ID: 1061055060

View in Genome Browser
Species Human (GRCh38)
Location 9:128218170-128218192
Sequence AGGGGGCGCCCTCTGTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061055060_1061055070 17 Left 1061055060 9:128218170-128218192 CCCTGGGACAGAGGGCGCCCCCT 0: 1
1: 0
2: 0
3: 17
4: 168
Right 1061055070 9:128218210-128218232 TTGACCTCCAACTCATTGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 100
1061055060_1061055069 16 Left 1061055060 9:128218170-128218192 CCCTGGGACAGAGGGCGCCCCCT 0: 1
1: 0
2: 0
3: 17
4: 168
Right 1061055069 9:128218209-128218231 TTTGACCTCCAACTCATTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061055060 Original CRISPR AGGGGGCGCCCTCTGTCCCA GGG (reversed) Intronic
900210394 1:1452771-1452793 AGGAGCCTCGCTCTGTCCCAAGG - Intronic
900267199 1:1763824-1763846 TGGAGGCGACCTCTGACCCAGGG + Intronic
901223414 1:7596932-7596954 AGGGGGCTCCGCCTGTCTCAAGG - Intronic
901253279 1:7797941-7797963 GGGGTGCGCCCTCTGGGCCAGGG + Intronic
903171868 1:21559258-21559280 CGGGGCTCCCCTCTGTCCCAGGG - Intronic
904612368 1:31732612-31732634 AGCAGGCGCCCTCTGTCCCCAGG - Exonic
904772080 1:32886288-32886310 AGGGGACGCCCTCAGTTCCCCGG - Intronic
905394864 1:37660717-37660739 GGGGGCCGCCCCCTTTCCCAGGG - Intergenic
905445744 1:38027525-38027547 AGGGCGCACCCTCTGACCCGGGG - Intergenic
906687990 1:47774851-47774873 ACAGGGCGCCATTTGTCCCATGG - Intronic
910129390 1:83885677-83885699 AGGGGGCACCCACTGCCCTAGGG - Intronic
912695337 1:111837417-111837439 AGGGGCCCTGCTCTGTCCCATGG + Intronic
913131667 1:115843130-115843152 AGGAGGGGCCATCTGTGCCAGGG - Exonic
917520403 1:175743491-175743513 AGGGGGTCCTCTCTGACCCAAGG - Exonic
917966339 1:180181254-180181276 AGGGGGCGCCACCTGCTCCATGG + Intronic
918693426 1:187511449-187511471 AGGGGGCTGCCTATCTCCCATGG + Intergenic
920106263 1:203555763-203555785 AGGGGGCTGCCTCTTTTCCAAGG - Intergenic
920384939 1:205564401-205564423 TGGGGCTGCCCTCTGTCCCCAGG - Intergenic
922169495 1:223143013-223143035 AGGCGGCGCTCTCTGCCCCGCGG - Intronic
1062920338 10:1274264-1274286 TGGGGGCCACATCTGTCCCACGG + Intronic
1066472069 10:35708802-35708824 ATGGAGCTCCCTGTGTCCCAAGG - Intergenic
1067295933 10:44975212-44975234 CGGGGGCTCCGTCTCTCCCAGGG + Intronic
1069507005 10:69008348-69008370 AGGGGTCTCACTCTGGCCCAAGG - Intronic
1069792990 10:71035222-71035244 AGGGAGCTCACTCTCTCCCATGG - Intergenic
1070800952 10:79243973-79243995 TGGGGGCGCACTCTGCCCCGTGG - Intronic
1070805311 10:79267232-79267254 AGGGGGCACTGTCTGCCCCAGGG + Intronic
1076786976 10:132754738-132754760 TGGGGGCCCCCTCCTTCCCATGG - Intronic
1077069184 11:660056-660078 ATGGGGAGCCCTCTGCCCCATGG - Intronic
1078152120 11:8768139-8768161 AGGGAGCCCACTCTGTCTCAGGG - Intronic
1084284640 11:68123008-68123030 AGTGGCCGGCCTCCGTCCCAGGG - Intergenic
1085195934 11:74671751-74671773 AGGGAGGGTCCTCTGTCCCCTGG - Intergenic
1085756913 11:79209373-79209395 AGGGAACGCCTTCTGGCCCAGGG - Intronic
1088154831 11:106790389-106790411 ATGGGCTGCCCTCTGGCCCAGGG + Intronic
1090801605 11:130176306-130176328 AGGGGGTTCCCTTGGTCCCAGGG + Intronic
1091370240 11:135051469-135051491 AGGGAGCTGCCTCTGTCCCCAGG - Intergenic
1096570769 12:52521844-52521866 CGGGGGCGCCCTGTGGCCCGAGG + Intergenic
1101251956 12:102945696-102945718 AGTGGGCCCCCTCTGGCCCAGGG + Intronic
1101826642 12:108225544-108225566 GGGGAACTCCCTCTGTCCCAAGG - Intronic
1103852579 12:123942965-123942987 AGAGGGTGCCCTCTGACCCCAGG - Intronic
1104679482 12:130739643-130739665 AGGGGGTGCCCACTGTCCTTGGG + Intergenic
1104925435 12:132311635-132311657 AGGGAGGGCCCGCTGTCCCACGG - Intronic
1105701820 13:22940157-22940179 AAGTGGGGCCCTCTGCCCCAGGG + Intergenic
1105854444 13:24361942-24361964 AAGTGGGGCCCTCTGCCCCAGGG + Intergenic
1113901959 13:113802503-113802525 AGGGGGCGCCCCTCGTCCCTGGG - Intronic
1114672240 14:24417457-24417479 CGGGGGTGCCCCCTGCCCCAGGG + Exonic
1117547023 14:56801938-56801960 AGGGGCCACACTCAGTCCCATGG - Exonic
1119745940 14:77043932-77043954 AAGAGGTGCCCTGTGTCCCAGGG - Intergenic
1120697465 14:87659928-87659950 AGTGGGCTCCCTCTGGCCCAGGG - Intergenic
1121992127 14:98568441-98568463 TGGGGGCGCCTTTTGTCCCTAGG + Intergenic
1122329307 14:100902114-100902136 AGGGAGCTCCCTCTCTCCCCAGG + Intergenic
1122797316 14:104212528-104212550 GGGGAGCGCCCGCTGTGCCAGGG - Intergenic
1122982043 14:105196396-105196418 GAGGGGCACCCTCTGTCTCAGGG + Intergenic
1123940132 15:25212743-25212765 AGGGGGCATCCCATGTCCCATGG + Intergenic
1124012369 15:25849144-25849166 AGGGACAGCCCTTTGTCCCAGGG - Intronic
1125484595 15:40103450-40103472 TGGAGGAGCCCTCTGTGCCATGG - Intronic
1127047615 15:55043489-55043511 ATGGGGCTCTCTTTGTCCCAGGG + Intergenic
1129392744 15:75228770-75228792 AGCTGCCTCCCTCTGTCCCAGGG + Intergenic
1130549138 15:84878693-84878715 AGGGGGCGCCTCCTGTCCAGAGG - Intergenic
1132618429 16:853319-853341 AGGGGAGGGCCTCTGTCCTATGG + Intergenic
1132863101 16:2081194-2081216 CGGGGGCTCCCTCTGCCCCTGGG - Intronic
1135616316 16:23913918-23913940 TGGGGGCCATCTCTGTCCCAAGG - Intronic
1142008516 16:87701800-87701822 AGCTGGAGGCCTCTGTCCCATGG - Intronic
1143026988 17:3946831-3946853 AGGAGGAGCCTTCTGCCCCATGG + Intronic
1143619184 17:8071510-8071532 AGGTGGCGTCCACTGCCCCAGGG + Intergenic
1143864649 17:9915174-9915196 AGAGGGCTCACTCTATCCCAGGG + Exonic
1143918025 17:10309177-10309199 AGGAGGCGCTATCTGCCCCAGGG + Intronic
1144722510 17:17481230-17481252 AGGTGGCGCTCTCTGGCCCTGGG + Intronic
1145992970 17:29090236-29090258 TGGGGGAGGCCTCTGGCCCAGGG - Intronic
1148695349 17:49555315-49555337 AGGGGGCTCCCACTGACTCAGGG - Intergenic
1150223682 17:63511157-63511179 AGGGGCCTGCCTCTCTCCCATGG - Intronic
1150229583 17:63542828-63542850 AGGGGGTGCCTTCTGTCCAGAGG + Intronic
1152294286 17:79457586-79457608 TTGGGGCGCCCTCTCTCCCCAGG + Intronic
1152753720 17:82078235-82078257 AGGGGATGCCCTCTGTCCTCTGG - Intergenic
1160811707 19:1015627-1015649 AGGGGGCGCCCACGGCCACATGG + Intronic
1161335757 19:3712366-3712388 AGAGGGGGCCCCCTGCCCCATGG - Intronic
1161335759 19:3712375-3712397 AGGGGGCCCCCTCTAGCCCTGGG + Intronic
1162130440 19:8522784-8522806 AGGGGGCCCCCTCTGGCAGAGGG + Exonic
1162798766 19:13099762-13099784 AGGGGCCGCCCTTTGGGCCATGG - Intronic
1163815896 19:19464233-19464255 AGTGGGCACCAACTGTCCCATGG + Intronic
1163834554 19:19565237-19565259 AGGTGGCGCCCTCTGAACCACGG + Intronic
1164457113 19:28417966-28417988 AGTGGGCTCCCCCTGGCCCAGGG + Intergenic
1164587606 19:29485677-29485699 AGTGGGGGCTCTGTGTCCCAGGG - Intergenic
1167049691 19:47070859-47070881 ACGGGGCTCCCACTGCCCCACGG + Intronic
1168290400 19:55354566-55354588 AGGGCGCCCCCTCGGCCCCACGG - Intronic
925126307 2:1459837-1459859 AAGGGGCCCCCTGTCTCCCAGGG - Intronic
926345738 2:11943325-11943347 CGGTGGCCCCCTCTGACCCATGG + Intergenic
927430837 2:23025032-23025054 GGTGGGCTCTCTCTGTCCCATGG - Intergenic
929460713 2:42100817-42100839 AGGGGCCGGCCTCTCTCTCAGGG + Intergenic
930439656 2:51390322-51390344 AGTGGGCTCTCTCTGGCCCAGGG + Intergenic
934810282 2:97271548-97271570 AGGGGGAGCTCTCTCACCCAGGG + Intergenic
934827410 2:97436391-97436413 AGGGGGAGCTCTCTCACCCAGGG - Intergenic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
942915027 2:181294761-181294783 AGTGGGCACCCTCTGGCCCAGGG - Intergenic
947793807 2:232882145-232882167 AGGGGGCGCCATTTGTCCTTGGG - Intronic
948467691 2:238160032-238160054 AGGGGGTGCCTTCAGTCCCTGGG - Intronic
1169105914 20:2994310-2994332 AGGGGGCCCCCTCTCTAGCATGG + Intronic
1169329671 20:4706416-4706438 AGAGGGAGGCCTCTGTCCCGTGG - Intergenic
1169585925 20:7085422-7085444 AGGGGGAGGGCTCTGTTCCATGG + Intergenic
1170114104 20:12838460-12838482 AGGGGGCACACTCTCTCACAAGG + Intergenic
1171240928 20:23566456-23566478 ATGAGGCTCCCTCTGTCCCAGGG - Intronic
1171242694 20:23584918-23584940 ATGAGGCTCCCTCTGTCCCAGGG + Intergenic
1171245064 20:23604134-23604156 ATGAGGCTCCCTCTGTCCCAGGG - Intronic
1171522946 20:25789204-25789226 AAGCTGCTCCCTCTGTCCCATGG + Intronic
1171530690 20:25851173-25851195 AAGCTGCTCCCTCTGTCCCATGG + Intronic
1171553881 20:26066679-26066701 AAGCTGCTCCCTCTGTCCCATGG - Intergenic
1172173682 20:32959911-32959933 AGGGGGCGCTCTCCGGCCCACGG - Intronic
1172626529 20:36350592-36350614 AGGGCATGCCCTCTGTACCAGGG + Intronic
1175814380 20:61875900-61875922 AGGGGCTGCCCTCTCTCCCCAGG - Intronic
1179450707 21:41466610-41466632 AGGGGGCGTCACCTGGCCCAGGG - Intronic
1179533004 21:42032946-42032968 AGAAGGCCCCCTCTGGCCCAAGG + Intergenic
1180131668 21:45830643-45830665 AAGGGGCGGCTGCTGTCCCAGGG - Intronic
1183491777 22:38120682-38120704 ACAGGGAGCCCTCTGTCCCCAGG + Intronic
1185258434 22:49849103-49849125 AGGGGACGCGCACTGTCCCCGGG - Intergenic
953876504 3:46669794-46669816 TGCGGGTGCCCTCTGCCCCAAGG + Exonic
955081767 3:55664448-55664470 TGGGGGTGCCCTCTGTGCCCAGG - Intronic
960681233 3:120249587-120249609 AGTGGGTTCCCTCTGGCCCAGGG - Intronic
960955515 3:123027926-123027948 AGGGGGCGCCCTGCATCCCGCGG + Intronic
973695667 4:53488182-53488204 AGGGAGCTCACTGTGTCCCAAGG + Intronic
974867922 4:67603274-67603296 AGGGGCGCCCCTCTGACCCAAGG + Intronic
983229175 4:165112607-165112629 AGGGGGCGCCGCCTGTGCCCGGG - Intronic
985064653 4:186108569-186108591 AAGGGGCAGCCTCTGTTCCATGG - Intronic
985229443 4:187799133-187799155 GAGGGGTCCCCTCTGTCCCAGGG - Intergenic
987684386 5:21178545-21178567 AGGGGGCAGCCTCTGCCTCAGGG - Intergenic
988297987 5:29390790-29390812 AGCGGGCGTCCCCAGTCCCAGGG - Intergenic
989128463 5:38079738-38079760 AGGGGAAGTCCTCTGTCTCATGG - Intergenic
989427831 5:41316605-41316627 AGTGGGCTCCCTCTGACCCTGGG - Intronic
991934046 5:71784258-71784280 AGGAGGCTCCCTCTGCCTCAAGG + Intergenic
994631698 5:102295795-102295817 AGGGCGCGTCCACCGTCCCACGG + Intronic
994888480 5:105598511-105598533 AGGGGTCTCACTCTGTCCCCGGG + Intergenic
997883901 5:137614002-137614024 AGGACGAGCTCTCTGTCCCAGGG - Intergenic
1000834294 5:166135342-166135364 AGATGGCGTCCCCTGTCCCACGG + Intergenic
1002170240 5:177370769-177370791 AGGGGGCGGGGTTTGTCCCAGGG - Intronic
1004605600 6:17192338-17192360 AGAGAGCCCCCTCTGTCCCAGGG + Intergenic
1005958179 6:30679143-30679165 AGGGGGCGCCCTCGGGCCGGCGG + Intronic
1006053505 6:31362727-31362749 AGGGAGGGCCAGCTGTCCCAGGG - Intergenic
1006751009 6:36376960-36376982 AGGAGGCTCCCTTTGTCCCCTGG - Intronic
1007791822 6:44313417-44313439 AGGGGGCGGCCTCTGCCGCCGGG + Intronic
1011359707 6:86510725-86510747 AATGGGCCCCCTCTGGCCCAGGG + Intergenic
1011607204 6:89117519-89117541 GAGGGGCGCCCCGTGTCCCACGG + Intronic
1013097726 6:106961193-106961215 AAGGGGTGCCCTCTGTGCCTTGG + Intergenic
1015578789 6:134701589-134701611 AGTGGGCTCCCTCTGGCCCAGGG + Intergenic
1015794417 6:136996902-136996924 TGGAGGCTCCTTCTGTCCCAAGG - Intergenic
1015999435 6:139028670-139028692 AGGGGCCGCCCACACTCCCAGGG - Exonic
1018652629 6:166004879-166004901 ATGGGGTGCCTTCTGCCCCAGGG + Intergenic
1018867595 6:167758353-167758375 AGGGGATGCCCTCTATGCCACGG + Intergenic
1019278606 7:188788-188810 TGGGGGGCCCGTCTGTCCCAGGG + Intergenic
1019327655 7:446184-446206 AGGGGGCGCCTCTTGTCCGAGGG + Intergenic
1020130573 7:5556584-5556606 AGGGGGCGCCCTCGGAGCCATGG + Intronic
1024505771 7:50159806-50159828 AGGGGGAGCCCTCTGGCCTTCGG + Exonic
1026959415 7:74398948-74398970 AAGTGGCGGCCTCTGCCCCAGGG + Intronic
1032194341 7:129780712-129780734 AGGGGGCGCACCCGGACCCAGGG + Intergenic
1032468410 7:132161218-132161240 AGGTGGCAGCCTCTGCCCCATGG - Intronic
1034489862 7:151387412-151387434 AGGGGGCGCTCCCAGCCCCAGGG + Intronic
1035643572 8:1201355-1201377 AGGGGGAGCCCCCTGCCCCACGG - Intergenic
1035692063 8:1566689-1566711 AGGGAGGGCCCTGTGGCCCAGGG - Intronic
1037983233 8:23269961-23269983 AGTGGGAGCCCTCTGTTCCAGGG + Intergenic
1038284317 8:26193296-26193318 AGGGGGAGCCCTCTGTGCAGCGG - Intergenic
1039822497 8:41146285-41146307 AAGGGGCTCCCTCTCTCACAAGG + Intergenic
1039953629 8:42191075-42191097 GGGGGGCGGCCACTGGCCCAAGG - Intronic
1049332949 8:142064885-142064907 AAGCAGCCCCCTCTGTCCCAGGG - Intergenic
1049469995 8:142770953-142770975 GGGGGGTGGCCTCTCTCCCACGG + Intronic
1049766344 8:144356970-144356992 ATGGTGAGCCCTGTGTCCCAAGG - Exonic
1053003350 9:34589804-34589826 AGCGGGCGCCCGCGGTCACATGG - Intronic
1057631273 9:96720726-96720748 AGGAGTCTCCCTCTGCCCCAGGG - Intergenic
1057855746 9:98599597-98599619 AGGGGGCCACCTCTGTCCTACGG + Intronic
1060634480 9:125189407-125189429 ATGTCGCGGCCTCTGTCCCAGGG - Intronic
1060745315 9:126127247-126127269 ACGGGGTGCCCTCTGGTCCAGGG + Intergenic
1061055060 9:128218170-128218192 AGGGGGCGCCCTCTGTCCCAGGG - Intronic
1061466730 9:130786229-130786251 AGGGACGGCCCTCTGCCCCAGGG - Intronic
1061884409 9:133584337-133584359 AGGGAGAGGCCTCTGACCCAAGG - Intronic
1062206840 9:135342183-135342205 AGGGGGCTCCCAGTGTCCGATGG + Intergenic
1062353037 9:136148440-136148462 CGGGGGGGCCCCCAGTCCCAGGG + Intergenic
1062501052 9:136852227-136852249 AGGAGGGGGCCTCTGACCCAGGG - Intronic
1189333842 X:40158252-40158274 CCGGGGCGCGCGCTGTCCCAGGG - Intronic
1189746107 X:44170557-44170579 AGAGGCCTCCCTCTGTCTCATGG + Intronic
1191991203 X:67038846-67038868 AGTGTGCTCCCTCTGGCCCAGGG + Intergenic
1192502669 X:71664055-71664077 AGGAGGCACCCTCTCTCCCTGGG + Intergenic
1192529009 X:71870548-71870570 AGGAGGCACCCTCTGTCCGTGGG + Intergenic
1192694437 X:73399528-73399550 ATGGGTTCCCCTCTGTCCCAGGG - Intergenic
1193698726 X:84739324-84739346 AGAGGGCGTCCCCTTTCCCATGG - Intergenic
1194522066 X:94931468-94931490 ATGGGCTTCCCTCTGTCCCACGG + Intergenic
1196214487 X:113034962-113034984 AGGGGTCTCCCTCTAGCCCAAGG + Intergenic
1197391880 X:125877785-125877807 ATGGGTCCCCCTCTGGCCCAAGG + Intergenic
1197873702 X:131083312-131083334 GGGTGGCGTCCACTGTCCCAGGG + Intronic
1200071657 X:153532248-153532270 AGGGGGCACCCCCGCTCCCATGG - Intronic
1200162144 X:154015134-154015156 AGGGAGCGCCCCGAGTCCCAGGG + Intronic