ID: 1061050343

View in Genome Browser
Species Human (GRCh38)
Location 9:128191461-128191483
Sequence AGTCGCCCCCACGGATGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061050335_1061050343 -1 Left 1061050335 9:128191439-128191461 CCCCGCGCGCCCTCAACGCTCAA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050337_1061050343 -3 Left 1061050337 9:128191441-128191463 CCGCGCGCCCTCAACGCTCAAGT 0: 1
1: 0
2: 0
3: 28
4: 577
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050336_1061050343 -2 Left 1061050336 9:128191440-128191462 CCCGCGCGCCCTCAACGCTCAAG 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050332_1061050343 12 Left 1061050332 9:128191426-128191448 CCGCACCTCGCCTCCCCGCGCGC 0: 1
1: 0
2: 0
3: 43
4: 490
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050323_1061050343 29 Left 1061050323 9:128191409-128191431 CCCAGCCGCCCCCGGCCCCGCAC 0: 1
1: 0
2: 5
3: 96
4: 850
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050338_1061050343 -10 Left 1061050338 9:128191448-128191470 CCCTCAACGCTCAAGTCGCCCCC 0: 1
1: 0
2: 0
3: 25
4: 542
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050333_1061050343 7 Left 1061050333 9:128191431-128191453 CCTCGCCTCCCCGCGCGCCCTCA 0: 1
1: 0
2: 2
3: 50
4: 464
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050327_1061050343 20 Left 1061050327 9:128191418-128191440 CCCCGGCCCCGCACCTCGCCTCC 0: 1
1: 1
2: 4
3: 64
4: 684
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050330_1061050343 14 Left 1061050330 9:128191424-128191446 CCCCGCACCTCGCCTCCCCGCGC 0: 1
1: 0
2: 6
3: 61
4: 617
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050324_1061050343 28 Left 1061050324 9:128191410-128191432 CCAGCCGCCCCCGGCCCCGCACC 0: 1
1: 1
2: 25
3: 293
4: 1918
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050325_1061050343 24 Left 1061050325 9:128191414-128191436 CCGCCCCCGGCCCCGCACCTCGC 0: 1
1: 1
2: 12
3: 226
4: 2137
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050334_1061050343 2 Left 1061050334 9:128191436-128191458 CCTCCCCGCGCGCCCTCAACGCT 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050328_1061050343 19 Left 1061050328 9:128191419-128191441 CCCGGCCCCGCACCTCGCCTCCC 0: 1
1: 0
2: 5
3: 134
4: 1084
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050326_1061050343 21 Left 1061050326 9:128191417-128191439 CCCCCGGCCCCGCACCTCGCCTC 0: 1
1: 0
2: 5
3: 68
4: 655
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050329_1061050343 18 Left 1061050329 9:128191420-128191442 CCGGCCCCGCACCTCGCCTCCCC 0: 1
1: 0
2: 26
3: 266
4: 3750
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061050331_1061050343 13 Left 1061050331 9:128191425-128191447 CCCGCACCTCGCCTCCCCGCGCG 0: 1
1: 0
2: 2
3: 29
4: 301
Right 1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061050343 Original CRISPR AGTCGCCCCCACGGATGGGC CGG Exonic
902286584 1:15411443-15411465 AGTGGGACCCAGGGATGGGCCGG - Intronic
915316779 1:155033254-155033276 TGTCGCCCCCAGGGCAGGGCCGG - Exonic
917285624 1:173419006-173419028 TGTGGCCCCCACGGTGGGGCTGG + Intergenic
922340228 1:224649006-224649028 AGGAGCCACCACTGATGGGCTGG - Intronic
922925423 1:229343115-229343137 AGCCGCCCCCACGGAGCGGGCGG - Intronic
1062968247 10:1626572-1626594 AGTCTGCCTCACGGATGGCCTGG - Intronic
1069574437 10:69516787-69516809 AGTCTCCCCCACTGAGGGGTGGG + Intergenic
1074535594 10:114326284-114326306 AGTTGCCCCCAGGAATGGGGAGG - Intronic
1076004028 10:126933613-126933635 AGTCAGCCCCCCGGATGAGCAGG + Intronic
1078124013 11:8540719-8540741 AGTAGCTACCATGGATGGGCAGG + Intronic
1084216405 11:67649023-67649045 AGCTGCCCCCAGGGCTGGGCCGG - Intronic
1084546229 11:69816452-69816474 CGCCGCCCCCACGGAGGGGGCGG + Intronic
1095981488 12:47977054-47977076 AGTCCCCACCAGGGATAGGCTGG - Intronic
1102472634 12:113168167-113168189 AGCCGCCTCCAGGCATGGGCTGG + Intronic
1107873062 13:44764635-44764657 AGTGGGCCCCAGGGATGCGCTGG - Intergenic
1119200242 14:72746721-72746743 AGTCCACCCCAGGGATGGGCAGG - Intronic
1122957090 14:105075937-105075959 CGACGCCCCCACGGGAGGGCTGG + Intergenic
1124165001 15:27318551-27318573 AATCGGCCCTAGGGATGGGCTGG - Intronic
1125903608 15:43370877-43370899 AGACGCTCCCAGGGGTGGGCTGG - Intronic
1131977465 15:97960848-97960870 AGTCGCCCGGCGGGATGGGCGGG + Exonic
1134300439 16:12985955-12985977 AGTCGGCCCCACCGCTGGCCTGG - Intronic
1134783899 16:16923498-16923520 AATTGCCCCCAAGGTTGGGCAGG + Intergenic
1147585217 17:41650808-41650830 AGGCTCTCCCACGTATGGGCTGG - Intergenic
1148158408 17:45436446-45436468 AATCGCCCCCAGGGAAGGGTGGG + Exonic
1148382353 17:47209287-47209309 AGGAGCCCCCACAGAGGGGCTGG - Intronic
1151585006 17:75003540-75003562 AGTCGTCCCCGCGGCCGGGCTGG - Exonic
1151828857 17:76538170-76538192 GTTCGCCCCCACGGGCGGGCTGG - Intronic
1152343775 17:79739358-79739380 AGTGGCTCCCACTGCTGGGCCGG + Intronic
1152757083 17:82091552-82091574 CGTTGCCGCCACGGACGGGCAGG + Exonic
1160286120 18:77545079-77545101 AGAGGCCCCCACGGACTGGCTGG - Intergenic
1160754524 19:750699-750721 AGTTGCCCCAAGGGGTGGGCTGG + Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162398313 19:10430681-10430703 AGCCGCCCCCAGGGCGGGGCGGG - Intronic
1163828365 19:19536050-19536072 AGCCACCCCCACGGAGGGTCCGG - Exonic
1165129222 19:33621861-33621883 AGCCGCCACCACGGCGGGGCGGG + Intergenic
925384299 2:3451300-3451322 AGTATCCCCCACGGTGGGGCTGG + Intronic
934059924 2:88284109-88284131 AGGCGCCCCCAGGGAGTGGCTGG - Intergenic
935405897 2:102708413-102708435 AGCCGCCACCACGGCTGGTCTGG + Exonic
937338146 2:121074693-121074715 AGTGGCCCCCAGGGATGGAGAGG + Intergenic
948061529 2:235046041-235046063 AGTGGCCCCCAGGGTTGGGATGG - Intronic
948620335 2:239230594-239230616 AGTGGCCCCCACGGAAGGACTGG - Intronic
1172091158 20:32433905-32433927 AGTCTCCTACCCGGATGGGCGGG - Exonic
1175852128 20:62099293-62099315 AGGAGCCCCCACGGAAGGGCTGG - Intergenic
1183050585 22:35257729-35257751 AGCCGCCCCCAGGAAGGGGCTGG + Intronic
953570111 3:44064603-44064625 AGTTTCCCACAGGGATGGGCAGG - Intergenic
960664488 3:120095622-120095644 AATGGCCCCCGCGGCTGGGCGGG - Intergenic
968658691 4:1789815-1789837 AGTCACCGCCAGGGCTGGGCTGG + Intergenic
969049618 4:4363515-4363537 ACTGGCCCCAAGGGATGGGCAGG + Intronic
975562781 4:75723342-75723364 AGTCTCACCCAAGGATGGACTGG + Intronic
985223953 4:187738723-187738745 ACTAGCCCCCAGGGATGAGCAGG + Intergenic
985543911 5:499847-499869 AGTGGCCCCTACAGAGGGGCTGG - Intronic
985801842 5:2009560-2009582 AGTTAGCCTCACGGATGGGCTGG + Intergenic
990042009 5:51387607-51387629 ATTCGTCCCCAGGGATGAGCTGG - Exonic
998130816 5:139650281-139650303 AGTCGCGCCTTCGGATGGGGGGG + Intronic
1004750951 6:18561290-18561312 AGACTCCTCCAGGGATGGGCGGG + Intergenic
1006271769 6:32970962-32970984 AGTCCTCCCCACGGAGCGGCTGG - Exonic
1021521307 7:21542151-21542173 AGTAGCCCCCATGGAAGGGGTGG + Intergenic
1025942848 7:66086630-66086652 AGTGGCTCCAGCGGATGGGCTGG - Exonic
1029524974 7:101088733-101088755 ATTCGGCCCCAGGGCTGGGCTGG - Exonic
1040299081 8:46178662-46178684 AGTAGCCCCCAGGGCTGGGATGG + Intergenic
1049105349 8:140609110-140609132 CGTGGCCCCCAGGGAAGGGCTGG - Intronic
1049610649 8:143553323-143553345 AGGCGCCCCCTCTGAGGGGCTGG + Exonic
1050151458 9:2622400-2622422 AGGCGCCACCACGGAGGGGAGGG - Intronic
1051500933 9:17776978-17777000 AGTAGCTCCCACGGATAGGGAGG + Intronic
1058699338 9:107587864-107587886 GGCCGCCCGCACGGAAGGGCCGG - Intergenic
1060222649 9:121772832-121772854 CGTCCTCCCCACAGATGGGCAGG + Exonic
1060733017 9:126049896-126049918 AGTTGCCCTCTCGGAAGGGCGGG + Intergenic
1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG + Exonic
1062458157 9:136650253-136650275 AGTTGCTCCCAGGGGTGGGCGGG - Intergenic
1191152936 X:57240672-57240694 AGTCTCCCCTACAGATGTGCTGG - Intergenic