ID: 1061050227

View in Genome Browser
Species Human (GRCh38)
Location 9:128191033-128191055
Sequence TAGCAGGACTGGAGGTAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061050227 Original CRISPR TAGCAGGACTGGAGGTAACT TGG (reversed) Intronic
902834466 1:19037750-19037772 ATGGAGGGCTGGAGGTAACTTGG - Intergenic
903018619 1:20378102-20378124 TGGCAGGGCTGGAGGTGGCTGGG - Intergenic
903361232 1:22778684-22778706 CAGAAGGACTGGAAGTAAATGGG - Intronic
904451449 1:30615485-30615507 TAACAGGAATGCAGGTGACTGGG - Intergenic
904983066 1:34522967-34522989 TTGCAGGACTGCAGGGAAGTTGG + Intergenic
905105178 1:35559591-35559613 TAGCAGGGCTGGAAGTGGCTGGG + Intronic
907203008 1:52743834-52743856 TTGCAGGACTGGAAGGTACTTGG - Intronic
908495197 1:64688004-64688026 TGGCAGGACTGGAGGTGGGTGGG + Intronic
909082323 1:71127616-71127638 TGCCATGACTGGTGGTAACTAGG - Intergenic
912022849 1:105127664-105127686 TAGCATGACTGGAGTCAACAAGG - Intergenic
912170164 1:107090749-107090771 TGGCAGGACGGGAGGTGAATAGG - Intergenic
912638390 1:111320286-111320308 TAGCAGCTCTGGAGGCAGCTCGG + Exonic
918788320 1:188793462-188793484 TAGGAGAATTGGAGGTTACTAGG + Intergenic
921851661 1:219938485-219938507 TAGCAGGATTGCAGGTCCCTGGG - Intronic
922936507 1:229426898-229426920 TAGAAGGACTGCAGGGAAATGGG - Intergenic
924367740 1:243313804-243313826 GAGCAGGACTGTAGCTAACTGGG + Intronic
1063499865 10:6543759-6543781 GACAAGGACTGGAGGAAACTGGG + Intronic
1063529514 10:6817837-6817859 TAGCAAGAATGTAGATAACTGGG + Intergenic
1064968245 10:21036820-21036842 TATTAGGCCTGGAGGTGACTTGG + Intronic
1065016510 10:21467438-21467460 TATCAGAATTGGAGGTCACTAGG - Intergenic
1066632375 10:37469746-37469768 TGGCGAGACTGCAGGTAACTTGG - Intergenic
1067743296 10:48913383-48913405 TGGGAAGACTGGAGGTGACTTGG - Exonic
1076787764 10:132759599-132759621 TAGCAGGAATGGGGGTGCCTGGG - Intronic
1078916706 11:15784982-15785004 TATCAGGATTGGAGGCAACAGGG + Intergenic
1082808895 11:57466756-57466778 GAGAATGACTGGAAGTAACTTGG - Intronic
1087284476 11:96249975-96249997 TAGCAGGACCAGAGTAAACTAGG - Intronic
1091151951 11:133337321-133337343 TAGCAGCACTGTAGGTGAGTGGG - Intronic
1095154338 12:38834028-38834050 TGGCAGGAGAGGAGGTAACCAGG + Intronic
1095634015 12:44409996-44410018 TAGAAAGGCTGGAGGAAACTGGG - Intergenic
1096002077 12:48138514-48138536 AAGCAAGGCTGCAGGTAACTGGG - Intronic
1096220805 12:49827471-49827493 TGCCAGGACTGGAGATAACGCGG + Intronic
1096620971 12:52865390-52865412 GAGCAGGACTGGATTAAACTGGG - Intergenic
1096864849 12:54556457-54556479 TTGCAGGACTGGGGGATACTAGG - Intronic
1098848146 12:75563233-75563255 TGGCAGGATTGCAGGTAGCTGGG + Intergenic
1099046586 12:77728171-77728193 TAACAGGACTGGAGTGAGCTGGG - Intergenic
1104065219 12:125300090-125300112 GAGCAGGCCTGGAGGTATCTGGG - Intronic
1107624182 13:42266267-42266289 TAGCTACACTGGAGGTAAGTGGG + Intergenic
1109489287 13:63074957-63074979 TATCAAGCCTGGAAGTAACTTGG + Intergenic
1112471448 13:99693427-99693449 TATCAGGAATGGAGGCAGCTCGG + Intronic
1113666493 13:112145215-112145237 GAGCAGGCCTGGAGGTTACAGGG + Intergenic
1119326055 14:73760064-73760086 TCGCAGGACTGGGGGTGACACGG - Exonic
1121499298 14:94420875-94420897 TACCAGGTCTGCAGGGAACTTGG - Intergenic
1122289523 14:100672720-100672742 TTGCAGGACTGCAGGGAACGGGG - Intergenic
1123109758 14:105860577-105860599 GGGCAGGACTGCAGGGAACTGGG - Intergenic
1125199848 15:37093979-37094001 AAACAGGACTGGAAATAACTGGG + Intronic
1132458791 16:39176-39198 TAGCAGGACTGGGGGTGTCGGGG - Intergenic
1137239008 16:46638965-46638987 TGTCAGGACAGGAGGTAACTTGG - Intergenic
1137441034 16:48498570-48498592 TAGCAAGACTGGAGTTCAGTGGG + Intergenic
1141396600 16:83710610-83710632 TAACAGGGCTGGAGGAATCTGGG - Intronic
1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG + Intronic
1145297647 17:21604559-21604581 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1146142565 17:30379877-30379899 TAGCAGGACGGGAGGCTACGCGG - Intronic
1147917510 17:43897559-43897581 TGGCAGGTCTGGAGGGCACTGGG - Intronic
1148600801 17:48892897-48892919 TAGTAGGAGTGCAGGTGACTTGG + Exonic
1148843017 17:50511292-50511314 TAGCAGGAAGGGAGGGTACTAGG - Intronic
1150525252 17:65915947-65915969 TAGCTGGAATGGAGTGAACTTGG - Intronic
1152408731 17:80111554-80111576 TAGCAGGAATGGCAGAAACTGGG + Intergenic
1155192975 18:23447690-23447712 TGGCAGGACTTGAGGTAGATTGG - Intergenic
1157181427 18:45501699-45501721 GAGCAGGACTGGAAGTGACAAGG + Intronic
1157874926 18:51263634-51263656 TAGTAAGACTGGAGGTAATGAGG + Intergenic
1158380593 18:56925808-56925830 TAGTATGATAGGAGGTAACTGGG - Intronic
1159340928 18:67132216-67132238 TAGTAGGAGTGGAGTAAACTTGG + Intergenic
1164494395 19:28746153-28746175 TATCAGGACAGGAGATAACTTGG - Intergenic
1166775783 19:45311691-45311713 TTGCAGGACTGGAGGAGGCTGGG + Intronic
926049829 2:9737638-9737660 TAGAAGGAGTGGGGGTTACTAGG - Intergenic
926875187 2:17468292-17468314 AAGCAGGAATGGTGGTTACTGGG - Intergenic
928533897 2:32220440-32220462 TAGCTGGAGTTGATGTAACTGGG - Exonic
937469891 2:122165874-122165896 GAGCAGGCAGGGAGGTAACTTGG - Intergenic
945403342 2:209415741-209415763 TAGCAAGATTGCAGGTAACAAGG + Intergenic
946084165 2:217154363-217154385 TAGAAGGACTTGAGGCAACAAGG - Intergenic
1168893822 20:1310477-1310499 GAGCAGGACTGGAGGCAACCTGG + Exonic
1169134841 20:3190944-3190966 TAGCAGGACTGGATGCAGCCAGG - Intronic
1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG + Intergenic
1173670425 20:44795017-44795039 TAGCAGAACTGGATGATACTAGG - Intronic
1175324904 20:58116917-58116939 TAGCAGGAATTGAGCTAAGTAGG - Intergenic
1176675003 21:9769468-9769490 TAGCAGGACTGGAAGTTGCTGGG + Intergenic
1177667982 21:24186428-24186450 TAATAGTACTGGAGGAAACTGGG + Intergenic
1179202259 21:39235905-39235927 TGGCAGGACCGGAGACAACTGGG - Intronic
1179390210 21:40981858-40981880 TAGTAGGACTGGAGGTAAATTGG - Intergenic
1181588782 22:23869926-23869948 TAAAAGGGCTGGAGGGAACTAGG - Intronic
1183989455 22:41588655-41588677 TAGCAGGACTGGAGCAAAGGTGG - Intronic
1184302937 22:43573224-43573246 GAGCAGGACTGGAGGTTAAATGG + Intronic
1184556531 22:45236207-45236229 GAGCAGGACTGAAGGAAACGCGG + Intronic
949248437 3:1953296-1953318 TTGCAGGACTGGAAGTCACTGGG + Intergenic
949366248 3:3284730-3284752 TAGTAGAACTTGAGGTAAATAGG + Intergenic
951161940 3:19434041-19434063 TATCACCACTGGAGGAAACTAGG + Intronic
951647581 3:24910318-24910340 TAGCGGGACTGAACCTAACTGGG - Intergenic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
954173878 3:48827674-48827696 TTGCAGGACTGGAGTTATTTCGG + Intronic
954599032 3:51853330-51853352 TAACAGGACTGAGGGTACCTGGG + Intergenic
955046529 3:55366127-55366149 TTGCAGGACTGGAAGTTGCTTGG - Intergenic
958974974 3:100657409-100657431 CAGCAGTACTTCAGGTAACTGGG - Intronic
965147688 3:164927725-164927747 TCGCAGCATTGGAGGTAACATGG + Intergenic
969345497 4:6567344-6567366 TAGCTGGAATGGAGGGAACCAGG - Intergenic
976825384 4:89254999-89255021 TAGCAGGACTCCTGGTCACTTGG - Intronic
977249099 4:94669214-94669236 TAGCAGGCCTGGTGTTAATTAGG + Intergenic
982542253 4:156688603-156688625 TAGCAGGACTGAAGGGCACAGGG + Intergenic
984183202 4:176510535-176510557 TTGAAGCACTGGAGGTGACTTGG - Intergenic
984378510 4:178962039-178962061 TAGAAGCACTGGAGGAAACATGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985400550 4:189589226-189589248 TAGCAGGACTGGAAGTTGCTGGG - Intergenic
986943497 5:12986090-12986112 TAACAGGACTGTAGGTTTCTGGG + Intergenic
989148372 5:38271663-38271685 TCATAGAACTGGAGGTAACTGGG - Intronic
991035985 5:62127994-62128016 TAGTGGGGCTGGAGGTTACTAGG - Intergenic
992052622 5:72955593-72955615 TCGCTGGGCTGGAGGAAACTTGG - Intergenic
992408371 5:76481022-76481044 TAAAAGGGCTGGAGGGAACTAGG - Intronic
997568125 5:134905047-134905069 TACCAGGGCTGGCGGTAGCTGGG + Intronic
998212907 5:140214791-140214813 TAGAAGGATTGGAGCTAACCAGG + Intronic
998295397 5:140965352-140965374 TAGCAGTACAAGAGGAAACTTGG + Intronic
1006669172 6:35718991-35719013 TAGCAGAACAGGAGGCAGCTGGG + Intronic
1007205235 6:40144675-40144697 AAGCAAGAGTGGAGGTCACTAGG + Intergenic
1010188342 6:73167834-73167856 TAGAAGGGCTGGAGTGAACTAGG - Intronic
1012529186 6:100213726-100213748 GACAAGCACTGGAGGTAACTTGG + Intergenic
1013507018 6:110810942-110810964 TATCAAGACTGGAGGTAAGATGG + Intronic
1016302709 6:142650129-142650151 GAGCAGGACTGGAGGTTACATGG - Intergenic
1020401281 7:7780332-7780354 TAGAAGGAAAGGAGGTCACTGGG - Intronic
1020551884 7:9616888-9616910 TTGCAGGACTGGAAGTTGCTCGG + Intergenic
1027870950 7:83707573-83707595 TAGCAGGACTGCATGAACCTTGG - Intergenic
1028803471 7:94996102-94996124 TAGAAGGACTGGATATATCTTGG + Intronic
1028822036 7:95223204-95223226 TAACAGTACTGCAGGTAATTTGG + Intronic
1029962307 7:104700895-104700917 CAGCAGGCCTGGAGATAAATTGG - Intronic
1030186872 7:106771369-106771391 ATGCAGGAATGGAGGTTACTTGG + Intergenic
1030429491 7:109425453-109425475 TAACAGGAATAGAGGTAAATAGG + Intergenic
1030471162 7:109963928-109963950 TTGCAGGACTGGAAGTAACTGGG + Intergenic
1033763586 7:144463438-144463460 TAGCAGTATTAGAGGTAACTGGG - Intronic
1034823703 7:154240746-154240768 TAGCAGGACTTGAGGAAATGAGG - Intronic
1035313947 7:157986765-157986787 TGGCAGGACTGGAAGTAACTGGG + Intronic
1035405868 7:158596840-158596862 TAGCAGGCATGGAGTGAACTGGG - Intergenic
1037310067 8:17545718-17545740 AAGCAGGACTGCAGGTAAGAAGG - Intronic
1038144465 8:24882173-24882195 TAAAAGGACTGGAGGGCACTGGG - Intergenic
1040845462 8:51833299-51833321 TACTATGACTGGAGGTAACTTGG - Intronic
1042132565 8:65602159-65602181 TAGCACAACTGCAGGGAACTGGG + Intergenic
1042368059 8:67959234-67959256 TGGCAGGACTTGAGGGAAGTGGG + Intronic
1042919694 8:73909196-73909218 CAACAGGACTGAAGGTAACTGGG + Intergenic
1048992802 8:139771156-139771178 CACCAGGACTGGAGGTGGCTGGG - Intronic
1049046487 8:140156009-140156031 TAACATGACTGGAGGGAGCTCGG - Intronic
1051845711 9:21449243-21449265 TAGCAGGTTTGGAGGCACCTAGG + Intergenic
1053001382 9:34578785-34578807 TCCCAGCACTGGAAGTAACTTGG - Intronic
1055423772 9:76171739-76171761 TAAAATGACTGGAGGTGACTAGG - Intronic
1056590615 9:87963546-87963568 TGGTAGGACTGGAGGAAACTGGG - Intergenic
1057174786 9:92988267-92988289 TACCAGGAATGGTGGTAGCTTGG - Intronic
1061050227 9:128191033-128191055 TAGCAGGACTGGAGGTAACTTGG - Intronic
1203626136 Un_KI270750v1:25127-25149 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1197761495 X:130031198-130031220 TGGCAGGACTGGAGGATGCTGGG - Intronic
1198091009 X:133329988-133330010 TAGCAGAACTGGAGGTTCTTTGG - Intronic
1199872339 X:151911379-151911401 TAGCAGGACAGCAGGAAAATTGG + Intergenic
1202594466 Y:26521831-26521853 AAGCTGGACTGAAGGTATCTTGG - Intergenic