 1
2: 7
3: 38
4: 287
Right 1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG No data
1061048039_1061048043 -9 Left 1061048039 9:128177978-128178000 CCCTTGTATGACAGATGGGGAAA 0: 1
1: 2
2: 16
3: 84
4: 571
Right 1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG No data
1061048030_1061048043 22 Left 1061048030 9:128177947-128177969 CCAGGTCGGCCTAAAGTACCACT 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG No data
1061048035_1061048043 -5 Left 1061048035 9:128177974-128177996 CCACCCCTTGTATGACAGATGGG 0: 1
1: 1
2: 0
3: 9
4: 82
Right 1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG No data
1061048031_1061048043 13 Left 1061048031 9:128177956-128177978 CCTAAAGTACCACTCATCCCACC 0: 1
1: 0
2: 3
3: 7
4: 136
Right 1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG No data
1061048029_1061048043 23 Left 1061048029 9:128177946-128177968 CCCAGGTCGGCCTAAAGTACCAC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG No data
1061048033_1061048043 -4 Left 1061048033 9:128177973-128177995 CCCACCCCTTGTATGACAGATGG 0: 1
1: 1
2: 0
3: 19
4: 102
Right 1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG No data
1061048040_1061048043 -10 Left 1061048040 9:128177979-128178001 CCTTGTATGACAGATGGGGAAAC 0: 1
1: 3
2: 49
3: 263
4: 1451
Right 1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061048043 Original CRISPR ATGGGGAAACAGACTCAGGA GGG Intronic
No off target data available for this crispr