ID: 1061059903

View in Genome Browser
Species Human (GRCh38)
Location 9:128245090-128245112
Sequence GTGTCCAACCCCGAAGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061059890_1061059903 25 Left 1061059890 9:128245042-128245064 CCGGCCGGCAGGAAGGGAGGGGT 0: 1
1: 0
2: 3
3: 25
4: 255
Right 1061059903 9:128245090-128245112 GTGTCCAACCCCGAAGCACAGGG No data
1061059899_1061059903 -10 Left 1061059899 9:128245077-128245099 CCGCTCCTACCTAGTGTCCAACC 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1061059903 9:128245090-128245112 GTGTCCAACCCCGAAGCACAGGG No data
1061059893_1061059903 21 Left 1061059893 9:128245046-128245068 CCGGCAGGAAGGGAGGGGTGGGG 0: 1
1: 1
2: 8
3: 117
4: 973
Right 1061059903 9:128245090-128245112 GTGTCCAACCCCGAAGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061059903 Original CRISPR GTGTCCAACCCCGAAGCACA GGG Intronic
No off target data available for this crispr