ID: 1061057826

View in Genome Browser
Species Human (GRCh38)
Location 9:128233612-128233634
Sequence CCACGCCTTTAGGAAGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061057813_1061057826 19 Left 1061057813 9:128233570-128233592 CCAGAGGCTGTCCCCTGCCTGAT 0: 1
1: 0
2: 0
3: 22
4: 239
Right 1061057826 9:128233612-128233634 CCACGCCTTTAGGAAGGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 99
1061057818_1061057826 -5 Left 1061057818 9:128233594-128233616 CCCCATCTAGCTGTCCCTCCACG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1061057826 9:128233612-128233634 CCACGCCTTTAGGAAGGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 99
1061057814_1061057826 8 Left 1061057814 9:128233581-128233603 CCCCTGCCTGATTCCCCATCTAG 0: 1
1: 1
2: 2
3: 20
4: 217
Right 1061057826 9:128233612-128233634 CCACGCCTTTAGGAAGGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 99
1061057819_1061057826 -6 Left 1061057819 9:128233595-128233617 CCCATCTAGCTGTCCCTCCACGC 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1061057826 9:128233612-128233634 CCACGCCTTTAGGAAGGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 99
1061057815_1061057826 7 Left 1061057815 9:128233582-128233604 CCCTGCCTGATTCCCCATCTAGC 0: 1
1: 0
2: 3
3: 16
4: 173
Right 1061057826 9:128233612-128233634 CCACGCCTTTAGGAAGGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 99
1061057817_1061057826 2 Left 1061057817 9:128233587-128233609 CCTGATTCCCCATCTAGCTGTCC 0: 1
1: 0
2: 0
3: 17
4: 131
Right 1061057826 9:128233612-128233634 CCACGCCTTTAGGAAGGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 99
1061057820_1061057826 -7 Left 1061057820 9:128233596-128233618 CCATCTAGCTGTCCCTCCACGCC 0: 1
1: 0
2: 0
3: 10
4: 204
Right 1061057826 9:128233612-128233634 CCACGCCTTTAGGAAGGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 99
1061057816_1061057826 6 Left 1061057816 9:128233583-128233605 CCTGCCTGATTCCCCATCTAGCT 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1061057826 9:128233612-128233634 CCACGCCTTTAGGAAGGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061057826 Original CRISPR CCACGCCTTTAGGAAGGCAC AGG Intronic
901911549 1:12462860-12462882 CCATGCCCTCATGAAGGCACTGG + Intronic
902055222 1:13595248-13595270 CCACACCATCAGGAAGGGACAGG - Intronic
904383667 1:30127890-30127912 CCATGCCTTTCGGTAGGCTCAGG - Intergenic
905320236 1:37110966-37110988 CCTGGCCTTGAGGAAGGCTCAGG + Intergenic
906330178 1:44877727-44877749 CCAGTCTATTAGGAAGGCACAGG + Intronic
906330386 1:44879211-44879233 CCAGGCCTTAATGAAGGCAGGGG - Intronic
912254073 1:108041271-108041293 CTGCCCCTTTAGGAAGGCAGGGG + Intergenic
918507217 1:185269202-185269224 CCAATCCTTTAGAAAGGCAAGGG - Intronic
922272410 1:224045735-224045757 CAAGGCCTTAAGGAAGGCATGGG + Intergenic
1062760322 10:12438-12460 CCACGCCCTCAGAAAGACACTGG + Intergenic
1063265485 10:4444793-4444815 CCACTCATTGAGGAAGGAACTGG + Intergenic
1068645429 10:59461359-59461381 CCCCTTCTTTAGGAAGGAACAGG - Intergenic
1070414010 10:76172127-76172149 TCACCACTGTAGGAAGGCACTGG + Intronic
1071042478 10:81330288-81330310 CCACTCTTTTAAGAAGGCAGAGG + Intergenic
1072417356 10:95260311-95260333 CCAAGCCTTTAGGAAGTATCAGG + Intronic
1073642664 10:105268960-105268982 CCACAGCTCAAGGAAGGCACTGG - Intergenic
1075554688 10:123421852-123421874 CTCTGCCTTCAGGAAGGCACTGG - Intergenic
1077607337 11:3621014-3621036 CCACACCTCTAAGAAGGCAGGGG + Intergenic
1084170351 11:67397957-67397979 CCAGGACTTCAGGAAGGAACAGG - Exonic
1084454224 11:69258186-69258208 GCATGGCTTGAGGAAGGCACTGG - Intergenic
1089353521 11:117835158-117835180 CCAGGCCTTTGGAAAGACACAGG - Intronic
1090072589 11:123556931-123556953 ACATGCCATTAGGAAGGCATGGG - Intronic
1091382583 12:71966-71988 CTAGGCCTTCAGGAAGGCAAAGG - Intronic
1091831270 12:3552707-3552729 CCACGCCTTGAGGAAGGGTGAGG - Intronic
1096411358 12:51379237-51379259 CCATGCCTTTAGCAAAGCCCTGG + Intronic
1101057393 12:100932957-100932979 CCATGCATTTGGGAAGGCAAGGG - Intronic
1107164528 13:37269171-37269193 CCACGCCTTAAGGGAACCACAGG - Intergenic
1111553724 13:89851691-89851713 CCAGGCCTATAGGATAGCACGGG + Intergenic
1113674948 13:112200792-112200814 TCACGCCTTTACGAAGGGTCTGG - Intergenic
1116379646 14:44249649-44249671 CCCAGCATTTAGGAAGGCAGAGG + Intergenic
1119474728 14:74920461-74920483 CCAGGCCTTGAGGTGGGCACTGG - Intronic
1119749923 14:77069960-77069982 CAAAGCCTTCTGGAAGGCACTGG - Intergenic
1124821512 15:33051081-33051103 CCCCCCCTTTAAGAAGGCAGAGG + Intronic
1134009139 16:10838407-10838429 CCAGGCCTTTAGGATGGTCCTGG + Intergenic
1134596432 16:15499669-15499691 CCATCCCTCTAGGAAGGAACTGG - Intronic
1134638933 16:15813740-15813762 CCCAGCTCTTAGGAAGGCACAGG + Intronic
1136171863 16:28494717-28494739 CCAGGCCTTGAGGGGGGCACTGG + Exonic
1137666402 16:50252091-50252113 CCACGCCTTGAGGACGGTGCAGG + Intronic
1138506672 16:57481631-57481653 ACACGCCTACAGGAAGCCACTGG + Intronic
1140640314 16:76964460-76964482 CCAGGCCTTCAGGAAAGCCCAGG + Intergenic
1141815888 16:86409034-86409056 CCACGGCTCTAGGGAGGTACAGG - Intergenic
1143784633 17:9247346-9247368 CCACCCCTTGAGGAAGGCAAAGG + Intergenic
1144705373 17:17364325-17364347 CCAGGCCTGGAGGAAGCCACAGG + Intergenic
1146942749 17:36855202-36855224 CCATGCCCTTGGGAAGGCCCTGG + Intergenic
1148879850 17:50717570-50717592 CCACTACTTTAGGGAGGCAGAGG - Intergenic
1152953230 18:12792-12814 CCACGCCCTCAGAAAGACACTGG + Intergenic
1159146880 18:64466188-64466210 CCATGCATTTATTAAGGCACTGG + Intergenic
1160765792 19:807091-807113 CACCGCCTTGAGGAAGTCACAGG - Intronic
1160915508 19:1494647-1494669 CCAGGCCCTTTGGGAGGCACTGG - Intronic
1161102190 19:2426732-2426754 CCAGCACTTCAGGAAGGCACAGG + Exonic
1162159323 19:8699762-8699784 CCACGCTTTCAGGAAGACCCAGG + Intergenic
1162859210 19:13492910-13492932 CCACACCCTTAGGAACGTACAGG - Intronic
1163456859 19:17411932-17411954 CCATGCCTGTAGGAAGTCGCTGG + Intronic
1163834758 19:19566394-19566416 CCATGCCTGTAGGAAGGCGCTGG - Intronic
1165473433 19:36016234-36016256 TCACGCCCTTAGGCAGGCAGCGG + Intronic
925601459 2:5612324-5612346 CGAAGGCTTTAGGAAGACACGGG + Intergenic
927504371 2:23603537-23603559 CCAGGCCTTTTGAAAGGCCCTGG + Intronic
934543769 2:95197711-95197733 CCATGCCTTAAGGATGGCAGAGG + Intergenic
935171045 2:100611825-100611847 CCATGCGTGGAGGAAGGCACAGG + Intergenic
938573565 2:132584208-132584230 CCAGGCCTTTATGGAGGCTCTGG + Intronic
943095505 2:183423477-183423499 TCATGCCTTTAGGAAGAAACAGG - Intergenic
946241640 2:218359561-218359583 CCAGGCCTCCAGGGAGGCACTGG + Intronic
948938610 2:241184749-241184771 CCCAGCTTTTAGGAAGGCAGAGG - Intergenic
1175754422 20:61520460-61520482 CCACCCCTCCAGGAAGGCATCGG - Intronic
1176282619 20:64322869-64322891 CTAGGCCTTCAGGAAGGCAAAGG + Intergenic
1180981604 22:19880712-19880734 CCGCCCCTTGGGGAAGGCACAGG + Exonic
1182258339 22:29054257-29054279 CCACGCCTTTAGGCAGGTGATGG + Exonic
1183393535 22:37559645-37559667 CCCCTCCTTGAGGATGGCACAGG + Intergenic
1183976644 22:41516141-41516163 CCACACAGTTAGGAAGTCACCGG - Intronic
1184614095 22:45626200-45626222 GCCCTCCTTTACGAAGGCACAGG + Intergenic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954189076 3:48943396-48943418 CCAAGCCCTCAGGAATGCACAGG - Intronic
963561104 3:146866290-146866312 CCACAGATTTAGGAAGGCCCTGG + Intergenic
966985152 3:185173182-185173204 CCAAGACTTCAGGAAGGCCCTGG - Intergenic
969333516 4:6493625-6493647 CTTCTCCTTCAGGAAGGCACTGG - Intronic
972687494 4:41365105-41365127 CCAGGCCTTTAGGGAGGGACTGG + Intronic
975180689 4:71340529-71340551 CCATGCCTTCAGGAATTCACTGG + Intronic
975630584 4:76397978-76398000 CCATGCCTTTAAAAAGACACAGG + Intronic
987057213 5:14205089-14205111 CCACGGATTCAGGAGGGCACAGG + Intronic
990287124 5:54310988-54311010 CAGAGCCTTTAGGAAGGCTCTGG - Intergenic
992265311 5:75012635-75012657 CCCTGCCTTTAGGAAGAAACAGG + Intergenic
994189697 5:96856068-96856090 CCACCCCTTTAGGGAGGCCCAGG + Intronic
998181689 5:139950479-139950501 CCACTTCTTTAGGAAGGTTCTGG + Intronic
1001431778 5:171667828-171667850 CCTCGCCTTTAGGAGTGCTCAGG + Intergenic
1001902884 5:175445552-175445574 TCCCACCTTTCGGAAGGCACAGG - Intergenic
1003447302 6:6196350-6196372 CCATGCATTTAGGAAGTCAGAGG + Intronic
1026537793 7:71254575-71254597 CTCCTCCTTTGGGAAGGCACAGG - Intronic
1032197019 7:129795268-129795290 CCACCCCTTGAGGAACCCACAGG + Intergenic
1032424780 7:131813674-131813696 ACACGCCTTTAGGGAGGCTGAGG + Intergenic
1033658138 7:143386986-143387008 CCAGGCATTTAGAATGGCACTGG + Intronic
1034283027 7:149866618-149866640 CCACCACCTAAGGAAGGCACTGG - Exonic
1034690209 7:153007910-153007932 CCACATCTTTAGGAAGCCATGGG - Intergenic
1035514660 8:222364-222386 CCAAGCATTTTGGGAGGCACAGG + Intergenic
1036990904 8:13592696-13592718 CCTGCCCTTAAGGAAGGCACTGG + Intergenic
1045403703 8:101844113-101844135 CCAGGGCTTTAGGAAGCCACAGG - Intronic
1046930516 8:119837259-119837281 CCAAGTCTTTAAGAAGGCAGAGG + Intronic
1049148231 8:141017553-141017575 CCCTGCCTTTAGGAACGCCCAGG - Intergenic
1049414764 8:142490100-142490122 CCAGGGCTGTAGGAAGCCACGGG + Intronic
1050360248 9:4823401-4823423 CCAGTCCTTTAGGAAAGCCCAGG + Intronic
1058931212 9:109721039-109721061 GCAATCCTTTAGGAAGACACAGG - Intronic
1061057826 9:128233612-128233634 CCACGCCTTTAGGAAGGCACAGG + Intronic
1061930245 9:133828657-133828679 CCTCTCCCTCAGGAAGGCACAGG - Intronic
1062329890 9:136034841-136034863 CCCAGCATTTTGGAAGGCACTGG + Intronic
1190654237 X:52597160-52597182 TCCAGCCTTCAGGAAGGCACTGG - Intergenic
1193492667 X:82168408-82168430 CCATGCGTTGTGGAAGGCACTGG - Intergenic