ID: 1061062348

View in Genome Browser
Species Human (GRCh38)
Location 9:128256992-128257014
Sequence AAGGGATGGTAGGGATATGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 11, 3: 44, 4: 347}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061062336_1061062348 30 Left 1061062336 9:128256939-128256961 CCCGTTAGACAGGGGTCTATGCT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1061062348 9:128256992-128257014 AAGGGATGGTAGGGATATGGTGG 0: 1
1: 0
2: 11
3: 44
4: 347
1061062337_1061062348 29 Left 1061062337 9:128256940-128256962 CCGTTAGACAGGGGTCTATGCTT 0: 1
1: 0
2: 0
3: 11
4: 87
Right 1061062348 9:128256992-128257014 AAGGGATGGTAGGGATATGGTGG 0: 1
1: 0
2: 11
3: 44
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061062348 Original CRISPR AAGGGATGGTAGGGATATGG TGG Exonic
900993207 1:6107252-6107274 AAGGGATGATGGAGAGATGGAGG + Intronic
900993419 1:6108096-6108118 GAGGGATGGTGGAGACATGGAGG + Intronic
903968619 1:27104814-27104836 AAAGGATGGTAAAGAAATGGAGG + Intronic
904711482 1:32433516-32433538 AAGGGAGAGTAGAGACATGGAGG - Intergenic
906744682 1:48213519-48213541 AAGGGAGAGTAGAGATATGGAGG + Intergenic
907090693 1:51722579-51722601 AAGGGATGCTAAGGATACAGTGG + Intronic
907296322 1:53458013-53458035 AGGGGAGGGGAGGGAAATGGAGG + Intergenic
907891630 1:58642077-58642099 AATGGAGAGTAGGGATGTGGAGG - Intergenic
909094621 1:71271549-71271571 AAGGTAGGGTAGGGAAATGGGGG - Intergenic
909286527 1:73826925-73826947 AAGGGAGGGTAGGGGAAGGGAGG + Intergenic
911795346 1:102068980-102069002 AAAGGATAGAAGAGATATGGTGG + Intergenic
912076718 1:105884528-105884550 AAAGCTTGGTAGGGAGATGGGGG - Intergenic
912815497 1:112825100-112825122 AAGAGAGGGTAGAGACATGGCGG + Intergenic
913148522 1:116016661-116016683 AAGGGGTGTTAGGTACATGGTGG - Intronic
915745605 1:158154643-158154665 AAGGTATGGTGGGGTTAGGGTGG + Intergenic
917896425 1:179492644-179492666 GAGGGATGGAAGGGAGAAGGAGG + Intronic
918116428 1:181502092-181502114 AGGGGATGGGAGGGGTATGCAGG + Intronic
918681433 1:187359791-187359813 AAGGGATGGTAGAGACAAGAGGG - Intergenic
919462394 1:197893376-197893398 AAGTGTTGGCAAGGATATGGAGG - Intergenic
920956421 1:210623738-210623760 ATGGGATGGATGGGATTTGGGGG + Intronic
921833584 1:219755558-219755580 AAGGGTTGGTGAGGATATGAAGG + Intronic
923664549 1:235988380-235988402 AAGTTTTGGTAAGGATATGGAGG + Intronic
923784085 1:237051183-237051205 AAGGGAGGGAAGGGAAAAGGAGG - Intronic
1062802194 10:388933-388955 AAGGGATCTCAGGGACATGGGGG + Intronic
1063410016 10:5830392-5830414 TAGGGATGGTGGGGCTGTGGGGG - Intronic
1064791809 10:18965256-18965278 AATGGGTGCTAGGGATATAGTGG + Intergenic
1065354836 10:24829888-24829910 AAGGGCTGTTATGGATTTGGAGG - Intergenic
1065917009 10:30360823-30360845 AAGGGGTGTTAGGGACATGGTGG + Intronic
1067530199 10:47065481-47065503 TAGGGATGGGAGGGATAAAGAGG + Intergenic
1068242921 10:54328152-54328174 AGTGGATGTCAGGGATATGGTGG - Intronic
1069164490 10:65135229-65135251 AAGTATTGGTGGGGATATGGAGG + Intergenic
1070127458 10:73633778-73633800 GAGAGATGGCAGGGATATGGGGG - Intronic
1070279574 10:75038693-75038715 AAGAGTTGGAAGGGAGATGGAGG + Intronic
1070698303 10:78579502-78579524 AAGGGATGATATGGACATGTAGG + Intergenic
1070714602 10:78710168-78710190 AAGAGATGCCAGGGATATGGGGG + Intergenic
1070912072 10:80127443-80127465 AAGGGATGAATGGGATATGGGGG - Intergenic
1072382489 10:94889919-94889941 AAGGGAGGGTGGGGGTATAGGGG - Intergenic
1072906903 10:99462719-99462741 AAGGGAACGAAGGGATATAGAGG - Intergenic
1073176452 10:101560320-101560342 AAGGGATGGGTGGGGAATGGTGG - Intergenic
1073595170 10:104792287-104792309 AGGGCTTGGTAGGGAGATGGTGG + Intronic
1074899343 10:117803187-117803209 CAGGGATGGTAGAGAAAGGGTGG - Intergenic
1074971877 10:118545589-118545611 AAGGGATGGATTGGACATGGTGG - Intergenic
1075651465 10:124130331-124130353 AAGGGAAGGCAGGGCTGTGGTGG + Intergenic
1075666305 10:124233473-124233495 CAGGGATGGGAGAGATATCGGGG - Intergenic
1075802234 10:125160631-125160653 AAGGGAAGGGAGGGGTAGGGTGG - Intronic
1075934166 10:126325329-126325351 AAGGGTTGGGAGGGAACTGGGGG + Intronic
1076433281 10:130422454-130422476 AAGGGCTGGTGGGGAGATGCGGG + Intergenic
1077332823 11:1990844-1990866 AAGGGCTGGCAGGGCTGTGGGGG - Intergenic
1077698885 11:4421135-4421157 AAGAGCTGGAAGGGATATGGGGG + Intergenic
1078379267 11:10825342-10825364 TAGGCATGGGAGGGAGATGGGGG + Intronic
1078920976 11:15830350-15830372 TAGGAAAGGTAGGGATAGGGAGG + Intergenic
1079041477 11:17063877-17063899 GAGGGAGGGTAGGGAAGTGGGGG + Intergenic
1080705304 11:34686497-34686519 AAGTGTTGGTAAGGATATGCTGG - Intergenic
1081012922 11:37838378-37838400 AGGGGGTGGTTGTGATATGGAGG - Intergenic
1081133293 11:39406829-39406851 AATTTATGGTAGGGGTATGGTGG + Intergenic
1081263502 11:40989810-40989832 ATGGGAAGGCAAGGATATGGAGG - Intronic
1081597137 11:44467158-44467180 CAGGGAGGGGAGGGATAGGGAGG + Intergenic
1082234206 11:49803135-49803157 AAAGGATAGTAGGAAGATGGTGG + Intergenic
1083138096 11:60698962-60698984 AAGAGAAGGTAGAGATATGTTGG - Intergenic
1084047008 11:66574796-66574818 AAGGGAGAGTAGAGACATGGAGG - Intergenic
1084613423 11:70218802-70218824 AAGGGAGAGTAGAGACATGGAGG + Intergenic
1086607581 11:88714556-88714578 AAGAGATTATAGGGATTTGGAGG - Intronic
1086617382 11:88838296-88838318 AAGGGATAGTAGGAAGATAGTGG - Intronic
1087098944 11:94346894-94346916 AAGAGAGAGTAGAGATATGGAGG - Intergenic
1087686782 11:101274081-101274103 AAGAGATGGTTGGGTTATGGGGG + Intergenic
1088629543 11:111761532-111761554 AAAGGATGGGATGGAGATGGTGG - Intronic
1090356045 11:126140930-126140952 CTGGGATGGTTGGGATAAGGAGG - Intergenic
1090644612 11:128757814-128757836 AAAGGAGGGTGGGGATAGGGAGG - Intronic
1090819494 11:130328452-130328474 AAGGGATGGGAGAGAAATCGAGG - Intergenic
1091160213 11:133413102-133413124 AGGGGATGGTGGGGATGTGGAGG + Intronic
1091326231 11:134690232-134690254 AAGCTATGGAAGGGATTTGGGGG - Intergenic
1202815806 11_KI270721v1_random:46020-46042 AAGGGCTGGCAGGGCTGTGGGGG - Intergenic
1091973600 12:4808736-4808758 AAGGGATGGTAGAGAAAGGGTGG - Intronic
1092218267 12:6697255-6697277 AAAGGCTGGGAGGGATATGACGG - Intronic
1092474337 12:8806141-8806163 AAGGGAGAGTAGAGACATGGAGG - Intergenic
1092528972 12:9328522-9328544 AAGGGAGGGTAGGTGTTTGGGGG + Intergenic
1093216914 12:16373249-16373271 GAAGGATAGTAGGGATGTGGGGG + Intronic
1093351905 12:18113651-18113673 AAGGGCTGTTAGGGATTTGTGGG - Intronic
1093882244 12:24418221-24418243 AAGGAATGAAAGGGATATTGAGG - Intergenic
1095487246 12:42698087-42698109 AAGGTATGGTAAAAATATGGTGG + Intergenic
1096984144 12:55745306-55745328 AAGGGATGCTAAGGATATTTAGG - Intronic
1097038963 12:56142955-56142977 AAGGGATGGAGGCGATCTGGAGG - Intronic
1097068302 12:56336863-56336885 AAGGGTTGGTGGGGAGATTGTGG - Intronic
1097080656 12:56428424-56428446 AAGGGATGGAAGGGCTATTCTGG + Intronic
1097169522 12:57105099-57105121 AAGGGCTGTTAGGGTGATGGAGG - Intronic
1099147408 12:79064022-79064044 CCGGAATGGTAGGGATAAGGAGG - Intronic
1099203631 12:79703522-79703544 AAGTGATGGTGGGCAAATGGAGG + Intergenic
1099480929 12:83165467-83165489 AAGGAAAGGGAGGGAGATGGGGG + Intergenic
1100940142 12:99716381-99716403 AAGAGAGAGTAGGGACATGGAGG - Intronic
1101037117 12:100717102-100717124 AAGGGGTGGCAGGGATGTCGTGG - Intergenic
1102172483 12:110852765-110852787 AAGGGATGGCAGGGGGAGGGAGG + Intronic
1102469023 12:113149253-113149275 AAGGGATGGTCTGGACTTGGGGG - Intergenic
1103909703 12:124345441-124345463 AAAGGATGGTGAGGAAATGGGGG + Intronic
1104374976 12:128257703-128257725 AAGGGTTGGTGAGGATTTGGAGG - Intergenic
1104439495 12:128783218-128783240 AAGGTCTGGGAGGGAGATGGGGG - Intergenic
1104711745 12:130992240-130992262 ATGGGATGGTAGGCATCTGTGGG - Exonic
1105320384 13:19314454-19314476 TAGGGATGATAGGGCTCTGGTGG + Intergenic
1108372076 13:49780067-49780089 GAGGGATTGTAGGGATAAGAAGG - Intronic
1112492608 13:99880830-99880852 AAGGGACGGGAGGGATAAAGAGG + Intronic
1113044885 13:106145408-106145430 AAGGGGTGGGAGGGAGAAGGAGG - Intergenic
1114551906 14:23537627-23537649 AAGGGGTGGAAGGGATGGGGAGG + Intronic
1114754916 14:25248162-25248184 AATAGATGATAGAGATATGGAGG - Intergenic
1115514908 14:34175445-34175467 AAGGGATGGTGTGGAAATTGGGG - Intronic
1116522209 14:45863377-45863399 GAGGGATGGTGGAGAGATGGTGG + Intergenic
1117514526 14:56487518-56487540 TAGGGATGGCAGGGAGAAGGTGG - Intergenic
1117813204 14:59570305-59570327 AGGGCATAGGAGGGATATGGAGG - Intronic
1118901399 14:69989176-69989198 AAGTGTTGGTAAGGATGTGGAGG - Intronic
1119022270 14:71125500-71125522 AAGGGAGAGTAGAGACATGGAGG - Intergenic
1120307730 14:82791618-82791640 TAGGTATGGTAGGGATACTGAGG + Intergenic
1123665281 15:22603869-22603891 AAGAGGTGGTAGGGACATGGTGG + Intergenic
1123752477 15:23368786-23368808 AAGAGGTGGTAGGGACATGGTGG - Intergenic
1124319115 15:28698288-28698310 AAGGGGTGGTAGGGACATGGTGG + Intergenic
1124483407 15:30097098-30097120 AAGGGGTGGTAGGGACATGGTGG - Intergenic
1124489859 15:30149160-30149182 AAGGGGTGGTAGGGACATGGTGG - Intergenic
1124520171 15:30400128-30400150 AAGGGGTGGTAGGGACATGGTGG + Intergenic
1124538484 15:30566096-30566118 AAGGGGTGGTAGGGACATGGTGG - Intergenic
1124687161 15:31792425-31792447 AAGGGATGCTATGGAGAGGGCGG - Intronic
1124753671 15:32389166-32389188 AAGGGGTGGTAGGGACATGGTGG + Intergenic
1124760167 15:32441489-32441511 AAGGGGTGGTAGGGACATGGTGG + Intergenic
1124975417 15:34524872-34524894 AAGGGGTGGTAGGGACATGGTGG + Intergenic
1125830985 15:42717062-42717084 AAGGAATGGTAGGGATGGGTGGG - Intronic
1125932442 15:43610210-43610232 AAAGGATAGTAGGGATAAGCTGG + Intronic
1125945540 15:43709682-43709704 AAAGGATAGTAGGGATAAGCTGG + Intergenic
1127126752 15:55819556-55819578 AAAGGTGGGTAGAGATATGGAGG - Intergenic
1129038998 15:72670005-72670027 AAGGGATGGTAGGGACACGATGG - Intergenic
1129331223 15:74828400-74828422 CAGGCTTGGTGGGGATATGGGGG - Intronic
1129399512 15:75273855-75273877 AAGGGATGGTAGGGACACGATGG - Intronic
1129476660 15:75790539-75790561 AAGGGGTGGTAGGGACATGGTGG - Intergenic
1130259012 15:82339587-82339609 GAGGGGTTGTAGGGACATGGTGG + Intergenic
1130282289 15:82529973-82529995 AAGGGGTGGTAGGGACATGGTGG - Intergenic
1130462004 15:84166831-84166853 GAGGGGTTGTAGGGACATGGTGG - Intergenic
1130473623 15:84245753-84245775 GAGGGGTTGTAGGGACATGGTGG - Intergenic
1130481038 15:84359817-84359839 GAGGGGTTGTAGGGACATGGTGG - Intergenic
1130490674 15:84427942-84427964 GAGGGGTTGTAGGGACATGGTGG + Intergenic
1130502261 15:84506712-84506734 GAGGGGTTGTAGGGACATGGTGG + Intergenic
1130595907 15:85250354-85250376 GAGGGGTTGTAGGGACATGGTGG - Intergenic
1130798652 15:87237549-87237571 TAGGGAGGGTAGGGAGAAGGGGG - Intergenic
1131189151 15:90300399-90300421 AAGGGGTGGCAGGGACATGGTGG - Intronic
1132184940 15:99796389-99796411 AAGGGGTGGTAGGGTCATGGTGG - Intergenic
1132203180 15:99969106-99969128 AAGGGATGGTGGGATTTTGGTGG - Intergenic
1132432047 15:101768165-101768187 AAGGGGTGGTAGGGTCATGGTGG + Intergenic
1133747991 16:8701939-8701961 CAGGGAGGGGAGGGACATGGAGG + Intronic
1133936087 16:10270525-10270547 AAAGGAGGGTAGGGATATCCTGG - Intergenic
1135731093 16:24895573-24895595 AAGGGAGGGAAGGGAAAAGGAGG + Intronic
1137773307 16:51035820-51035842 AAGGGCTGGTGGGGATTGGGTGG - Intergenic
1138088384 16:54154515-54154537 AGGGCATGGTGGGGACATGGTGG + Intergenic
1138485086 16:57335937-57335959 AAGTGATGGCAAGGATGTGGAGG - Intergenic
1138624547 16:58238716-58238738 AATGGCTGCTTGGGATATGGAGG - Intronic
1138759261 16:59522137-59522159 AAGGGAGAGTAGAGACATGGAGG + Intergenic
1139659570 16:68411510-68411532 GAGGGATGGGAGGGTGATGGAGG + Intronic
1139908630 16:70382935-70382957 AAGGGATGACAGGTATATGAGGG + Intronic
1140412988 16:74752715-74752737 AAGGGATGGTGGGGAGCAGGAGG + Intronic
1141062803 16:80889930-80889952 GAGGGAAGGTATGGATTTGGGGG + Intergenic
1141195785 16:81859849-81859871 AAGGGCTGGTAGAGATGTGTTGG + Intronic
1142756050 17:2017032-2017054 ATAGGATGATGGGGATATGGAGG - Intronic
1144313628 17:14038089-14038111 AAGGTATGATAAGGATATTGTGG - Intergenic
1145755649 17:27388243-27388265 AAGGGATGAGAGGGTTTTGGAGG + Intergenic
1146690266 17:34869535-34869557 AAAGGATGGGAGGGAGATGAGGG - Intergenic
1147579419 17:41619857-41619879 ATGGGATGGAAGGGAGGTGGTGG - Intronic
1148293570 17:46478881-46478903 GAGGGATGGTAGAGAGATTGTGG + Intergenic
1148315756 17:46696583-46696605 GAGGGATGGTAGAGAGATTGTGG + Intronic
1148326427 17:46785846-46785868 AAGGGAGGGAAGGGGTGTGGAGG + Intronic
1149259836 17:54867113-54867135 AAGGGATACTGGGGATATGAAGG + Intergenic
1151153114 17:72104904-72104926 AAGTGGTGGTAGGGAGAGGGAGG - Intergenic
1151256529 17:72881011-72881033 AAGTGTTGGTGAGGATATGGAGG + Intronic
1152851349 17:82638198-82638220 AAGGGAGGGGAGGGAAAGGGAGG + Intronic
1153017337 18:596174-596196 AGAGGATGTTTGGGATATGGGGG + Intergenic
1155671471 18:28377034-28377056 AAAGAATGGTAGGGCTATGATGG - Intergenic
1156249620 18:35340100-35340122 AAGGAGTGGTAGGGGAATGGGGG + Intronic
1158826128 18:61222241-61222263 AAGGGAAGGGAGGGAGATTGAGG - Intergenic
1158906807 18:62020999-62021021 AAGGGCTGACAGGGATGTGGAGG + Intergenic
1159094314 18:63885415-63885437 AAGGGATGGTATAGATATGGAGG + Intronic
1160184632 18:76665954-76665976 TAGGGATGGTGGGGATAGGGAGG + Intergenic
1161849374 19:6730828-6730850 AAGGGATGGAGGGGAGATGGGGG - Intronic
1162134108 19:8544640-8544662 CAGGGATGGAAGGGATAGGGGGG + Intronic
1162467191 19:10849339-10849361 AGGGGATGGAAGGGGAATGGGGG - Intronic
1164157090 19:22603485-22603507 AAGGGGTGGGAGGGACATGGGGG - Intergenic
1164564195 19:29314453-29314475 GAGGGATGGTTGGGAGAGGGAGG + Intergenic
1164950422 19:32332030-32332052 AAGGGATGGAAGGTACATGAGGG - Intergenic
1165148835 19:33749438-33749460 GGGGGATGGTGGGGAGATGGGGG - Intronic
1165565622 19:36724879-36724901 AAGTGATGGAAAGAATATGGAGG - Intronic
1166905956 19:46108584-46108606 AAGAGAGGGTAGAGACATGGAGG + Intergenic
1167821350 19:51930907-51930929 AAGTGTTGGTAGGTACATGGTGG - Intronic
924997571 2:377017-377039 AAGTGATGTTAGCAATATGGTGG + Intergenic
925606134 2:5662021-5662043 AAGGGAAGGGAGGGAAATGGGGG + Intergenic
925965674 2:9063017-9063039 AAGGGAAGGAAGGGAAAGGGAGG + Intergenic
926379929 2:12276868-12276890 AAGGAATGGAAGAGATATGGTGG - Intergenic
926447761 2:12965191-12965213 AAGGGCTGGGAGGGAGAGGGAGG - Intergenic
927348879 2:22082441-22082463 GAGAGGTGGTAGGGAGATGGAGG + Intergenic
927693182 2:25222671-25222693 AAGGGAGGGGTGGGTTATGGGGG + Intergenic
927723907 2:25406048-25406070 GATGGCTGGCAGGGATATGGTGG + Intronic
928405457 2:31011066-31011088 GAGGGAGGGAAGGGATAGGGAGG + Intronic
928687974 2:33768929-33768951 AGGGGATGGAAGGGAAATGAAGG + Intergenic
928718596 2:34092917-34092939 AAGGGAGAGTGGGGATTTGGAGG - Intergenic
929566288 2:42987747-42987769 AAGTGCTGGCAGGGATGTGGAGG - Intergenic
930696535 2:54417141-54417163 GAGGGAGGGGAGGGAAATGGAGG + Intergenic
930780439 2:55219885-55219907 AAAGGTGGGCAGGGATATGGAGG - Intronic
935080267 2:99786148-99786170 AAAGGATGGTAGGGAGATGAAGG + Intronic
935404708 2:102697072-102697094 AGGGGATGCTAGGGAAAGGGAGG - Intronic
935425970 2:102918593-102918615 AGTGGATGGTAGGGACATGGGGG - Intergenic
935537967 2:104316473-104316495 AATGGATGGTAGGGACCCGGAGG - Intergenic
936089906 2:109494813-109494835 AAGAGATGGTTGAGATCTGGAGG - Intronic
936277850 2:111116418-111116440 TATAGAGGGTAGGGATATGGTGG - Intronic
937682909 2:124663852-124663874 AAAGGAAGACAGGGATATGGTGG + Intronic
937704350 2:124901862-124901884 GAGGTATGATAAGGATATGGAGG - Intronic
938019937 2:127897953-127897975 TAGGGATGGTAGGGAGAAGAGGG + Intergenic
938560770 2:132470258-132470280 GAGGGATGGGAGTGCTATGGAGG + Intronic
939186042 2:138861734-138861756 AAGGGGTGGGAGAGAGATGGGGG + Intergenic
940981951 2:160013356-160013378 AAGGGATGGGAGAGACATGGTGG - Exonic
941087434 2:161134298-161134320 AATGGATGAAAGGGATATAGTGG - Intergenic
941561858 2:167056809-167056831 GAGGGAAGATATGGATATGGAGG - Intronic
941918462 2:170827476-170827498 AGGGGATGGTGGAGATGTGGAGG + Intronic
942017267 2:171829560-171829582 AAGGGATAGCAGGGCTATAGAGG - Intronic
942119003 2:172758238-172758260 GAGGGATGGTAAGGATGTTGTGG + Intronic
942593526 2:177570775-177570797 AAGGGATGAGAGGGAAGTGGGGG - Intergenic
943099309 2:183469297-183469319 AAAGGGTAGTAGGGATGTGGGGG - Intergenic
945046820 2:205789150-205789172 AGGGGGCAGTAGGGATATGGTGG + Intronic
945301643 2:208220774-208220796 AAGGGAGAGTAGAGACATGGAGG + Intergenic
945311490 2:208318641-208318663 TATGGATGTTAGGGAAATGGTGG + Intronic
947836058 2:233176492-233176514 AATGGATGATAGCCATATGGTGG + Intronic
948654805 2:239469953-239469975 AAGGGGAAGTTGGGATATGGAGG + Intergenic
1170116231 20:12863135-12863157 AGGGGATGGTAGTGGTAGGGTGG - Intergenic
1170950313 20:20930755-20930777 AGGGGATGGTGAGGATAGGGAGG - Intergenic
1170950320 20:20930775-20930797 AGGGGATGGTGGGGATAAGGAGG - Intergenic
1170950328 20:20930795-20930817 AGGGGATGGTGGGGATAGGGAGG - Intergenic
1170950337 20:20930815-20930837 AGGGGATGGTGGGGATAGGGAGG - Intergenic
1170950346 20:20930835-20930857 AGGGGATGGTGGGGATAGGGAGG - Intergenic
1170950355 20:20930855-20930877 AGGGGATGGTGGGGATAGGGAGG - Intergenic
1170950364 20:20930875-20930897 AGGGCATGGTGGGGATAGGGAGG - Intergenic
1170950378 20:20930915-20930937 AGGGGATGGTGGGGATAGAGAGG - Intergenic
1172308080 20:33895940-33895962 GAGGGATGGCAAGGATATGGGGG + Intergenic
1174354658 20:49989859-49989881 AAGGGAAGTTAGGGAGTTGGGGG + Intergenic
1174825063 20:53761489-53761511 AAGGGCTGGGAAGGATATGATGG - Intergenic
1176868528 21:14070293-14070315 AAGGGCTCGTAGGGCTAGGGCGG + Intergenic
1177692014 21:24522819-24522841 ATGGTATGGTAGGGATATATTGG + Intergenic
1179240509 21:39586434-39586456 AAGGGATGATAGGGAGAGGTTGG + Intronic
1180715947 22:17872403-17872425 AAGGGATGGGAGGGGCATGATGG + Intronic
1181136309 22:20768982-20769004 AAGTGATGGTGGAGATATGAAGG + Intronic
1182116554 22:27759889-27759911 GAGGGATAGAAGGGATTTGGGGG - Intronic
1185087713 22:48749646-48749668 AAGGAAGGGTGGGGATTTGGGGG + Intronic
949715392 3:6924797-6924819 AAGGGATGGAAGGGATTCTGGGG + Intronic
950505112 3:13389703-13389725 AGGGGATGTTGGGGATGTGGTGG - Intronic
950653551 3:14422721-14422743 GAGTGAGGGTAGGGATTTGGAGG - Intronic
950907625 3:16553406-16553428 CACGGATGGTTGGGATATGATGG + Intergenic
951031282 3:17884851-17884873 AAGAAATGGTAAGAATATGGGGG - Intronic
951678326 3:25267279-25267301 AAGGCATTGTAAGGAAATGGTGG + Intronic
951812530 3:26716511-26716533 ATGGGATGGTGGGGATGTTGAGG + Intergenic
952773360 3:37021964-37021986 AAGGGAGGGAAGAGACATGGAGG + Intronic
952782107 3:37111738-37111760 TAGGGGTGGTAGGGATGGGGTGG - Intronic
954388177 3:50255250-50255272 AGGGCATGGCAGGGATATTGAGG + Intronic
954751706 3:52817726-52817748 CAGGGATGGCAGGGCCATGGCGG - Intronic
956406309 3:68932212-68932234 AAGGGTTGGAAGGGATAAGGAGG - Intronic
957264469 3:77944493-77944515 AGAGGATGGAAGGGCTATGGCGG + Intergenic
959368096 3:105488712-105488734 AAGGGAAGGGAGGGAGAAGGAGG + Intronic
960698170 3:120415614-120415636 AAGGGATTGAAGGGTTATGGGGG + Intronic
961100537 3:124194955-124194977 CAGTGATGGTAGGTATAGGGGGG + Intronic
961660275 3:128464946-128464968 AAGGGAGGGAAGGGAGAAGGGGG - Intronic
962308014 3:134305990-134306012 AAATGATAGTAGGGACATGGTGG - Intergenic
962484706 3:135831174-135831196 AAGGGATGGTAGGGTGGTGGGGG - Intergenic
962826496 3:139104557-139104579 AAGGTATGCAAAGGATATGGGGG - Intronic
964125618 3:153231220-153231242 AAGAGAGAGTAGAGATATGGAGG + Intergenic
964906662 3:161726356-161726378 AAGGGAGAGTAGAGACATGGAGG + Intergenic
965626471 3:170687854-170687876 AAGGGAGAGTAGAGACATGGAGG + Intronic
969481318 4:7448547-7448569 AAGGGAGGGTAGAGAAAGGGAGG - Intronic
969833833 4:9822135-9822157 AAGTGATGTTGGGGAGATGGAGG - Intronic
970532573 4:16998877-16998899 AAGGGAGAGTAGAGACATGGAGG - Intergenic
970801767 4:19980175-19980197 AAGGGTTGGTAGGAATTAGGTGG + Intergenic
973294075 4:48496109-48496131 AAGGTATGGTGGGGATAGTGGGG + Intergenic
975038832 4:69718946-69718968 AAGGGAGGGAGGGGATATAGAGG + Intergenic
976017914 4:80581686-80581708 AAGTGATGGTAAGGATAGGAAGG - Intronic
976802049 4:89003964-89003986 AGGGTATGGTAGGGATCTGCCGG + Intronic
977062671 4:92276013-92276035 AACGGAGGGAAGGGATTTGGGGG + Intergenic
978107260 4:104918089-104918111 AATGGATGGTAGATATATGTTGG - Intergenic
979146466 4:117253294-117253316 AAGGGAGAGTAGAGACATGGAGG - Intergenic
979991996 4:127385872-127385894 ACGGGCTGGGAGGGATATGATGG + Intergenic
981036055 4:140169838-140169860 AAGGGAATGTAGGGAGATGTTGG - Intergenic
982609212 4:157552023-157552045 ATGTGATGGTAGGGACCTGGTGG + Intergenic
983314527 4:166113741-166113763 AAGTGTTGGTAAGGATGTGGAGG + Intergenic
983971761 4:173883928-173883950 AAGGGAAAGCAGGGATGTGGAGG - Intergenic
984408853 4:179370068-179370090 AAGGCATGGAAGGCACATGGAGG + Intergenic
985189824 4:187360450-187360472 AAGGGATGGAAGGGGGAGGGAGG + Intergenic
985721483 5:1491763-1491785 AATGGATGGTGCGGATATGAAGG + Intronic
989239543 5:39188436-39188458 AAGGGTTGGTGGGGAGATGAAGG - Intronic
989659771 5:43787311-43787333 AAGAGAGGGTAGAGACATGGGGG - Intergenic
991118662 5:62984844-62984866 CAGGCAGGGAAGGGATATGGGGG - Intergenic
991443201 5:66672931-66672953 AAGGGCTGACAGGGATGTGGGGG - Intronic
991493790 5:67208537-67208559 AGGGGATGGAAGGGGTCTGGAGG + Intergenic
992081525 5:73238077-73238099 AAGTGTTGGCAGGGATATGAAGG + Intergenic
992304140 5:75418361-75418383 AAGTGTTGGTGGGGATATGGAGG + Intronic
992913944 5:81428617-81428639 AAGGGATGATGGCGAAATGGGGG - Exonic
993441052 5:87957486-87957508 AAGGCATTGTTGGGATATGGGGG - Intergenic
993503300 5:88685012-88685034 GAGGGATGGGAGGGGTAGGGTGG + Intergenic
994475521 5:100263762-100263784 TAGGGATGGTGGGGAAAAGGTGG - Intergenic
995607276 5:113870445-113870467 AAGGGAGGGATTGGATATGGAGG + Intergenic
996876041 5:128241761-128241783 AAGGGATGCTGGAGATTTGGGGG + Intergenic
997238384 5:132288937-132288959 AAGGGAGGTAGGGGATATGGAGG - Intronic
998962991 5:147509032-147509054 AAGTGATGCTGGGAATATGGGGG - Intronic
999705196 5:154266364-154266386 ATTGGATGGTAGGATTATGGAGG + Intronic
1000264146 5:159618791-159618813 ATGGCATAGTAGGTATATGGTGG - Intergenic
1000796914 5:165675390-165675412 AAGTGTTGGCAAGGATATGGAGG - Intergenic
1001046650 5:168378282-168378304 TAGAGAGGGTAGGGAGATGGGGG + Intronic
1001121727 5:168986400-168986422 AAGGGAGAGGAGGGCTATGGAGG - Intronic
1001418122 5:171563078-171563100 AAGTGGTGGAAGGGATCTGGTGG - Intergenic
1002273287 5:178086798-178086820 AAGGGAGGGGAGGGAGATGGGGG - Intergenic
1003026189 6:2557911-2557933 AAGGGATGGGAAGTATAAGGGGG - Intergenic
1003685048 6:8294480-8294502 AAGGGATAGATAGGATATGGGGG + Intergenic
1004079363 6:12376227-12376249 AATGGATTGTAGGGACATGTAGG - Intergenic
1004753459 6:18586749-18586771 AAGAGATCGTACTGATATGGTGG - Intergenic
1004768736 6:18758571-18758593 AAGGGAGAGTAGAGACATGGAGG + Intergenic
1005417097 6:25611608-25611630 AAGGGATGGTAGTGCTAAGTAGG + Intronic
1005894701 6:30168001-30168023 AAGGCATAGTAGGGTTATGATGG + Intronic
1006760551 6:36456838-36456860 AAGAGATGGTAAAGAGATGGCGG + Intronic
1006821093 6:36895964-36895986 AAGTGTTGGTAAGGACATGGAGG - Intronic
1006927133 6:37663150-37663172 AAGGGATGGGAGGAATTTGCTGG - Intronic
1006948258 6:37800116-37800138 CAGGGAAGGTAGGGAAATGAGGG - Intergenic
1006965076 6:37975126-37975148 AAGTGTTGGTGAGGATATGGAGG - Intronic
1008360150 6:50607783-50607805 AAGAGAAGGTGGGGAAATGGAGG + Intergenic
1008876349 6:56333756-56333778 AAGTGATGGCAAGGGTATGGAGG - Intronic
1010481995 6:76366693-76366715 ATGTCATGGTAGGGATTTGGTGG + Intergenic
1012319960 6:97830959-97830981 GAGACATGGTAGGGATTTGGGGG - Intergenic
1013251820 6:108342037-108342059 AAGGGATGGAAGGGCAAAGGAGG + Intronic
1013535126 6:111056945-111056967 AGGTGATGGTAGGGCGATGGGGG + Intergenic
1013893161 6:115050780-115050802 AACGGATGGTTGGAGTATGGAGG + Intergenic
1014672455 6:124322534-124322556 AAAGGATGGTAGGGATGATGAGG - Intronic
1016428502 6:143958830-143958852 AAGGAATGTTAAGGAAATGGGGG + Intronic
1016546051 6:145225585-145225607 AATGGATGCTAGTGATATGCTGG + Intergenic
1017332740 6:153218469-153218491 AGGGGAAGGGAGGGAAATGGAGG - Intergenic
1018336354 6:162794109-162794131 AAGTGTTGGTGAGGATATGGAGG - Intronic
1021002001 7:15342463-15342485 AAGGGATGGTTGGGATGGGTGGG - Intronic
1021239027 7:18178034-18178056 AAGGGGAGGTAGGGGGATGGAGG - Intronic
1021707572 7:23382820-23382842 AAGGGAGGGTAGAGATTTGCTGG + Intronic
1021974039 7:25994612-25994634 AAGTGTTGGTGAGGATATGGAGG + Intergenic
1023669837 7:42563973-42563995 AAAGGATGGGAGGGAGATGAGGG + Intergenic
1024017585 7:45332025-45332047 AAGTGTTGGTAAGGATGTGGAGG - Intergenic
1027202051 7:76070098-76070120 GGGGGATGATAGGGACATGGAGG + Intergenic
1027250381 7:76395208-76395230 CGGGAATGGTAGGGGTATGGTGG - Intronic
1027349346 7:77294518-77294540 AAGGGATGGGAGGGGTAGGAGGG - Intronic
1027469956 7:78561214-78561236 AAGGGATGGTAGGTAGGTGTGGG + Intronic
1028842040 7:95439138-95439160 AAGGGATAAAAGGAATATGGAGG - Intergenic
1029425999 7:100494228-100494250 AAGGGATGGGAGGAAGAGGGGGG + Exonic
1029543883 7:101200357-101200379 CAGAGATGGTGGGGACATGGGGG - Intronic
1030711747 7:112757879-112757901 AAGGGATGGAAGAGAGGTGGAGG - Intergenic
1031376784 7:121036090-121036112 AAGGAAAGGTAGGGATTTGAGGG + Intronic
1031391173 7:121216799-121216821 AAGGAATGGTAAATATATGGTGG + Intronic
1031788391 7:126064981-126065003 CAGGGATGGCAGGGATATAGAGG + Intergenic
1031971171 7:128066172-128066194 GTGGGATGGTAGGGGTAGGGGGG - Intronic
1032865635 7:135921336-135921358 AAAGGCTGGTAGGGATTTGCTGG - Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034315154 7:150123961-150123983 AAGAGATGGAAGGGACATCGGGG - Intergenic
1034694805 7:153043870-153043892 AAGGGATGTCAGGGAAATGTAGG + Intergenic
1034791739 7:153976838-153976860 AAGAGATGGAAGGGACATCGGGG + Intronic
1035184764 7:157117867-157117889 AAGGGAGAGAAGGGATCTGGGGG - Intergenic
1035907814 8:3532489-3532511 AGGGGAAGGTTGGGATATGGAGG - Intronic
1036718023 8:11144848-11144870 AAGGGAAGGGAGGGGTAGGGAGG + Intronic
1036959549 8:13228939-13228961 AAGTGTTGGTAAGGATGTGGAGG + Intronic
1038055646 8:23855153-23855175 AATGGATAGCAGGGGTATGGTGG + Intergenic
1038218861 8:25588602-25588624 AAGAGATGGCAAGGAAATGGGGG - Intergenic
1038518499 8:28207829-28207851 TAGGGCTGGCAGGGATAAGGGGG - Intergenic
1039889714 8:41676226-41676248 AAGTGTTGGTGAGGATATGGGGG - Intronic
1040062407 8:43115219-43115241 AAGGGATGGAAGGGATGAGGAGG - Intronic
1041216086 8:55601612-55601634 AAGTGTTGGTAAGGATCTGGAGG - Intergenic
1042113944 8:65411329-65411351 AAGGGAGGGTAGGGATGCTGAGG - Intergenic
1043982348 8:86657306-86657328 AAGGGGTGGTAAGGACCTGGTGG + Intronic
1044210926 8:89550643-89550665 AAGGGACAGTAGGTAAATGGCGG - Intergenic
1044332190 8:90933578-90933600 AAAGGGTGGTAGGGAGATGAGGG + Intronic
1050314898 9:4391222-4391244 AAGGGACAGTGGGGACATGGGGG + Intergenic
1053167203 9:35853260-35853282 AAGGGTGGGGAGGGATGTGGGGG + Intronic
1055000382 9:71442464-71442486 AAGGGAAAGGGGGGATATGGAGG + Intronic
1055377107 9:75660425-75660447 AAGCGTTGGTAAGGATGTGGAGG + Intergenic
1056008390 9:82299241-82299263 AAGAGAAGGAAGGGATATGGTGG + Intergenic
1057133769 9:92672191-92672213 CAGGGATGGTTGAGAAATGGGGG + Intergenic
1059407272 9:114108936-114108958 AAGGGAGGGAAGAGAGATGGAGG - Intergenic
1059664771 9:116436304-116436326 AAGGGATGCTTGGGATTGGGTGG + Intronic
1059866331 9:118518650-118518672 AAGAGAGGGTAGGGGTAGGGTGG - Intergenic
1060569264 9:124623181-124623203 GAAGGAAGGTAGGGATATGATGG + Intronic
1060722214 9:125986748-125986770 ATGGGATGGTGGTGATATAGGGG + Intergenic
1061062348 9:128256992-128257014 AAGGGATGGTAGGGATATGGTGG + Exonic
1062146346 9:134991923-134991945 AAGGGGTGGTGGGGGGATGGGGG - Intergenic
1185587058 X:1248281-1248303 AAGGGAGGGGAGGGGAATGGAGG + Intergenic
1186456382 X:9713145-9713167 CAGGGAAGGAAGGGAAATGGTGG + Intronic
1186601218 X:11039404-11039426 AATGGATGGTAATGATATGATGG + Intergenic
1187197115 X:17098018-17098040 AGGGCATGGTAGGGGTTTGGGGG + Intronic
1189047443 X:37608462-37608484 AAGGGATAGGAGGGATAGGCGGG + Intronic
1189524108 X:41801433-41801455 AATGAATGGTAGGGAGCTGGAGG - Intronic
1190497874 X:51044098-51044120 ATGGGATAGTTGGGATATGATGG + Intergenic
1190702226 X:52997561-52997583 AAGGGCTGGAGGGGGTATGGGGG - Intergenic
1192263959 X:69525794-69525816 AAGGAATGGTAGGAATAGTGGGG - Intronic
1192914296 X:75636792-75636814 AAGAGAGGGTAGAGACATGGAGG + Intergenic
1193546923 X:82842807-82842829 AAGGGATTGTAGAAACATGGAGG + Intergenic
1195129824 X:101840959-101840981 GAGGGGTGGAAGGGATAAGGTGG - Intronic
1195176412 X:102318864-102318886 GAGGGGTGGAAGGGATAAGGTGG + Intronic
1195182452 X:102368229-102368251 GAGGGGTGGAAGGGATAAGGTGG - Intronic
1195464929 X:105169858-105169880 TATGGATGGTAGGGATTTGGTGG + Intronic
1195841324 X:109179612-109179634 AAGGGAGAGTAGAGACATGGAGG - Intergenic
1197711022 X:129667590-129667612 AAGTGTTGGTGAGGATATGGAGG - Intergenic
1198577287 X:138024642-138024664 AAGGTGGGGTAGGGAGATGGGGG - Intergenic
1199480404 X:148292240-148292262 AAGGAATGGTAGGGAAGTGGGGG - Intergenic
1200314146 X:155113972-155113994 AAGTGTTGGTGGGAATATGGAGG + Intronic
1201581240 Y:15513572-15513594 AAGGGAGAGTAGAGACATGGAGG - Intergenic
1202273948 Y:23096651-23096673 CATGGATGGTTGGGATATGATGG + Intergenic
1202292078 Y:23324026-23324048 CATGGATGGTTGGGATATGATGG - Intergenic
1202426944 Y:24730396-24730418 CATGGATGGTTGGGATATGATGG + Intergenic
1202443847 Y:24939698-24939720 CATGGATGGTTGGGATATGATGG - Intergenic