ID: 1061058727

View in Genome Browser
Species Human (GRCh38)
Location 9:128239750-128239772
Sequence ATGAACAAGAAGAAGACTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 411}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061058719_1061058727 15 Left 1061058719 9:128239712-128239734 CCCTCCCTCCCATTAGTGCTCAG 0: 1
1: 0
2: 1
3: 18
4: 236
Right 1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG 0: 1
1: 0
2: 5
3: 34
4: 411
1061058721_1061058727 11 Left 1061058721 9:128239716-128239738 CCCTCCCATTAGTGCTCAGCAGA 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG 0: 1
1: 0
2: 5
3: 34
4: 411
1061058720_1061058727 14 Left 1061058720 9:128239713-128239735 CCTCCCTCCCATTAGTGCTCAGC 0: 1
1: 0
2: 1
3: 17
4: 200
Right 1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG 0: 1
1: 0
2: 5
3: 34
4: 411
1061058725_1061058727 6 Left 1061058725 9:128239721-128239743 CCATTAGTGCTCAGCAGAGGAGC 0: 1
1: 0
2: 0
3: 14
4: 119
Right 1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG 0: 1
1: 0
2: 5
3: 34
4: 411
1061058722_1061058727 10 Left 1061058722 9:128239717-128239739 CCTCCCATTAGTGCTCAGCAGAG 0: 1
1: 1
2: 0
3: 10
4: 118
Right 1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG 0: 1
1: 0
2: 5
3: 34
4: 411
1061058718_1061058727 16 Left 1061058718 9:128239711-128239733 CCCCTCCCTCCCATTAGTGCTCA 0: 1
1: 0
2: 3
3: 23
4: 275
Right 1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG 0: 1
1: 0
2: 5
3: 34
4: 411
1061058724_1061058727 7 Left 1061058724 9:128239720-128239742 CCCATTAGTGCTCAGCAGAGGAG 0: 1
1: 0
2: 3
3: 5
4: 205
Right 1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG 0: 1
1: 0
2: 5
3: 34
4: 411
1061058717_1061058727 19 Left 1061058717 9:128239708-128239730 CCTCCCCTCCCTCCCATTAGTGC 0: 1
1: 0
2: 3
3: 56
4: 455
Right 1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG 0: 1
1: 0
2: 5
3: 34
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061058727 Original CRISPR ATGAACAAGAAGAAGACTTC AGG Exonic
901117937 1:6863822-6863844 CTGAAAAAGAACAAGACTTTAGG - Intronic
901459119 1:9381163-9381185 AGGAATAAGAGCAAGACTTCTGG - Intergenic
902509879 1:16960783-16960805 AGGAACAAGAAGGCGAGTTCCGG + Exonic
902681266 1:18045547-18045569 AGGAAGGAGATGAAGACTTCAGG + Intergenic
902944470 1:19824992-19825014 AGGATCAAGAAGAAAACTTGAGG + Intergenic
904785561 1:32980098-32980120 AAGAAGATGAAGAAGTCTTCAGG + Intergenic
908230797 1:62103041-62103063 GTGAACAAAAAGATGACTTGTGG - Intronic
909715326 1:78701172-78701194 AAGAACAAGCACAAGAATTCTGG - Intergenic
909762111 1:79302807-79302829 CAGAACAAGAAGCAGATTTCTGG + Intergenic
910031118 1:82724990-82725012 ATGACAAAGAAGAAGAGGTCTGG + Intergenic
910782059 1:90949947-90949969 ATGAACAACAAAAAGGATTCAGG - Intronic
910820688 1:91342352-91342374 ATGTACAGGAAGAATTCTTCTGG + Intronic
910992127 1:93067321-93067343 ACGAAGAAGAAGAAGAGCTCTGG + Intergenic
911054609 1:93699360-93699382 ATGAACAGGAAGAAGACTGTAGG - Intronic
911148639 1:94575896-94575918 AAGAAAAAAAAGAAAACTTCTGG - Intergenic
911186636 1:94911023-94911045 CTGAAAAAGAATAAGAATTCGGG - Intronic
912100995 1:106204533-106204555 AGGAACAAGAAGAAGCATTTTGG + Intergenic
912327532 1:108782457-108782479 TTGAAGAAGAAGATGACCTCTGG + Exonic
914248562 1:145903631-145903653 AAGAAGAAGAAGAAGAGTTAGGG - Intronic
914725663 1:150325066-150325088 ATGGACAAGAAGAAGGCAGCCGG + Exonic
916277764 1:163013699-163013721 AGGAACCAGAATAAGAATTCTGG - Intergenic
916313801 1:163425693-163425715 CTGGACAAGAATAAGACTTTTGG + Intergenic
917293207 1:173492745-173492767 ATGAAGAAGAAGTAGGCTACAGG + Intergenic
917295339 1:173513100-173513122 AACAACAAAAAGAAAACTTCAGG - Intronic
917697238 1:177538138-177538160 AACAACAAAAAGAAAACTTCAGG + Intergenic
918867680 1:189924354-189924376 AACAACAAAAAGAAAACTTCAGG - Intergenic
919740177 1:200976673-200976695 ATGAAAAATTATAAGACTTCTGG - Intronic
922000800 1:221476409-221476431 AAAAACAAGATGAAGACTTGGGG - Intergenic
922609185 1:226911800-226911822 AAGAAGAAGAAGAAGACAGCTGG - Intronic
922818249 1:228466518-228466540 AAGAAGAAGAAGAAGACATCAGG - Intergenic
923961012 1:239084268-239084290 AGGAACCAGAAAAAGAATTCTGG - Intergenic
924207896 1:241733028-241733050 AAGGACAAGAGAAAGACTTCTGG - Intronic
924487687 1:244502665-244502687 ATGAACTACAAGCACACTTCTGG - Intronic
924910423 1:248506157-248506179 ATGAACATGGAGAAGACAGCAGG - Intergenic
924913677 1:248541882-248541904 ATGAACATGGAGAAGACAGCAGG + Intergenic
1063277536 10:4587498-4587520 CTGAACAAGAAGAAGGTCTCTGG - Intergenic
1063763363 10:9107760-9107782 ATGCCCAAGAAGAATTCTTCTGG - Intergenic
1064023651 10:11829220-11829242 ATGAACAAGGGGAAGACACCTGG + Intronic
1064487164 10:15805742-15805764 AGGGAAAAGAACAAGACTTCTGG - Intronic
1064489749 10:15841384-15841406 AGGAACAAGAAAAAAACTTCAGG + Intronic
1064846338 10:19658682-19658704 TTGAACAAGAAGAACAATTAAGG + Intronic
1065381356 10:25094776-25094798 ATGATCAAGCAGAAGAATTAGGG - Intergenic
1067261978 10:44700668-44700690 AGGAACAGGAACAGGACTTCAGG - Intergenic
1068149114 10:53110427-53110449 ATTAACAAGAAGAATGCTTGAGG - Intergenic
1069269317 10:66505146-66505168 ATAAACAATAAGTAGACTGCAGG - Intronic
1069283062 10:66679614-66679636 ATAAAAATGAAGAATACTTCTGG - Intronic
1070182775 10:74030303-74030325 ATTAAAAAGAAACAGACTTCTGG - Intronic
1070473706 10:76811546-76811568 AGGAAGAAGAAAAAGCCTTCAGG + Intergenic
1070722645 10:78767538-78767560 ATGAAAAAGAAGAAGAGGCCGGG + Intergenic
1072498626 10:95989340-95989362 ACGAACTAGAAGAACACTTGTGG - Intronic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1072646962 10:97263963-97263985 ATAAACAAGAAGAGGTCTTTAGG - Intronic
1075628315 10:123981685-123981707 AACAACAAAAAAAAGACTTCAGG + Intergenic
1077487333 11:2845165-2845187 CTGAACAAGAACGAGACCTCAGG + Intronic
1077976867 11:7255701-7255723 ATGTACAAGTAGAAGTCTTCAGG + Intronic
1079654412 11:22970663-22970685 AACAACAAAAAGAAAACTTCAGG - Intergenic
1079841468 11:25406002-25406024 AAGAAAAAGATGAAGACTGCAGG - Intergenic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1082796229 11:57379975-57379997 ATGGACAAGAACCTGACTTCTGG + Intronic
1085157492 11:74309631-74309653 ATGAACAAAAAGAAAACATTTGG + Intronic
1085184339 11:74562668-74562690 ATGGACAACAAGCAGACCTCAGG - Intronic
1085334827 11:75684583-75684605 AAGAAGAAGAAGAAAACTTCAGG - Intergenic
1085387852 11:76167456-76167478 ATGAACAGGAAGAACAATTAAGG + Intergenic
1085966279 11:81531477-81531499 ATCTACAAGAAGAACATTTCTGG - Intergenic
1086993340 11:93330203-93330225 ATGAAAAAGAAATAAACTTCGGG - Intronic
1087363410 11:97189195-97189217 CTGAACAAGAAAAGGAATTCTGG - Intergenic
1087817460 11:102675600-102675622 ATGAACCAGAAAAACAATTCTGG - Intergenic
1088963643 11:114696034-114696056 AAGAAGAAGAAGAAGAAATCAGG + Intronic
1089811368 11:121134566-121134588 ATGAAAAAAAAAAAGACTTTGGG - Intronic
1090857795 11:130625506-130625528 ATGACCAAGAAGGAGATTTATGG - Intergenic
1093064910 12:14647202-14647224 ATGAACAAGCAGATGATTTATGG - Intronic
1093430340 12:19078313-19078335 ATGAAGAGAAAGCAGACTTCAGG + Intergenic
1094492528 12:30969992-30970014 AAGAACAAGAAGGAGACACCAGG - Intronic
1095317081 12:40777472-40777494 ATGTAAAAGAACAAGTCTTCAGG + Intronic
1096047034 12:48571365-48571387 AGGAAGAAGAAGAAGAAATCAGG - Intergenic
1098406278 12:70129857-70129879 ATGATATAGGAGAAGACTTCTGG - Intergenic
1099648017 12:85384668-85384690 ATCAACAAAAAGAAGACTCTTGG + Intergenic
1100866146 12:98858941-98858963 ATTTACATTAAGAAGACTTCCGG + Intronic
1101386772 12:104265462-104265484 AAGAAGATGAAGAAGTCTTCAGG + Intronic
1101969966 12:109306025-109306047 ATGAACAAGGTCAAGACTCCGGG + Intronic
1103011190 12:117459742-117459764 ATGAACAAGAACACCACATCTGG - Exonic
1103179284 12:118894691-118894713 ATAAAAAAAAAGAAAACTTCAGG + Intergenic
1103471609 12:121186185-121186207 ATGAGAGAGAAGAAGCCTTCAGG + Exonic
1104553408 12:129778421-129778443 ATGGACAAGAAAAACACATCTGG + Intronic
1106750996 13:32767943-32767965 TTGAACAAGAATAATATTTCTGG - Intronic
1107275445 13:38673171-38673193 ATCAACAAGAAGAAATCTTGAGG + Intergenic
1107377316 13:39817944-39817966 ATGAACTCCAAGAAGACCTCAGG + Intergenic
1107799131 13:44087723-44087745 AGGAACAAAAATAAGACTTCAGG - Intergenic
1108642442 13:52395371-52395393 GTAAAGAAGAGGAAGACTTCTGG + Intronic
1110894611 13:80733621-80733643 ATGGGCAAGGAGAAGACTTGGGG - Intergenic
1111477985 13:88779090-88779112 ATGAAAAAGAATCAGAATTCAGG - Intergenic
1111956126 13:94760514-94760536 AAGAAGAAGAAGAAGACTTCTGG - Intergenic
1112094030 13:96112822-96112844 ATGAAGAAGAAGAGGACTGGTGG + Intronic
1112361582 13:98723833-98723855 AGGAAAAAGACGAAGACTTAAGG + Intronic
1112661241 13:101511199-101511221 TTGAAAAAAAAGAAAACTTCAGG + Intronic
1113128199 13:107004014-107004036 CTGAACAAGATGAAGAATTGTGG - Intergenic
1113722418 13:112569564-112569586 ATGAACAAGAAGAGGAGGCCGGG + Intronic
1114437643 14:22721082-22721104 ATGAACGAGAAGAAAAGTTTAGG + Intergenic
1114709947 14:24768072-24768094 AGGAGCAAGAAGAAGACCCCAGG + Intergenic
1115354920 14:32437049-32437071 ATGAACAAGGAGAAAAGTACAGG - Intronic
1115673290 14:35640770-35640792 ATCAACAAAAAGAAAACTACAGG + Intronic
1115929308 14:38472897-38472919 AGAAACATGAAAAAGACTTCTGG - Intergenic
1116222706 14:42110065-42110087 AGGAACCAGAACAAGAATTCTGG - Intergenic
1116324528 14:43515119-43515141 AGGAACAAGAAAAACAATTCTGG + Intergenic
1116511772 14:45755672-45755694 CTGAAGGAGAAGAAGCCTTCTGG + Intergenic
1116957474 14:50939393-50939415 ATGAACAAGAAGACTACCTAAGG + Intronic
1117029266 14:51651999-51652021 ATGAACAAGAACCAGGCGTCTGG + Intronic
1117271467 14:54147630-54147652 AAGAACCAGAAGAACAATTCTGG + Intergenic
1117306431 14:54480047-54480069 ATAAACAAGAACAAGTCTACAGG + Intronic
1117488852 14:56226084-56226106 AAGAAGAAGAAGAAGAAGTCAGG + Intronic
1118347830 14:64952462-64952484 ATGTAGGAGAAGAGGACTTCTGG - Intronic
1118848826 14:69569572-69569594 ATCAACAAGAAGAAAATTTAAGG + Intergenic
1122203135 14:100134600-100134622 ATGAACAAGAAAACGAGTGCCGG - Intronic
1202894209 14_KI270722v1_random:188690-188712 AAGAAGAAGTAGAAGAATTCAGG - Intergenic
1124384157 15:29192441-29192463 AACAACAAGAAGAAGACATTGGG + Intronic
1125121841 15:36169080-36169102 CTGAACAAGGAGCAGACTTTTGG + Intergenic
1125311119 15:38379082-38379104 AAGAAGAAGAAGAAGAAGTCAGG - Intergenic
1126116404 15:45211641-45211663 ATGAACAATAAGAAGAAACCAGG - Intergenic
1126716922 15:51527425-51527447 ATGAGCAATAAGAAGTCATCTGG + Intronic
1128189745 15:65680449-65680471 ATAAACAGCAACAAGACTTCTGG - Intronic
1128872167 15:71168028-71168050 AGGAACATGAGGACGACTTCTGG - Intronic
1131812611 15:96188210-96188232 ATTAAGAAGATGAAGCCTTCTGG - Intergenic
1133592056 16:7254810-7254832 ATGAACAAGAAGAAAAAGACTGG + Intronic
1134381411 16:13730349-13730371 TTGAACAAGAAGAACAAATCTGG - Intergenic
1135330190 16:21554271-21554293 AAAAAGAAGAAGAAGAATTCTGG - Intergenic
1137765272 16:50973197-50973219 ATGAGTAAGAACAAGAGTTCAGG + Intergenic
1138802933 16:60056992-60057014 ATGAGCTAAAAGAAAACTTCTGG - Intergenic
1138967412 16:62101393-62101415 ATGAACAAGCAGATGATTGCAGG - Intergenic
1138992954 16:62413866-62413888 AAAAACAAGAAGAAAACTACAGG - Intergenic
1139061571 16:63259605-63259627 AACAACAAAAAGAAAACTTCAGG - Intergenic
1139164143 16:64546295-64546317 AAGAACAAGAAGAAGACACAAGG - Intergenic
1139610950 16:68058147-68058169 ATGAAGAAGAAGCAGACTGCAGG + Intronic
1139868206 16:70080679-70080701 AGGAAAAAGAAGCAGACTTACGG + Intergenic
1140157807 16:72451901-72451923 ATCAACAACAAGAAGAATTTTGG - Intergenic
1140387127 16:74551169-74551191 AGGAAAAAGAAGCAGACTTACGG - Intronic
1141329623 16:83098002-83098024 ATGAAGGAGAATGAGACTTCAGG + Intronic
1141897218 16:86965744-86965766 AAGAAAAGGAGGAAGACTTCAGG + Intergenic
1203011799 16_KI270728v1_random:299287-299309 ATGAAAAAGAAAATGTCTTCAGG + Intergenic
1203030134 16_KI270728v1_random:572446-572468 ATGAAAAAGAAAATGTCTTCAGG + Intergenic
1203041587 16_KI270728v1_random:761985-762007 ATGAAAAAGAAAATGTCTTCAGG - Intergenic
1144521767 17:15957511-15957533 ATGAAGGAGAAGAAGACTCCAGG + Intronic
1145239574 17:21232510-21232532 ATGTAGAAGAAGAACATTTCAGG + Intergenic
1150353969 17:64467675-64467697 ATGAACAAAAAGCAAACTTGAGG + Intronic
1150803470 17:68300500-68300522 ATGATCAAGAAGAAAGCTCCAGG - Intronic
1151306221 17:73264188-73264210 ATGAACATGAAGGAGACTCCTGG + Intergenic
1153318835 18:3751857-3751879 AAGAAGAAGAAGAAGAAGTCCGG - Intronic
1153664971 18:7360448-7360470 TGGAACAAAAAGAAGAGTTCTGG + Intergenic
1153974200 18:10252738-10252760 ATGACCATGAAGAAGGCTTGTGG + Intergenic
1155426817 18:25715750-25715772 ATGAACAAGGAGCAGACTCAAGG - Intergenic
1156040126 18:32811059-32811081 ATGAAAAAGAATAAGAATTAAGG + Intergenic
1156061164 18:33077975-33077997 AACAACAAAAAGAAAACTTCAGG + Intronic
1157065630 18:44346771-44346793 AACAACAAAAAGAAAACTTCAGG - Intergenic
1157278594 18:46330560-46330582 AAGTACAATAAGAAGATTTCTGG - Intronic
1158295747 18:55995293-55995315 ATGAACAAGAAAGTGACCTCTGG - Intergenic
1158328407 18:56334754-56334776 ATGAACAACAGAAAGATTTCTGG - Intergenic
1158514277 18:58118554-58118576 ATGAACAAGAGGAGGAATACAGG - Intronic
1158735160 18:60071097-60071119 CTTAACAAGAAAGAGACTTCAGG - Intergenic
1160074437 18:75658783-75658805 AGGAGCAGGAGGAAGACTTCAGG + Intergenic
1160393286 18:78553289-78553311 ATGAACAATTATAAAACTTCTGG + Intergenic
1161548015 19:4894079-4894101 AAGAAGAAGAAGAAGACAGCCGG + Intronic
1162579791 19:11522121-11522143 AAGAAGATGAAGAAGTCTTCGGG + Intronic
1163074775 19:14879979-14880001 ATGACCAGGAAGAACACTTAAGG + Intergenic
1163532953 19:17861428-17861450 AAGAAGATGAAGAAGTCTTCAGG + Exonic
1165395896 19:35563442-35563464 ATGAGCAAGAAGAAGAAGGCGGG - Exonic
1167432932 19:49463819-49463841 ATGATCTAGAAGTCGACTTCTGG - Intronic
1168172571 19:54598345-54598367 ATGTACAGGAGGAAGACTTGAGG - Intronic
925099324 2:1231977-1231999 AAGAACAGGAAGCAGCCTTCAGG - Intronic
925583905 2:5443413-5443435 AAGAACAAGAAGATAACGTCTGG + Intergenic
925705637 2:6682114-6682136 AGGAACCAGAAGAACAATTCTGG + Intergenic
926570196 2:14521116-14521138 ATGAAAAATAAGAAAATTTCAGG - Intergenic
926905857 2:17804967-17804989 ATGAAGAAAAACAAAACTTCTGG + Intergenic
926987004 2:18635568-18635590 AACAACAAAAAGAAAACTTCAGG - Intergenic
927036851 2:19186980-19187002 ATCAACAACTAGAAGACCTCAGG - Intergenic
927559151 2:24056989-24057011 ATCAACAAGAAAAAGACAACCGG - Intronic
928003832 2:27545358-27545380 ATGATAAAGAAGAAGGTTTCAGG + Intronic
928686256 2:33752971-33752993 ATGAGCAAGAAGAAAACTGAGGG + Intergenic
928799428 2:35068575-35068597 AGGAACAAGCACAAGAATTCTGG + Intergenic
928838127 2:35571915-35571937 ATCAACAAAAAGAAAACTCCAGG - Intergenic
928891343 2:36206808-36206830 ATGAACAAGAATAATACTCGAGG - Intergenic
929462578 2:42114176-42114198 AAGAAGAAGAAGAAGATTGCTGG + Intergenic
929512849 2:42579280-42579302 ATGGACAAGCAAAAGACTTCAGG - Intronic
930010750 2:46936799-46936821 ATGAAAAAAAAGAAGACCACTGG - Intronic
930112565 2:47691071-47691093 AAGAAGATGAAGAAGTCTTCAGG - Intergenic
930889405 2:56365528-56365550 ATAGACTAGAAGGAGACTTCTGG + Intronic
932057906 2:68465898-68465920 ATGGACAAGAAGATGAGATCTGG + Intronic
932152098 2:69382424-69382446 ATGAAAAAGAAGAGGATTTTGGG - Intronic
932347222 2:71003639-71003661 ATGGTCCAGAAGAAGACTTGGGG - Intergenic
932931624 2:76046784-76046806 ATTAACAACAAGAAGAATTTTGG + Intergenic
933012429 2:77084162-77084184 ATGAACAGAAAGAAAACTTGCGG + Intronic
935007228 2:99090315-99090337 AGGAACAAGAAAAACAATTCTGG + Intronic
935353762 2:102178858-102178880 ATGAACATGGAGAGGACTTTTGG + Exonic
935572373 2:104675747-104675769 ATGAACAGGGAGAAGCCTCCAGG + Intergenic
936885616 2:117307731-117307753 AGGAACAAGAAAAATAATTCTGG - Intergenic
938923419 2:136016532-136016554 ATGAACAAGAAGCAGGGCTCAGG - Intergenic
939212415 2:139193760-139193782 ATGAAATAGAAGAAAACCTCAGG + Intergenic
940272986 2:151911625-151911647 AACAAAAAAAAGAAGACTTCAGG - Intronic
940317955 2:152344650-152344672 ATGACCCAGAAGTATACTTCTGG + Intronic
941392403 2:164930446-164930468 ATCAACAAAAAAAAAACTTCAGG + Intronic
941518135 2:166505265-166505287 ATCACCAATAATAAGACTTCAGG + Intergenic
942814031 2:180030820-180030842 ATCAACAACAAGAAGAATTTTGG - Intergenic
943410127 2:187536275-187536297 ATGCACAAAAAGAAAAATTCAGG + Intronic
943913532 2:193598621-193598643 AAGAAGAAGAAGAAAACTGCAGG + Intergenic
944190160 2:196994484-196994506 AAGAAGAAGAAGAAGACTGTTGG - Intronic
945069815 2:205978561-205978583 ATACACAAGAAGATGAATTCTGG + Intergenic
945201685 2:207288249-207288271 ATGAAGAAATAGAAGACATCAGG - Intergenic
945388266 2:209230378-209230400 AATAACAACAAGAAAACTTCAGG - Intergenic
945450526 2:209989669-209989691 ATGAACCAGGAGAAGACTAAGGG - Intronic
945713702 2:213331712-213331734 ATCAACAAGAAGAGGAATTTTGG + Intronic
945783454 2:214204727-214204749 ATGAACCAGAAAAACAATTCTGG + Intronic
945813336 2:214574166-214574188 ATGAACAAGAAGCACCCTTCTGG + Intronic
946082518 2:217134855-217134877 AAGAAAAAAAAGAAAACTTCGGG - Intergenic
946999428 2:225436765-225436787 AAGAAGAAGAAGAAGCCTCCTGG + Intronic
947674566 2:231966151-231966173 AAGAAGAAGAAGAAGAATTCTGG - Intronic
947800439 2:232926229-232926251 ATGAAGAACGAAAAGACTTCTGG + Intronic
948081657 2:235210754-235210776 ATGAACAAGATGAAGACTTTTGG - Intergenic
948714133 2:239847993-239848015 AGGAACCAGAAAAACACTTCTGG + Intergenic
1168845025 20:938614-938636 ATCAAAAAGTAGAAGCCTTCAGG + Intergenic
1169155992 20:3330236-3330258 AAGAAGAAGAAGAAGACATCTGG - Intronic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1170236340 20:14109097-14109119 ATCAACAACAAGAAGAATTTTGG + Intronic
1170343679 20:15358314-15358336 TTGAACATGAAGGAGACTTAGGG + Intronic
1171557699 20:26092929-26092951 ATGACCAAGATGAACACTTGTGG - Intergenic
1171961929 20:31501032-31501054 ATGAAAAAGAATAATACTTGTGG + Intergenic
1172150154 20:32784718-32784740 ATGAACATGATGAAGACCCCAGG - Intronic
1172524774 20:35592785-35592807 GTGAACAAGAAACAGATTTCTGG + Intergenic
1172947314 20:38699619-38699641 AAGAAGAAGAAGAAGACTTCAGG + Intergenic
1174409375 20:50323773-50323795 ATGATCAAGAGTAAGACTTTAGG - Intergenic
1175438932 20:58977194-58977216 AAGAAGAAAAAGAAGAATTCTGG - Intergenic
1176857311 21:13983566-13983588 ATCAATAAGAAGAAGAATTTTGG - Intergenic
1176919335 21:14668239-14668261 AACAACAAGAAGAAAATTTCAGG + Intergenic
1177174726 21:17691234-17691256 ATGAGTAAGAAGAAAACTCCTGG - Intergenic
1177531813 21:22370607-22370629 ATGGACAACAATAAGACTTTAGG - Intergenic
1177701206 21:24641580-24641602 ATGGGCAACAAGAAGCCTTCGGG - Intergenic
1178016437 21:28351672-28351694 ATGAGCAAGAAGAGGCCTCCAGG + Intergenic
1178846056 21:36175096-36175118 AAGAAGAAGAAGAAGAAATCTGG - Intronic
1179300650 21:40106421-40106443 ATGACAAAAAAGAAAACTTCAGG - Intronic
1179796925 21:43790181-43790203 ATGAACAAGAAGTAGATTCTCGG - Intronic
1181830874 22:25559256-25559278 AGGAGTAAGAAGATGACTTCTGG - Intergenic
1182015495 22:27036048-27036070 AAGAAGAAGAAGAAGAATGCAGG - Intergenic
1182252605 22:29013157-29013179 ATGAGCAAGCTGAGGACTTCTGG - Intronic
1182513824 22:30840373-30840395 ATGAACAAGAAAAAACCTTGAGG - Intronic
1182730629 22:32488663-32488685 ATGAACAAGAATAAGCCTTTAGG - Intronic
1182796237 22:32993642-32993664 ATGAAAAAGAAATAGACTTTGGG - Intronic
1184071149 22:42148136-42148158 ATCAACAACAAGAGGAATTCTGG + Intergenic
1184316598 22:43698084-43698106 ATGAACAAGCAGCAGTTTTCTGG - Intronic
950019433 3:9776687-9776709 AAGAGCAATAAGAAGACTGCAGG - Intronic
951238012 3:20257481-20257503 AGGAACCAGAAGAAGAATCCTGG - Intergenic
951600226 3:24366344-24366366 ATGAAGTAGAAGAGGACTTCTGG - Intronic
951980023 3:28555396-28555418 AACAAAAAGAAGAAAACTTCAGG - Intergenic
952951253 3:38527150-38527172 AAGAAGATGAAGAAGTCTTCAGG - Intronic
953140442 3:40224596-40224618 AAGAACAAGAAAATGACCTCAGG + Intronic
953277950 3:41522440-41522462 ATGTAAAAGAAGAAGACATTTGG - Intronic
953899556 3:46832198-46832220 AGGAACAGGAAGAATATTTCAGG + Intronic
956360793 3:68444358-68444380 GAGAAAAAGAAGAAGACTTGAGG - Intronic
956443513 3:69303598-69303620 ATCAAGAAGGAGAAAACTTCTGG + Intronic
957441154 3:80249809-80249831 AACAACAAAAAGAAAACTTCAGG + Intergenic
957822572 3:85397987-85398009 AAGAAAAAGAAAAAGGCTTCTGG - Intronic
957903014 3:86521448-86521470 ATGAAAAGGAAGAAGGCTTAAGG + Intergenic
958002104 3:87762860-87762882 AACAACTAGAAGAAGATTTCAGG - Intergenic
958155779 3:89753650-89753672 ATAAATAAAGAGAAGACTTCTGG + Intergenic
959191340 3:103115180-103115202 AAAAACAAGGAGAAGAATTCAGG + Intergenic
959814556 3:110660499-110660521 GTGCACAAAAAGCAGACTTCAGG + Intergenic
960276889 3:115738824-115738846 AACAACAACAAGAAAACTTCAGG - Intergenic
960468520 3:118029895-118029917 AGAAACCAGAAAAAGACTTCTGG - Intergenic
960521153 3:118657342-118657364 ATGAATAAGAAGAGGAATTTTGG - Intergenic
963014449 3:140808900-140808922 AGGAACAAGAAGAGAAATTCTGG - Intergenic
964098106 3:152957064-152957086 ATGGAAAAGAATAAGACTTTTGG + Intergenic
964191588 3:154008542-154008564 ATGAACAAAAATAGGCCTTCTGG + Intergenic
964462892 3:156955796-156955818 AACAACAAAAAGAAAACTTCAGG - Intronic
966453765 3:180092491-180092513 AAAAACAAAAAGAAAACTTCAGG - Intergenic
967621145 3:191635543-191635565 ATGCACAAATAAAAGACTTCAGG - Intergenic
969126622 4:4953761-4953783 AAGAACAAGAAAAGGATTTCTGG - Intergenic
970057485 4:11991360-11991382 ATGTTCAAGAAGCTGACTTCTGG - Intergenic
970609959 4:17715968-17715990 ATAAGCAAAAAGCAGACTTCAGG - Intronic
971919038 4:32912594-32912616 AACAACAAGAAAAAAACTTCAGG + Intergenic
972892727 4:43578503-43578525 AACAACAAAAAGAAAACTTCAGG + Intergenic
973019024 4:45176941-45176963 ATGAACAAGAACAAGGCTCAAGG + Intergenic
973025949 4:45271265-45271287 CTGAACAAGAAGAACAATTCTGG + Intergenic
973565858 4:52186741-52186763 ATGAACACTAAGAAATCTTCTGG + Intergenic
974122791 4:57660132-57660154 GTGAACAAGAAAAGGACTCCTGG - Intergenic
976321171 4:83717603-83717625 ATCAAGAAAAAGAATACTTCTGG - Intergenic
976593961 4:86876618-86876640 ATGAACCAGAAGAAAATTTCTGG + Intronic
976715072 4:88115010-88115032 ATGTCCAAGAAGAAGTCTGCAGG + Exonic
977385239 4:96330901-96330923 TTGACCAAAAAGAAAACTTCAGG + Intergenic
978262063 4:106772181-106772203 ATAAACAAGAAGAGGACTTATGG - Intergenic
978689393 4:111487992-111488014 ACAACCAAAAAGAAGACTTCAGG + Intergenic
979902619 4:126242103-126242125 ATAATCAAGAAGAAGCCTGCAGG + Intergenic
979937749 4:126719210-126719232 ATCAAGATGAAGAATACTTCCGG + Intergenic
979947707 4:126854297-126854319 ATCAAGAAGAAAAAGACTCCAGG + Intergenic
980270363 4:130576416-130576438 ATAAAGAAGAAGAAAACATCTGG - Intergenic
981527447 4:145720562-145720584 AAGAGCAAGAAGAACACTCCCGG - Intronic
982544092 4:156711108-156711130 ATGAATAAGCAGAAGACTGCAGG - Intergenic
982568226 4:157014371-157014393 GAGAACAAAAAGATGACTTCTGG - Intergenic
982941383 4:161561758-161561780 ATGTAGAAGAAAAAGAATTCTGG - Intronic
983035809 4:162864721-162864743 AGGAACAGGAAAAAGACCTCAGG + Intergenic
983410599 4:167392608-167392630 ATGACAAAGGAGAGGACTTCTGG - Intergenic
983548030 4:168983600-168983622 ATGAAAAAAAAGAAAACTTTAGG + Intronic
983814203 4:172102983-172103005 AGGAACCTGAAGAAGACCTCTGG + Intronic
984628194 4:182032500-182032522 ATCAACAACAAAAAAACTTCAGG - Intergenic
984854320 4:184180551-184180573 AAGAAAAAAAAGAAAACTTCAGG + Intronic
986893846 5:12341480-12341502 ATAAACAATAATCAGACTTCTGG - Intergenic
987491811 5:18590223-18590245 AAAAAAAAGAAGAAAACTTCAGG - Intergenic
989189684 5:38658587-38658609 ATGAAGCAGGAGAAGACTTTTGG + Intergenic
989233759 5:39119547-39119569 AAAAAGAAGAAAAAGACTTCAGG - Exonic
989445301 5:41521416-41521438 ATGAAGAAGAAGAGAACCTCAGG - Intergenic
989473298 5:41846085-41846107 ATAAATAAAGAGAAGACTTCTGG - Intronic
989481690 5:41938083-41938105 CTGAAAAAGATGAAGACTCCTGG + Intronic
989992733 5:50787099-50787121 ATGAAAAAAAAGAAGAGTTAAGG - Intronic
990272737 5:54162046-54162068 ATGAACAACCAAAAGAATTCTGG + Intronic
991022320 5:61992705-61992727 ATGAATAAGAAAAAGACTCATGG + Intergenic
991473860 5:66999135-66999157 ATGCAAAAGAAGGAGACTACTGG - Intronic
991554445 5:67879613-67879635 ATGGACACTGAGAAGACTTCAGG - Intergenic
991932494 5:71767242-71767264 AGGAACAAGAAGAAAATTACAGG + Intergenic
993217982 5:85049595-85049617 AGGAACCAGCAGAAGAATTCTGG + Intergenic
993942853 5:94081925-94081947 AGAAGCAAGAAGTAGACTTCAGG + Intronic
994144630 5:96380503-96380525 TTGAAAAAGAAAAAGACTTATGG + Intergenic
994325914 5:98444375-98444397 AAGAACAAGAAGAGGACATTGGG + Intergenic
994727453 5:103453321-103453343 ATGAACAACATGATGAGTTCTGG - Intergenic
996481897 5:123985074-123985096 AAGAAAAAGAAGAAGACTTCAGG - Intergenic
997108027 5:131044173-131044195 AAGAAGAAGAAGAAAACTTCAGG + Intergenic
997161532 5:131614309-131614331 AAGAAAAAGAAAAAGACTACCGG + Intronic
997231544 5:132247889-132247911 ATGAAAAATAAAAATACTTCGGG + Intronic
997848066 5:137305809-137305831 ATGCACAAGAAGGAGACCTGAGG - Intronic
997905664 5:137814490-137814512 CAGAAGAAGAAGAATACTTCCGG + Intergenic
998637218 5:143969145-143969167 AGGAACAAGAAGGAGACATTCGG + Intergenic
999844741 5:155466860-155466882 ATGAACAAGGTGATTACTTCGGG - Intergenic
1000135130 5:158340573-158340595 ATAAACAAGGAGGAGACATCTGG - Intergenic
1000989040 5:167893090-167893112 ATGAAGAATAAAAAGACCTCAGG - Intronic
1001021409 5:168185839-168185861 ATGAAAAAGTGGAAGACTTCAGG + Intronic
1001478427 5:172067793-172067815 ATGAAAAAGAGGAAGGTTTCAGG + Intronic
1001611441 5:173005906-173005928 ATTAACAGTAAGAAGACATCTGG - Intronic
1001991933 5:176124393-176124415 ATGAACAAGAAGGAGAGGACGGG + Intronic
1003421739 6:5964508-5964530 ATGAAGAAGAAAAATTCTTCTGG + Intergenic
1004282591 6:14293551-14293573 ATGAACAACAAGAAAACCTTAGG - Intergenic
1007319279 6:41015247-41015269 ATGAACAAGCTGGAGACTCCTGG + Intergenic
1007874620 6:45082338-45082360 AACAACAAAAAGAAAACTTCAGG + Intronic
1008443106 6:51555526-51555548 ATGAAAAAAAAGAAAACTGCAGG + Intergenic
1009387784 6:63107369-63107391 ATGAAAAAAAAGAAAACTACAGG - Intergenic
1009709293 6:67297117-67297139 ATGAACAACAAAAAAATTTCAGG - Intergenic
1010481667 6:76362223-76362245 AAGAAAAAAAAGAAAACTTCTGG - Intergenic
1010837217 6:80603851-80603873 ATGAACAACAAGAGGAATTTTGG - Intergenic
1011015040 6:82745130-82745152 ATGGAAAAAAAGAAGGCTTCTGG - Intergenic
1011580226 6:88854902-88854924 ATGGATAATAAGAAGACTTGGGG + Intronic
1011716008 6:90105755-90105777 ATGAACAAGAAGAAAAGTGAAGG + Intronic
1011813170 6:91156206-91156228 ATGAACAAAAATAAGAGTTTGGG + Intergenic
1011829954 6:91359567-91359589 ATGAAGAAGAAGAAAACCTCAGG + Intergenic
1011834235 6:91410411-91410433 TTGAACAAGAAGAACAAATCTGG - Intergenic
1011906521 6:92376350-92376372 TAGAACATGAACAAGACTTCTGG - Intergenic
1012134359 6:95537391-95537413 AACAACAATAAAAAGACTTCAGG - Intergenic
1013061917 6:106642934-106642956 ATAAACAAATAAAAGACTTCTGG + Intronic
1013423491 6:109988487-109988509 AACAACAAAAAGAAAACTTCAGG - Intergenic
1013738231 6:113252281-113252303 AACAACAAAAAGAAAACTTCAGG + Intergenic
1014003301 6:116388906-116388928 AGGAAGAAGAAGAAAACTTTTGG + Intronic
1014569384 6:122989899-122989921 AACAACAAAAAGAAAACTTCAGG + Intergenic
1015187912 6:130439658-130439680 ATGACCAAGAACAAGACTCTAGG + Intronic
1015362251 6:132354135-132354157 ATTAACCTGAAGAAGAATTCAGG - Intronic
1016027715 6:139305148-139305170 ATGAACAAGGAGAAGGCTTTTGG - Intergenic
1016643230 6:146375182-146375204 ATGAATAACAAGAGGAATTCTGG - Intronic
1018864960 6:167739090-167739112 AAGCACAAGAAGAAAACTACAGG - Intergenic
1020178328 7:5900535-5900557 ATGAACCAGAAGAAAATTTCTGG + Exonic
1020304598 7:6824464-6824486 ATGAACCAGAAGAAAATTTCTGG - Exonic
1021178148 7:17474595-17474617 ATGCAGAAGATGAAGACTTTCGG + Intergenic
1021730046 7:23587056-23587078 CTGAACAGGAGGAAGACTTTGGG - Intergenic
1021740195 7:23679218-23679240 CTGAACAGGAGGAAGACTTTGGG + Intergenic
1022912927 7:34917990-34918012 ATGCACAAAAAGAAAACCTCAGG + Intergenic
1022949795 7:35326764-35326786 ATATACTAGAAGTAGACTTCTGG - Intergenic
1023444448 7:40217199-40217221 AAGAAGAAGAAGAATAATTCTGG - Intronic
1023740245 7:43274312-43274334 AAGAAGATGAAGATGACTTCAGG + Intronic
1025160660 7:56656913-56656935 ATGAGCAACAAGAAAACATCTGG + Intergenic
1025529312 7:61857936-61857958 ATGAAAAAGAAAATGTCTTCAGG - Intergenic
1029080480 7:97970143-97970165 ATGAACCAGAAGAAAATTTCTGG - Intergenic
1029702611 7:102257298-102257320 ATGAAAAAAAAAAAGGCTTCTGG - Exonic
1029851894 7:103470059-103470081 ATGACCAAGAATACCACTTCTGG - Intergenic
1030898239 7:115088438-115088460 ATGACCAAAAAGAATACTTTAGG + Intergenic
1031273031 7:119678699-119678721 AAAAAGAAGAAGAAGACTTTCGG + Intergenic
1032931628 7:136678666-136678688 AGGAACAAGAAAAACAATTCTGG + Intergenic
1033656650 7:143380075-143380097 GTGAACAAGACGAAGGCCTCAGG + Intergenic
1033665745 7:143438768-143438790 ATGAAGAAGAAAAGGACTTGGGG - Intergenic
1033818267 7:145102044-145102066 ATGGAGAAGAAGAAGAATTTGGG - Intergenic
1033965141 7:146966216-146966238 ATGAACAGGAAGAAGTATTCTGG + Intronic
1035007576 7:155678663-155678685 ATGAAGATGAAGAAAATTTCAGG + Exonic
1036021475 8:4851728-4851750 TTGAAGAAGAAGAAGTCTTAAGG - Intronic
1036102836 8:5806093-5806115 ATGAACAGGAAGCAGACATGTGG - Intergenic
1037685439 8:21135412-21135434 AACAACAAAAAGAAAACTTCAGG - Intergenic
1037689669 8:21171414-21171436 ATGAACAAGACCAAGTCTTAAGG - Intergenic
1038749060 8:30279595-30279617 ATGAAAAAAAAGAAAAGTTCAGG + Intergenic
1038871575 8:31500527-31500549 ATGCACAAGATGAAGACTATAGG - Intergenic
1039305340 8:36255793-36255815 ATGAGCAAGAAGAACCCATCAGG + Intergenic
1039444748 8:37622059-37622081 AAAAACAAAAAGAAGACTTGGGG - Intergenic
1041879695 8:62735729-62735751 AGGAACCAGAAAAAGAATTCTGG - Intronic
1041897245 8:62938801-62938823 AGGAACCAGAAGAATAATTCTGG + Intronic
1042314398 8:67410377-67410399 ATGAAAAAAAAGAAGCTTTCAGG - Intergenic
1042381780 8:68123957-68123979 AACAACAAAAAGAAAACTTCAGG + Intronic
1043083488 8:75796932-75796954 AAGAACATAAAGAAAACTTCTGG + Intergenic
1044116890 8:88346677-88346699 AACAAAAAGAAGAAAACTTCAGG - Intergenic
1044421752 8:92004626-92004648 ATGAACTAAGAGAAAACTTCTGG - Intronic
1045810868 8:106218300-106218322 ATGAACATGAGGAGGCCTTCAGG - Intergenic
1046050772 8:109019686-109019708 ATGAACGATAAGAAGACCTGGGG + Intergenic
1046449299 8:114367206-114367228 AAGAAGAAGAAGACGACTACAGG + Intergenic
1047707410 8:127513637-127513659 ATGAACAATAAGAACACTACTGG + Intergenic
1048641003 8:136361474-136361496 ATGAACAAATTGAAGACTGCAGG - Intergenic
1050731356 9:8713464-8713486 AAGAAAATGAAGAAGTCTTCAGG + Intronic
1050845016 9:10205350-10205372 ATAAAGAAGAAGAAGAATTGTGG - Intronic
1051436606 9:17040323-17040345 ATGAACAACATGAGGACTACAGG - Intergenic
1051696085 9:19769139-19769161 ATGGAAAAGGGGAAGACTTCAGG - Intronic
1052790408 9:32870229-32870251 ATGAGCAAGAAAAAGACATAAGG - Intergenic
1052873914 9:33537937-33537959 ATGATAAAGATGAAGACTTTTGG - Intronic
1053502129 9:38606408-38606430 ATGATAAAGATGAAGACTTTTGG + Intergenic
1053622805 9:39837462-39837484 ATGACCAAAAAGAAAACTTCAGG + Intergenic
1054932216 9:70647232-70647254 ATGAAAAAAAAGAAAACTTCAGG + Intronic
1056085447 9:83144506-83144528 AGGAACAAGGGGAAGATTTCAGG + Intergenic
1056430995 9:86527615-86527637 AAGAACAAGAAGAAGAGGTTGGG + Intergenic
1056898141 9:90570549-90570571 AGGAGTAAGAAGAAGCCTTCTGG + Intergenic
1057371360 9:94477350-94477372 ACCAACAAGAAGAGGAATTCTGG + Intergenic
1057681500 9:97190718-97190740 ATGAAAAAGATGAAGACCTTTGG + Intergenic
1057786337 9:98090435-98090457 AGGCACATGAGGAAGACTTCTGG + Intronic
1059300838 9:113311909-113311931 ATGAAGAAGCAGAACACATCAGG - Intergenic
1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG + Exonic
1061270745 9:129540311-129540333 ATGAAGAAGAAGAAAACATTGGG - Intergenic
1185917598 X:4053058-4053080 CTGAACAAAAAGAAAATTTCTGG + Intergenic
1186838267 X:13459378-13459400 ATGGAGAGGAAGAAGGCTTCAGG + Intergenic
1187376310 X:18758204-18758226 AAGAACAAGAAACAGATTTCTGG - Intronic
1188264212 X:28050751-28050773 ATGAACAAAAAGATGTTTTCAGG - Intergenic
1188347877 X:29089936-29089958 ATGAATAAGAAAAAGACTTCAGG - Intronic
1188711475 X:33405912-33405934 ATGACAAAAAAGAAAACTTCAGG - Intergenic
1188996365 X:36890878-36890900 ATGAATAAAAAGAGGAATTCGGG + Intergenic
1189843111 X:45103346-45103368 ATGAACAGGAAAAAGAGTTGGGG - Intronic
1190529229 X:51358297-51358319 ATGAGAAAGAAGAAAACTTAGGG + Intergenic
1191100386 X:56719988-56720010 AGGAACCAGAAGAATAATTCTGG + Intergenic
1191608290 X:63084731-63084753 ATGATCAGGAACAAGCCTTCAGG + Intergenic
1191997462 X:67111285-67111307 ATGGACAAGAAGGAGATTTAGGG + Intergenic
1192435289 X:71139596-71139618 AGGTGCAAGAAGAAGACTTCAGG + Intronic
1193152895 X:78142912-78142934 ATGAACAAGATCAGGTCTTCTGG - Intergenic
1193199803 X:78675312-78675334 CTGAAGACGAAGAAGACTTAAGG - Intergenic
1193355610 X:80517030-80517052 AACAACAAAAAGAAAACTTCAGG + Intergenic
1193627177 X:83836243-83836265 ATAAATAAGAACAATACTTCTGG - Intergenic
1194077056 X:89408940-89408962 AAGAACAACAAAAATACTTCAGG - Intergenic
1194721582 X:97346542-97346564 ATTAACAAGAGGAAAACTTATGG + Intronic
1194776916 X:97976513-97976535 ATGAACAAAGAGAAGATTGCTGG - Intergenic
1195315816 X:103676777-103676799 AAGAACAAGCAGAAGACTCCTGG - Exonic
1195595782 X:106687453-106687475 ATCAACAAAAAGAAAACTACAGG + Intergenic
1196105334 X:111889166-111889188 ATGAAGAAGAAGAGGACTTGGGG + Intronic
1197107001 X:122728812-122728834 AAGAAGAAGAAGATAACTTCAGG + Intergenic
1197288844 X:124630108-124630130 ATGAACAAAAAGAAGACTGTTGG + Intronic
1197492201 X:127131067-127131089 ATGAACAATAAGAAATCATCTGG + Intergenic
1197845167 X:130793782-130793804 TTCAAGAAGAAGAACACTTCAGG + Intronic
1198312638 X:135436696-135436718 AGGAACAAGAAGGCGAGTTCCGG + Intergenic
1198664843 X:139008750-139008772 ATGAACCAGAAAAACAATTCTGG + Intronic
1198733061 X:139754537-139754559 AACAACAAAAAGAAAACTTCAGG + Intronic
1198896403 X:141460355-141460377 ATGAATAAGATGAAGACCCCAGG + Intergenic
1200364071 X:155642785-155642807 ATCAACAACAAGAAGAATTTTGG - Intronic