ID: 1061062455

View in Genome Browser
Species Human (GRCh38)
Location 9:128257498-128257520
Sequence GCTGCTGGAGCTGCAGGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1537
Summary {0: 2, 1: 12, 2: 41, 3: 190, 4: 1292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061062455_1061062462 -6 Left 1061062455 9:128257498-128257520 CCAGCTCCTGCAGCTCCAGCAGC 0: 2
1: 12
2: 41
3: 190
4: 1292
Right 1061062462 9:128257515-128257537 AGCAGCTTCACCTGGAGGGAGGG 0: 20
1: 9
2: 8
3: 36
4: 340
1061062455_1061062463 -5 Left 1061062455 9:128257498-128257520 CCAGCTCCTGCAGCTCCAGCAGC 0: 2
1: 12
2: 41
3: 190
4: 1292
Right 1061062463 9:128257516-128257538 GCAGCTTCACCTGGAGGGAGGGG 0: 20
1: 7
2: 14
3: 41
4: 372
1061062455_1061062461 -7 Left 1061062455 9:128257498-128257520 CCAGCTCCTGCAGCTCCAGCAGC 0: 2
1: 12
2: 41
3: 190
4: 1292
Right 1061062461 9:128257514-128257536 CAGCAGCTTCACCTGGAGGGAGG 0: 20
1: 7
2: 9
3: 42
4: 346
1061062455_1061062459 -10 Left 1061062455 9:128257498-128257520 CCAGCTCCTGCAGCTCCAGCAGC 0: 2
1: 12
2: 41
3: 190
4: 1292
Right 1061062459 9:128257511-128257533 CTCCAGCAGCTTCACCTGGAGGG 0: 21
1: 9
2: 2
3: 36
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061062455 Original CRISPR GCTGCTGGAGCTGCAGGAGC TGG (reversed) Exonic
900013316 1:133662-133684 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
900064818 1:724646-724668 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
900095696 1:939279-939301 GCTGCTGCTGCCGCGGGAGCTGG + Exonic
900240611 1:1615723-1615745 GCTGCTGGGCCAGCGGGAGCGGG - Intronic
900359996 1:2283850-2283872 TCTGCTGGGGCTGGAGGAGGCGG + Intronic
900458611 1:2789600-2789622 GCTGGTGGTGCTGCGGGAGGAGG - Exonic
900669430 1:3841571-3841593 GCTGCTGAATCAACAGGAGCTGG - Intronic
900680747 1:3914950-3914972 GCCGCTCCAGCTGCAGGAACTGG - Intergenic
900831223 1:4967132-4967154 GCAGCTGGAGCAGAGGGAGCAGG - Intergenic
900965213 1:5952714-5952736 GCTGCTGGAGCTCCACGTCCAGG - Exonic
900978080 1:6029603-6029625 GCAGCGGGGGCTGCAGGAGCTGG - Intronic
901042290 1:6372114-6372136 GCTGCTGGAGAAGCTGCAGCAGG - Intronic
901056791 1:6452057-6452079 GCAGCTGAAGATGCAGGAGGAGG + Exonic
901089994 1:6634747-6634769 GACGCTGGACCTGCAGGAGCGGG + Exonic
901206499 1:7500599-7500621 GCTGCTGCTGCTACAGAAGCGGG - Intronic
901237589 1:7675821-7675843 GGTGATGGAACTGCAGGAGCAGG + Intronic
901628995 1:10639160-10639182 GGAGCTGGAGCTGCCGGAGGAGG - Exonic
901641499 1:10695145-10695167 GCTTCTGGAGCTGGAGGAACAGG + Intronic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901828812 1:11879786-11879808 GCTGGAGGAGCTGCAGAGGCTGG + Intergenic
901965804 1:12864775-12864797 GCTGCTGCTGCTGCAGCAGTGGG - Intronic
901965806 1:12864778-12864800 ACTGCTGCAGCAGCAGCAGCCGG + Intronic
901981204 1:13035152-13035174 GCTGCTGCTGCTGCAGCAGTGGG - Intronic
901981206 1:13035155-13035177 ACTGCTGCAGCAGCAGCAGCCGG + Intronic
902000880 1:13193774-13193796 ACTGCTGCAGCAGCAGCAGCCGG - Intergenic
902000882 1:13193777-13193799 GCTGCTGCTGCTGCAGCAGTGGG + Intergenic
902020113 1:13339478-13339500 ACTGCTGCAGCAGCAGCAGCCGG - Intergenic
902020115 1:13339481-13339503 GCTGCTGCTGCTGCAGCAGTGGG + Intergenic
902483482 1:16725233-16725255 GCTCCAGAAGCTGCAGAAGCCGG - Intergenic
902511089 1:16967474-16967496 GCCGCAGGGGCTGCAGGAGGAGG + Intronic
902511954 1:16971530-16971552 GCAGCTGGAGCTGCAGCAGGAGG + Exonic
902540680 1:17152376-17152398 ACAGCTGGAGCTGGAGCAGCAGG - Intergenic
902564890 1:17304973-17304995 GCAGCTGGAGCTGCAGGCACAGG + Intergenic
902639723 1:17759335-17759357 GCGGCACGTGCTGCAGGAGCAGG - Intronic
902814279 1:18907386-18907408 GCTGCTGGCAGTGCAGGAGCTGG - Exonic
903112681 1:21150174-21150196 GCTGCTGCTGCAGCAGGGGCGGG - Intronic
903296485 1:22346590-22346612 GCAGCTGCAGCAGCAGAAGCTGG - Intergenic
903306543 1:22417093-22417115 CCTGCTGGGGCTGAAGGGGCAGG - Intergenic
903372279 1:22844391-22844413 GCTGCTGTCTCTGCAGGGGCAGG + Intronic
903749376 1:25611244-25611266 GCTGCTTCTGCTGCAGGACCGGG + Intergenic
904014601 1:27409913-27409935 GCTGCTGGTGGTGGAGGAGGAGG + Exonic
904136287 1:28315092-28315114 GCAGCTGGGACTGCAGGCGCCGG + Intergenic
904684103 1:32248367-32248389 GCAGCGGGAGATGCAGGCGCAGG + Exonic
904998604 1:34650686-34650708 GCTGAGGGAGCTGGAGGCGCCGG - Intergenic
905172910 1:36119532-36119554 CCTGCTGCCGCTGCAGGAGGGGG + Intronic
905279885 1:36842291-36842313 GATGCTGATGCTGCAGGTGCAGG - Intronic
905393168 1:37650978-37651000 GCTGGTGGAACTGGAGGAGGTGG + Intergenic
905653004 1:39668939-39668961 CCAGGTGGAGCTGAAGGAGCAGG + Intronic
905695794 1:39972707-39972729 GCAGCAGGAGCTGCAAGACCAGG - Intergenic
905804968 1:40869615-40869637 GCTGCTGGAGAGGCTGGGGCAGG + Intergenic
905906282 1:41620630-41620652 GCTGCTGGAAATGCAGGATTGGG - Intronic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
905974339 1:42164226-42164248 GCTGTGGGAAGTGCAGGAGCTGG - Intronic
906017040 1:42591384-42591406 ACAGCTGGAGCTGTAGTAGCTGG - Intronic
906223645 1:44103403-44103425 GCTGGTGCGGCTGAAGGAGCTGG + Intergenic
906528925 1:46512216-46512238 GCCGCTGCAGCAGCAGGGGCCGG - Exonic
906775583 1:48526512-48526534 GCAGCTGCAGCGGCAGGAGGAGG + Intergenic
907188352 1:52629328-52629350 GCTTCTCCAGCTGCAGAAGCTGG + Intergenic
907401860 1:54229294-54229316 GAGGCTGGAGGTGGAGGAGCTGG + Intronic
907492502 1:54817129-54817151 GCAGCTGGAGCTGCAGGCGAAGG + Intronic
907534503 1:55137548-55137570 ACTGCTGCTGCTGCTGGAGCTGG + Exonic
907551705 1:55310379-55310401 TGTGCTGGAGCTGCAGCAGCTGG + Intergenic
907803155 1:57791686-57791708 GCTGTTGGATATGCAGGAGGTGG - Intronic
908308825 1:62854873-62854895 TCTGCTCTAGCTCCAGGAGCAGG + Intronic
908351177 1:63287068-63287090 GATCCTGGGTCTGCAGGAGCTGG - Intergenic
908395600 1:63722668-63722690 GCTGAAGGAGCTGTAGGACCTGG - Intergenic
908574948 1:65449575-65449597 GCTGCTGCAGCTGAAGGAGCTGG + Intronic
908825964 1:68132898-68132920 GCTGCTGGAGCCCCGGGAGGTGG + Intronic
908850766 1:68373499-68373521 GCTGGCGGCGCTGCTGGAGCAGG - Intergenic
908932308 1:69331713-69331735 GCGGCTGGAGCTGGAGCAGCTGG + Intergenic
909445528 1:75744280-75744302 GCTTTTGGGGCTGCAGCAGCAGG + Intronic
910090676 1:83459663-83459685 GCTGCAGAAGCTGCAGCATCTGG + Intergenic
910414361 1:86982138-86982160 ACAGCTGGAGCTGGAGCAGCTGG + Intronic
911612361 1:99970587-99970609 GCTTCTTGAGCTCCAGGTGCTGG - Exonic
911644058 1:100320164-100320186 GCAGCTGGAGCTGAAGCAGCTGG - Intergenic
912273431 1:108232394-108232416 GCTGCCAGAGGTGAAGGAGCAGG - Exonic
912294789 1:108461928-108461950 GCTGCCAGAGGTGAAGGAGCAGG + Exonic
912378132 1:109229611-109229633 GCTGCTGTCTCTGCAGGGGCGGG + Intronic
912401572 1:109397808-109397830 GCGGCAGCAGCTGCAGGAGGAGG + Exonic
912633814 1:111271925-111271947 GCTGCTGCAGCTGATGGAACTGG - Intergenic
913269107 1:117075551-117075573 GCCGCTGGTCCTCCAGGAGCAGG - Exonic
914463940 1:147909500-147909522 GCTGCTGGGGTTGGAGGAGCGGG - Intergenic
914790856 1:150876437-150876459 GCAGCTGGAGCTGAAGGCGCCGG - Intronic
914877711 1:151524736-151524758 GCAGCTGAGGCTGCGGGAGCGGG + Exonic
915127999 1:153679153-153679175 GCGGCGGCAGCAGCAGGAGCAGG - Exonic
915163415 1:153934796-153934818 GCAGCAGCAGCAGCAGGAGCAGG - Exonic
915264654 1:154708110-154708132 GCTGCTGCTGCTGCTGGCGCAGG + Exonic
915300211 1:154947419-154947441 GCAGCTGGGCCTGCAGCAGCCGG + Exonic
915472673 1:156135288-156135310 GCTTCTGGAGCTGGCTGAGCTGG - Exonic
915536710 1:156540806-156540828 GCTGCTGAAGCTCCAGGAAGAGG - Exonic
915569347 1:156735887-156735909 GCTGCTGTACCTTCAGGAACAGG + Exonic
915619865 1:157074598-157074620 GCTGGTGCGGCTGAAGGAGCTGG - Intergenic
916071842 1:161175022-161175044 GCTGCTGGCGCTGCAAGAAGGGG + Exonic
916987508 1:170207503-170207525 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
917139815 1:171824729-171824751 GCAGCTGGTGCTGCACCAGCAGG - Intergenic
918851631 1:189697368-189697390 GCTACTGGAGCGGCTGGGGCGGG + Intergenic
919092836 1:192994709-192994731 GGGGCTGGAGCAGCCGGAGCAGG + Intergenic
919371946 1:196739083-196739105 ACAGCTGGAGCTGAAGCAGCTGG + Intronic
919805742 1:201380109-201380131 GAGGCTGCAGCTGCAGGAACAGG + Intronic
919901533 1:202047407-202047429 GATGCAGGAGCTGCAGGTGAGGG - Intergenic
919924101 1:202183377-202183399 CCTGCAGGAGCTGAAGGAGGTGG + Intergenic
919924778 1:202186598-202186620 GCTGCTGCAGCAGCTGGAGGAGG + Intergenic
920032609 1:203046268-203046290 CCTGCAGGAGCTGCTGGAGGTGG + Intronic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
920513213 1:206565879-206565901 CCTCCTGGAGCTGGAGGAGATGG + Intronic
920685969 1:208109233-208109255 GCAGCTGAAGCTGATGGAGCTGG + Intronic
921348828 1:214214661-214214683 GCTGCTGGTGAAGCAGGAGGAGG - Intergenic
921850936 1:219931295-219931317 GCTGAGGAAGCTGGAGGAGCTGG + Intronic
922099723 1:222470665-222470687 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
922200174 1:223394291-223394313 GATACGGGAGCTGCAGCAGCAGG + Exonic
922261757 1:223950160-223950182 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
922414002 1:225403821-225403843 GCTGGTGGAGGTGGAGGAGCTGG - Intronic
922561179 1:226570667-226570689 GATGCTGCAGCTCCAGGTGCTGG - Intronic
922581666 1:226702967-226702989 GCTGGTGTAACTGCAGGAGGTGG + Intronic
922735323 1:227975585-227975607 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
923637156 1:235710364-235710386 GCTTCAGGAGCGGCAGCAGCAGG + Intronic
923680041 1:236111718-236111740 CCTCCAGGAGCTGCAGGCGCTGG - Intergenic
923969001 1:239178225-239178247 GCTGCTGCTGCTGCTGCAGCTGG - Intergenic
924052520 1:240092754-240092776 GCTGCTGCTGTTGCTGGAGCTGG - Exonic
924342922 1:243052332-243052354 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
924482110 1:244445141-244445163 GCTGCTGAAATTCCAGGAGCAGG + Intronic
924800905 1:247329317-247329339 GATTCTGGAGCTGCTGGTGCTGG - Exonic
1062886379 10:1019645-1019667 GCTGTGGGAGCTGCTGGAGAGGG - Exonic
1062906730 10:1184628-1184650 CAGGCTGGAGCTGCAGAAGCAGG - Intronic
1063210430 10:3875992-3876014 GCTGGAGGAGCTGGAGGAGCTGG - Intergenic
1063210432 10:3876001-3876023 GCTGGAGGAGCTGGAGGAGCTGG - Intergenic
1063210434 10:3876010-3876032 GCTGGAGGAGCTGGAGGAGCTGG - Intergenic
1063455938 10:6182721-6182743 GCAGGGGGAGCTGGAGGAGCGGG + Intronic
1063983216 10:11473276-11473298 GGTGCTGGTGAGGCAGGAGCCGG + Intronic
1064120139 10:12611369-12611391 GGTAGAGGAGCTGCAGGAGCGGG - Intronic
1064381218 10:14843389-14843411 GCTGTGGGAGCTGCTGTAGCTGG - Intronic
1065320111 10:24501518-24501540 GCTGCCGCATCTGCTGGAGCTGG - Exonic
1065540703 10:26763921-26763943 GCTGGTGGAGCTCCAGAAGGAGG + Exonic
1065818753 10:29506519-29506541 ACTGCTGGTGCTGCTGGAGCAGG + Intronic
1065917336 10:30364835-30364857 ACTGCTGGAGCTGCAGGAGCTGG - Intronic
1065954167 10:30677877-30677899 ACTGCTGGTGCTGCTGGAGCAGG - Intergenic
1066733561 10:38453220-38453242 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1067111970 10:43407554-43407576 GCAGCCGGCGCAGCAGGAGCCGG + Intronic
1067324014 10:45249182-45249204 GCAGGAAGAGCTGCAGGAGCAGG - Intergenic
1067693385 10:48518800-48518822 GCAGATGGGGCTGCAGGTGCTGG + Intronic
1067738996 10:48880858-48880880 GCTTCTGGAGATGCAGGCCCGGG + Intronic
1067839198 10:49662674-49662696 CCTGCTGGCACTGCGGGAGCTGG + Exonic
1068279990 10:54855233-54855255 GGTTCTGCAGGTGCAGGAGCAGG + Intronic
1068939004 10:62662599-62662621 GCTGAAGGAGCTGCAGGCCCAGG + Intronic
1069778338 10:70939624-70939646 GCTGCTGGAGGCACAGGGGCAGG + Intergenic
1069919432 10:71807559-71807581 TCTGCTGGTGCTGCGGGACCTGG + Exonic
1070352953 10:75611051-75611073 GCTGCTGCAGAGGCTGGAGCTGG + Intronic
1070703348 10:78619084-78619106 GCTCCTGGGGGTGCAGAAGCAGG - Intergenic
1071666916 10:87567720-87567742 GGAGCTGGAGCTGGAGCAGCTGG - Intergenic
1072260447 10:93665359-93665381 GCTGCTGAAGATTCAGGAGGTGG + Exonic
1072277055 10:93833745-93833767 ACAGCTGGAGCTGGAGCAGCTGG + Intergenic
1072280582 10:93862063-93862085 ACAGCTGGAGCTGAAGCAGCAGG - Intergenic
1072409270 10:95184872-95184894 GCAGCTGGAGTTGGAGGAGAAGG - Intergenic
1072799396 10:98382695-98382717 GCTGCTGGAACTGGAGAAGCTGG + Intergenic
1073326293 10:102645543-102645565 GCAGCTGGAGAGGCAGGACCGGG - Intronic
1073498817 10:103918112-103918134 GCTCCTGGAGCTGCAGGCGGCGG - Exonic
1073707185 10:105998261-105998283 AATCCTGGAGCTGCAGGAGCTGG + Intergenic
1073810991 10:107152067-107152089 ACAGCTGGAGCTGAAGCAGCTGG - Intronic
1074786920 10:116849611-116849633 GCTGCAGAAGCTGAAGCAGCAGG + Exonic
1074886788 10:117700217-117700239 GCTGATGGAGATGCAGATGCTGG - Intergenic
1075091512 10:119446511-119446533 TCTGCAGGGGCTGCAGCAGCTGG - Intronic
1075326188 10:121533962-121533984 GCTGTTGGACTTGCAGGAGAGGG - Intronic
1075861325 10:125679227-125679249 GCAGCTGCAGCTGCTGGTGCTGG - Intronic
1075874834 10:125797632-125797654 GCAGGTGGAGCTGGAGGGGCAGG + Intronic
1076169597 10:128308299-128308321 GCAGCTGGAGCAGCGGGGGCTGG - Intergenic
1076169600 10:128308305-128308327 GCAGCTGCAGCTGGAGCAGCGGG - Intergenic
1076697386 10:132253505-132253527 GCTGAGGGAGCTGAGGGAGCCGG + Intronic
1076741559 10:132488264-132488286 ACCCCTGGAGCAGCAGGAGCTGG + Intergenic
1076839696 10:133039963-133039985 GGGGCTGGAGCTGGAGGAGCCGG + Intergenic
1076871669 10:133197781-133197803 GCTGGTGGGGCAGCAGGGGCTGG - Intronic
1076969652 11:125866-125888 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1077011039 11:379484-379506 CCTGCTGGAGCTGGAGCTGCAGG + Exonic
1077192913 11:1262929-1262951 GCAGCTGGGGCTGCAGGTGTGGG + Intergenic
1077252267 11:1565925-1565947 GGTGCTGGACCTGCAGGGACAGG + Exonic
1077496133 11:2887193-2887215 GCAGCTGCAGCTGGGGGAGCAGG + Intergenic
1077730275 11:4722819-4722841 GCTGGTGTGGCTGAAGGAGCTGG + Intronic
1078050301 11:7960099-7960121 GCTGCTGGAGGTAAAGGAGCAGG - Exonic
1078085206 11:8229745-8229767 GATGCTGGAGCTTCAAGACCTGG - Intronic
1078142999 11:8705145-8705167 GAGGTTTGAGCTGCAGGAGCAGG - Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1078388902 11:10917910-10917932 GAGGCTGGAGCTGGAGCAGCTGG + Intergenic
1078421870 11:11219266-11219288 CCTGGTGCAGCTGCAGGATCGGG + Intergenic
1078516027 11:12023275-12023297 ACTACTGGAGCTGAAGTAGCTGG - Intergenic
1078526013 11:12102066-12102088 TCTGCGTGAGCTGCAGGAGCTGG + Intronic
1078724830 11:13920708-13920730 GCTCCTGGACCTGCTGGAGCTGG + Intergenic
1079125106 11:17713456-17713478 GCTCCTGGAGCTGTAGGGGCTGG - Intergenic
1079465294 11:20723992-20724014 ACTGCTGGAGCTGGAGCAGCTGG + Intronic
1079974733 11:27077038-27077060 GCTGCCACAGGTGCAGGAGCTGG - Intronic
1081051798 11:38350402-38350424 ACAGCTGGAGCTGCAGTATCTGG + Intergenic
1081767017 11:45618452-45618474 GTTGCTGGAGTTGCTAGAGCAGG + Intergenic
1081794624 11:45810972-45810994 GCTCCCCGAGCAGCAGGAGCAGG - Exonic
1081858038 11:46316289-46316311 GTTTCTGCAGCTGCTGGAGCAGG - Exonic
1082106720 11:48229007-48229029 GCTGCTGGTGCTGCAGGCCCAGG + Intergenic
1082162478 11:48900517-48900539 GCCGCAGGCGCTGCAGGGGCAGG + Intergenic
1082174878 11:49048510-49048532 GCCGCAGGCGCTGCAGGGGCAGG + Intergenic
1082238946 11:49852219-49852241 GCCGCAGGCGCTGCAGGGGCAGG - Intergenic
1082657697 11:55872936-55872958 GCAGCAGGCGCTGCAGGGGCAGG + Intergenic
1082797726 11:57390106-57390128 GATCCTGGAGCATCAGGAGCTGG - Intronic
1082996890 11:59262163-59262185 TCTGCTGGTGCTGCAGGCGGGGG - Intergenic
1083178919 11:60971939-60971961 GCCACTGGTGCTGGAGGAGCCGG + Intronic
1083367191 11:62148470-62148492 CCTCAGGGAGCTGCAGGAGCGGG + Exonic
1083591916 11:63900552-63900574 CCTGCAGGAGCTGCGGGAACGGG + Exonic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083721612 11:64606450-64606472 GCTGCTGGAGGAGCAGGGGTGGG - Exonic
1083756003 11:64792032-64792054 GATGCTGGAGCCGCTGGTGCTGG - Exonic
1083968146 11:66055564-66055586 GCTCTTGGAGCAGCAGAAGCGGG + Exonic
1084066217 11:66705765-66705787 CCTGCTGCAGCTGCACGAGCTGG - Exonic
1084147446 11:67272622-67272644 GCTCCGGGAGCAGTAGGAGCTGG + Intronic
1084175284 11:67419585-67419607 GCTGCTGGAGAAGCTGGAGGAGG + Exonic
1084218542 11:67664530-67664552 GCTGGTGGACGTGCAGGAGACGG - Exonic
1084269766 11:68022605-68022627 GCTGGTGGATGTGCAGGAGATGG + Exonic
1084288147 11:68145228-68145250 GGTGCTGTGGCTGTAGGAGCTGG + Intergenic
1084399205 11:68933867-68933889 GCTGTTTGAGCTGGAGGAGGAGG + Exonic
1084457768 11:69278244-69278266 CCTGCTGGAGCTGACGGAGGTGG + Intergenic
1084499359 11:69525658-69525680 GCAGCAGGATCTGCAGGTGCAGG - Intergenic
1084557359 11:69883041-69883063 GCAGCTGGAGCCCCAGAAGCTGG - Intergenic
1084563240 11:69915695-69915717 ACTGCTGAAGCGGCAGGGGCTGG - Intergenic
1084573600 11:69975022-69975044 GGGGCTGGAGCTGGAGGGGCTGG + Intergenic
1084611115 11:70203603-70203625 GCTGCTGGAGCAGAACGACCTGG + Exonic
1084611356 11:70205130-70205152 GCTGTCAGAGCTGCGGGAGCTGG + Intronic
1084652035 11:70495141-70495163 CCTGCTGCAGCCGGAGGAGCTGG - Intronic
1084654860 11:70509255-70509277 ACAGCTGGTGCTGCAGGGGCAGG - Intronic
1084730811 11:71072264-71072286 GCTGCTGGTCCTGTAGGAGCGGG - Intronic
1084791214 11:71476312-71476334 GCAGCTGGCTTTGCAGGAGCAGG + Intronic
1084804388 11:71568864-71568886 GCAGCAGGACCTGCAGCAGCTGG - Intronic
1085000313 11:73027810-73027832 ACGGCTGGAGCTGGAGCAGCTGG - Intronic
1085392940 11:76191754-76191776 GCTGCAGGAGCTGCAGGATGTGG - Exonic
1085407336 11:76271134-76271156 GGTGGTGGAGCAGGAGGAGCTGG - Intergenic
1085459991 11:76687842-76687864 GCTGCCGGATCTGCAGGTTCCGG + Intergenic
1085782675 11:79423658-79423680 ACTCCTGGAGCAGCAGGCGCAGG + Intronic
1086690897 11:89787576-89787598 GCCGCAGGCGCTGCAGGGGCAGG - Intergenic
1086697625 11:89863934-89863956 GCTGCAGGCGCTGCAGGGGCAGG + Intergenic
1086708534 11:89980554-89980576 GCTGCAGGCGCTGCAGGGGCAGG - Intergenic
1086714904 11:90052079-90052101 GCCGCAGGCGCTGCAGGGGCAGG + Intergenic
1087172830 11:95067642-95067664 GCTGCGGGACCTGGAGCAGCTGG - Exonic
1087269058 11:96092668-96092690 GCTGCTGGTGCTGCTGCATCCGG + Exonic
1087668943 11:101083105-101083127 ACAGCTGGAGCTGGAGCAGCTGG - Intronic
1087708384 11:101521268-101521290 GCAGCTGGAGCTGGAGTGGCTGG - Intronic
1087807314 11:102568996-102569018 ACAGCTGGAGCTGAAGTAGCTGG + Intergenic
1088388833 11:109290884-109290906 ACAGCTGGAGCTGGAGTAGCTGG + Intergenic
1088619863 11:111671037-111671059 GCTGGGGCAGCTGAAGGAGCCGG + Intronic
1089139895 11:116276642-116276664 GCTTCTGAAGCCGCAGGCGCTGG + Intergenic
1090465235 11:126927690-126927712 GCTGCTGAAGATTCAGGAGGTGG - Intronic
1090785201 11:130042522-130042544 GATGATGAAGCCGCAGGAGCAGG - Intergenic
1090801819 11:130177681-130177703 GCTCTTGGAGCTACAGGACCTGG + Intronic
1090806894 11:130208554-130208576 GCTGCTGGAGCTGGAGAAACCGG + Exonic
1091179370 11:133589517-133589539 TCTGGTGGAGCTGCAAGAACAGG + Intergenic
1091280783 11:134380435-134380457 ACTGACGGGGCTGCAGGAGCAGG - Intronic
1091316465 11:134617490-134617512 GCAGCTGAAGCTGGAGCAGCTGG - Intergenic
1092214617 12:6672357-6672379 GCTGCTGGAGGTGGGAGAGCTGG + Exonic
1092670520 12:10856040-10856062 ACAGCTGGAGCTGGAGCAGCTGG - Intronic
1092860084 12:12712795-12712817 GTTGCTGGGGCTACAGGTGCAGG + Intergenic
1093038120 12:14352171-14352193 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
1093547790 12:20368861-20368883 GCCGCTGACGCTGGAGGAGCCGG - Intergenic
1094036995 12:26082157-26082179 GCAGCTGGAGCTGCAGTGGCTGG + Intergenic
1094063519 12:26340166-26340188 GCTGGCGGAGCTCAAGGAGCAGG - Exonic
1094397633 12:30025104-30025126 ACTGCTGGAGATGAAGCAGCTGG + Intergenic
1094777324 12:33745746-33745768 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
1095731579 12:45511695-45511717 ACGGCTGGAGCTGGAGCAGCTGG + Intergenic
1095782729 12:46078155-46078177 AAAGCTGGAGCTGGAGGAGCTGG + Intergenic
1096084601 12:48857320-48857342 GGTGGTGGTGCTGCAGGGGCAGG - Exonic
1096148611 12:49295307-49295329 GCTGCTGGAGAAGCGGGAGCTGG - Exonic
1096195839 12:49648315-49648337 GCTGCTGGACGTGAAGGAGCTGG - Exonic
1096482117 12:51949408-51949430 GCTGATGGAGCTGACGGAGGTGG + Intergenic
1096524495 12:52202517-52202539 GAGGCTGGAGTTGGAGGAGCGGG - Intergenic
1096626189 12:52897512-52897534 GCTGGTGCGGCTGAAGGAGCTGG + Exonic
1096682978 12:53269161-53269183 CCTGCTGGAGCTGGCAGAGCTGG + Exonic
1096847478 12:54415734-54415756 GCTGTAGGACCTGTAGGAGCTGG - Intronic
1097240542 12:57572159-57572181 GCTGCAGGCCCTGGAGGAGCTGG + Exonic
1097486708 12:60212595-60212617 ACGGCTGGAGCTGGAGCAGCTGG - Intergenic
1097554041 12:61115414-61115436 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
1097558185 12:61166579-61166601 GTGGCTGGAGCTGAAGCAGCTGG + Intergenic
1097826558 12:64180095-64180117 GTTGCTGATGCTGCAGGACCAGG - Intergenic
1097955817 12:65484264-65484286 ACAGCTGGAGCTGTAGCAGCTGG + Intronic
1098264756 12:68706968-68706990 GCTGGTGCAGCTGAAGGAACTGG - Intronic
1098355637 12:69610334-69610356 GCTCCTGGAGGCGCCGGAGCTGG + Exonic
1099133518 12:78864786-78864808 GCTGCCGCTGCTGCAGGAGGAGG - Exonic
1099390180 12:82070045-82070067 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
1099487741 12:83249280-83249302 GCAGCTAGAGCTGCAGCAGCTGG - Intergenic
1100089627 12:90954362-90954384 GCTGCTGCTCCTGCTGGAGCGGG - Exonic
1100123398 12:91395090-91395112 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
1100230353 12:92600440-92600462 ACAGCTGGAGCTGGAGCAGCTGG + Intergenic
1100597902 12:96087549-96087571 ACTGCTGGAGCTGGAGTGGCTGG - Intergenic
1100981556 12:100166477-100166499 GCTGCTGGAGCTGGAGCAGGTGG - Intergenic
1101070223 12:101066751-101066773 GTTGCTGCAGCAGCAGGAGGAGG + Intronic
1101487678 12:105182135-105182157 GCTACTGGAGAGGCTGGAGCAGG - Intronic
1102262718 12:111454434-111454456 GCTGATGGAGCAGGAGGAGGAGG + Intronic
1102346373 12:112163670-112163692 GCTGCGGGAGCTGCAGAATGTGG - Exonic
1102678449 12:114674182-114674204 GCTGCTGGAGGTGGAAGGGCAGG + Exonic
1103119686 12:118371459-118371481 GCTGGAGGAGCTGGAGGGGCTGG - Intronic
1103223573 12:119267276-119267298 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
1103228633 12:119309214-119309236 CCTGGTGGAGCAGCAGCAGCTGG + Intergenic
1103471417 12:121184726-121184748 GCTGCTGCCGCTGGAGGATCCGG + Exonic
1103503444 12:121423393-121423415 GCGGCTGCAGCTGCAGGATGAGG + Exonic
1103809471 12:123602059-123602081 GCCGCTGGAGCTGCGGGAAGCGG + Intronic
1103893149 12:124254871-124254893 GCTGTTGGAGCTGAAAGAGGAGG + Intronic
1104005591 12:124890045-124890067 GATGGTGGAGCAGCAGGAGGTGG - Intergenic
1104352317 12:128055682-128055704 GCTGCTGCAGGTGCTGAAGCTGG + Intergenic
1104614223 12:130255061-130255083 GTTGCTGCGGCTGCAGGGGCAGG + Intergenic
1104624042 12:130338269-130338291 GGTGCGGGGGATGCAGGAGCCGG + Intronic
1104624055 12:130338311-130338333 GGTGCGGGAGATGCAGGAGCCGG + Intronic
1104624069 12:130338353-130338375 GGTGTGGGAGATGCAGGAGCCGG + Intronic
1104624097 12:130338437-130338459 GGTGCGGGAGATGCAGGAGCCGG + Intronic
1104624111 12:130338479-130338501 GGTGTGGGAGATGCAGGAGCCGG + Intronic
1104624124 12:130338521-130338543 GGTGCGGGAGATGCAGAAGCCGG + Intronic
1104624138 12:130338563-130338585 GGTGTGGGAGATGCAGGAGCCGG + Intronic
1104624154 12:130338605-130338627 GGTGCGGGGGATGCAGGAGCCGG + Intronic
1104624168 12:130338647-130338669 GGTGTGGGAGATGCAGGAGCCGG + Intronic
1104624184 12:130338689-130338711 GGTGCGGGGGATGCAGGAGCCGG + Intronic
1104679029 12:130736659-130736681 GTTGCTGCAGCTGCCGGTGCCGG + Intergenic
1104802541 12:131564376-131564398 GCTCCTGGAGCTGACAGAGCCGG - Intergenic
1104841622 12:131828566-131828588 GCTGCTGCTGCTGCTGGCGCTGG + Exonic
1104864020 12:131942098-131942120 GCTGCTGCAGGAGCAGGGGCAGG + Intronic
1104877269 12:132044251-132044273 GCGGCTGGAGCAGGAGGAGGCGG + Exonic
1104880464 12:132067399-132067421 GCTGCTGAAGCTGAAGCAGCAGG + Exonic
1104924699 12:132308158-132308180 GCGCCTGGAGCCCCAGGAGCTGG + Intronic
1105014042 12:132775176-132775198 GCTGCTGGTTCTGCTGGAGCAGG + Exonic
1105015487 12:132784163-132784185 GGTGCTGGAGCTGGAGGACGAGG - Exonic
1105296209 13:19089802-19089824 CTTGCTGGAGCAACAGGAGCTGG + Intergenic
1105701310 13:22937583-22937605 GCTGCTGGAGGAGGGGGAGCTGG - Intergenic
1106027465 13:25968602-25968624 GCTGGAGGAGGTGCAGGAGCTGG + Exonic
1106099938 13:26685704-26685726 GGTGCAGGAGCAGCGGGAGCAGG + Exonic
1106462225 13:29981173-29981195 GCTGCTGCAGCTGCAGAGGCTGG - Intergenic
1106662464 13:31814406-31814428 GGGCTTGGAGCTGCAGGAGCTGG - Intergenic
1106720157 13:32428019-32428041 GCTGCTGCTGCTGCTGGGGCTGG + Exonic
1106776729 13:33016497-33016519 GCTGCTGGTGCTGCTGGGCCTGG + Exonic
1107854198 13:44598528-44598550 GCAGCTGGGACTGCAGGTGCGGG + Intergenic
1108689390 13:52847827-52847849 CCTGGTGCTGCTGCAGGAGCTGG - Exonic
1108727675 13:53200585-53200607 CCTGGTGCTGCTGCAGGAGCTGG + Intergenic
1108930135 13:55807487-55807509 ACGGCTGGAGCTGGAGCAGCTGG + Intergenic
1109189557 13:59308254-59308276 ACTGCTGGAGCTGAAGCAGCTGG + Intergenic
1109494238 13:63147126-63147148 CCAGCTGGAGCTGGAGCAGCTGG + Intergenic
1110022289 13:70490582-70490604 ACAGCTGGAGCTGGAGGAGCTGG - Intergenic
1110119717 13:71866341-71866363 GCTGCTGCTGCTGCCGGTGCTGG + Exonic
1110466326 13:75806318-75806340 GCTAATGGAGCAGCAGAAGCAGG - Intronic
1110558438 13:76885932-76885954 GCAGCAGCAGCCGCAGGAGCTGG - Exonic
1110565909 13:76957325-76957347 GCTGCTGGACCAGCAGGACGTGG + Exonic
1110630139 13:77697997-77698019 GGTGAAGAAGCTGCAGGAGCTGG + Intronic
1111397085 13:87677755-87677777 GCTGCTGCTGCTGCAGGTGGTGG - Exonic
1111458062 13:88509063-88509085 ACTGCTAGAGCTACAGCAGCTGG + Intergenic
1111669903 13:91317523-91317545 GTTGCTGGAGGTGAAGGAGAAGG - Intergenic
1111688255 13:91527891-91527913 ACAGCTGGAGCTGGAGGGGCTGG + Intronic
1111986055 13:95068155-95068177 GCTGTTGGAGCTGATGGAGAGGG - Intronic
1112143468 13:96671989-96672011 GCAGATGGAGCTGGTGGAGCAGG - Intronic
1112568241 13:100569461-100569483 ACAGCTGGAGCTGCAGCAACTGG + Intronic
1112690949 13:101893276-101893298 GCAGCTCAAGGTGCAGGAGCAGG - Intronic
1113566363 13:111322070-111322092 GCTGCGAGAGCTGCAGGGCCAGG - Intronic
1113653955 13:112056845-112056867 GGGGCTGGCGCTGCCGGAGCCGG + Intergenic
1113657535 13:112077863-112077885 GCGGCAGGGGCTGCAGGGGCAGG - Intergenic
1113758631 13:112832321-112832343 GATTCTGCAGCTGCAGGCGCAGG + Intronic
1113906320 13:113820926-113820948 GCTGCTGGACCTGGACGAGGCGG - Exonic
1114140210 14:19901230-19901252 GCGGCTGGAACTGAAGCAGCCGG - Intergenic
1114147470 14:19994025-19994047 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
1114189402 14:20429378-20429400 GGTGCTGGAAGTGCAGGTGCTGG + Exonic
1114325661 14:21586637-21586659 GCCGCTGCAGCAGCAGCAGCAGG - Intergenic
1114534466 14:23414060-23414082 CCTGCTGCGGCTGCAGGACCTGG - Exonic
1114639583 14:24210453-24210475 GCTGGAGGAGCTAGAGGAGCTGG - Exonic
1115491194 14:33959983-33960005 GCTGCTGATGCTGCTGGAGCTGG - Intronic
1116098926 14:40408544-40408566 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
1116326846 14:43540959-43540981 GCTGGTGCAGCTGAAGGAGCTGG + Intergenic
1116866930 14:50038832-50038854 GATGCTGGAGTTGCATGAGCTGG + Intergenic
1116998278 14:51346891-51346913 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
1117366951 14:55038541-55038563 GCTGCTGGAGTTCTGGGAGCTGG + Intronic
1118321488 14:64755952-64755974 GCTGATGAACCTGCAGGGGCGGG - Intronic
1119003943 14:70907684-70907706 GCTGGTGCTGCTGCAGGAGGAGG - Exonic
1119470254 14:74892866-74892888 GCTTTTGGGGCTGCAGCAGCAGG - Exonic
1119472710 14:74909594-74909616 GCTGGAGGCGCTGCACGAGCAGG - Exonic
1119733922 14:76968893-76968915 GCAGCTGGTGCTGCACCAGCAGG + Intergenic
1120413778 14:84193816-84193838 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
1121310415 14:92932629-92932651 GCGGCTGGAGGGGCAGGAGGAGG + Exonic
1121318772 14:92978623-92978645 ACTGCTGGAGCTGGAGCAGCTGG - Intronic
1121524490 14:94609928-94609950 CCAGCTGGACCTGCAGGAGAGGG + Intronic
1121664921 14:95665149-95665171 CCTGCTGGGTCTGGAGGAGCAGG - Intergenic
1122130721 14:99603417-99603439 GTCGATGGAGCTGCGGGAGCCGG + Exonic
1122228402 14:100292819-100292841 GCGGCTGCAGCTGCAGGACGCGG - Exonic
1122259203 14:100502475-100502497 TCTCCTGGAGCTGGGGGAGCTGG + Intronic
1122471425 14:101969528-101969550 TCTGCTGGAGCTGGAGGTACTGG - Intronic
1122535904 14:102462655-102462677 GCTGGTGGTGCTGCTGGAGAGGG - Intronic
1123039959 14:105486452-105486474 GCTGCGGGGGCTGCGGGGGCTGG - Intergenic
1123120728 14:105915201-105915223 GCTGCTGGCTGTGGAGGAGCTGG + Intergenic
1123176273 14:106421986-106422008 CCAGCTGCAGCTGCAGGAGTCGG - Intergenic
1123473713 15:20572324-20572346 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123644296 15:22428029-22428051 GCTGCTGGAGCTGCAGGAGATGG - Intergenic
1123665605 15:22607928-22607950 GCTGCTGGAGCTGCAGCAGATGG - Intergenic
1123681783 15:22768998-22769020 GCAGATGGAGCAGGAGGAGCAGG - Intergenic
1123734013 15:23167335-23167357 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123752151 15:23364724-23364746 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1123980480 15:25597449-25597471 GCTGCTGGTGGAGCAGGAACCGG - Intergenic
1124139944 15:27068284-27068306 GATGCTCGCACTGCAGGAGCTGG + Intronic
1124284516 15:28388646-28388668 GCTGCTGGAGCTGCAGGAGATGG + Exonic
1124298181 15:28522968-28522990 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124319430 15:28702342-28702364 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124483086 15:30093089-30093111 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124489534 15:30145157-30145179 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124520497 15:30404129-30404151 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124538160 15:30562090-30562112 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124544626 15:30614151-30614173 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124564581 15:30801580-30801602 GCTGCTGGAGCTGCAGCAGATGG + Intergenic
1124618062 15:31256763-31256785 GCAGTTGTAGCAGCAGGAGCTGG + Intergenic
1124631451 15:31339860-31339882 GCTGTGGGAGATGCAGCAGCGGG + Intronic
1124753993 15:32393170-32393192 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124760493 15:32445495-32445517 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124778143 15:32603567-32603589 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124959073 15:34381829-34381851 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124975699 15:34528050-34528072 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1125298544 15:38229506-38229528 ACTGCTGGAGCTGTGGGTGCAGG - Intergenic
1125506323 15:40269806-40269828 GCTGCTGCTGCTGCAGGTGCTGG - Intronic
1125513915 15:40307545-40307567 GCTGCTGGAGCACCAGGTGGTGG - Intronic
1125726808 15:41872312-41872334 GCTGCGGGCACTGCAGGAGTTGG - Exonic
1125728865 15:41881965-41881987 GCGGCTGGAGGAGCAGGGGCGGG - Exonic
1125728869 15:41881971-41881993 GCTGCGGCGGCTGGAGGAGCAGG - Exonic
1125840978 15:42801047-42801069 GCTGGTGTGGCTGAAGGAGCTGG + Intronic
1126942109 15:53778741-53778763 ATTGCTGGAGCTGAAGCAGCTGG + Intergenic
1126963948 15:54030066-54030088 GCTGCTGCAGCAGCGGCAGCAGG + Intronic
1127299289 15:57637019-57637041 GCCTCTGAAGCTGCAGGAGGGGG - Intronic
1127361011 15:58245276-58245298 GCTCCTCTAGCTGCTGGAGCAGG - Intronic
1127426691 15:58865179-58865201 GATGCTGGAGCTGCTGGTGCTGG + Intronic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1128229774 15:66026302-66026324 GGTGCTGATGCTGCAGGACCGGG + Intronic
1128322639 15:66703747-66703769 GCGGCTGCTGCTGCTGGAGCAGG + Exonic
1128581635 15:68814512-68814534 GCTGGTGGTGCAGCAGCAGCAGG + Intronic
1128614651 15:69099653-69099675 GGTGGTGGAGCTGGTGGAGCTGG + Intergenic
1128655139 15:69455233-69455255 GCAGCTGGTGCTGCACCAGCAGG + Exonic
1129038671 15:72665980-72666002 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129169221 15:73797734-73797756 GCTGCAGGACTGGCAGGAGCGGG + Intergenic
1129203740 15:74022954-74022976 GACGCAGGCGCTGCAGGAGCAGG + Exonic
1129211220 15:74071250-74071272 GCTGCTGGAGCTGCAAGAGTTGG - Exonic
1129399183 15:75269837-75269859 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129402790 15:75294113-75294135 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129458367 15:75687695-75687717 GCTGCTGGAGGTGCAGGCCTCGG - Exonic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129530652 15:76261633-76261655 GCTGCTGTGGCGGCAGCAGCAGG + Intronic
1129597870 15:76979083-76979105 GCTGGTGCGGCTGAAGGAGCTGG + Intergenic
1129628902 15:77235839-77235861 CATGCTGGAGCTGAAGCAGCTGG - Intronic
1129667893 15:77589767-77589789 GCTGCTGGAGCCTCAAGAGTTGG - Intergenic
1129725417 15:77899170-77899192 GCTGCTGGAGGTGCAGGCCTCGG + Intergenic
1129728353 15:77915524-77915546 TCTGCTGGAGCTGCAAGAGCTGG - Intergenic
1129774191 15:78223938-78223960 AATGCTGGAGCACCAGGAGCTGG + Intronic
1129986448 15:79923430-79923452 GGTGCGGAAGCTGCAGGTGCCGG - Exonic
1130093418 15:80839492-80839514 GCTGCTGCTGCTGCGGGTGCTGG - Intronic
1130247175 15:82262613-82262635 GCTGGTGGGGCTGCTGCAGCCGG - Exonic
1130274654 15:82470094-82470116 GCTGCCGGTGATGCTGGAGCTGG - Intergenic
1130409353 15:83631643-83631665 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
1130453459 15:84080305-84080327 GCTGGTGGGGCTGCTGCAGCCGG + Intergenic
1130467000 15:84197468-84197490 GCTGCCGGTGATGCTGGAGCTGG - Intergenic
1130497264 15:84476068-84476090 GCTGCCGGTGATGCTGGAGCTGG + Intergenic
1130589298 15:85202061-85202083 GCTGCCGGTGATGCTGGAGCTGG - Intergenic
1130667940 15:85885498-85885520 GAGGCTGGAGCAGCAGGAGACGG + Intergenic
1130960980 15:88658478-88658500 GCTGGGGCAGCTGCAGGAGGAGG - Intergenic
1131054196 15:89365926-89365948 GTTCCTGGAGCTGCAGGAGGAGG + Intergenic
1131092452 15:89632918-89632940 GCGGCGGGCGCTGGAGGAGCTGG - Exonic
1131174558 15:90201662-90201684 GCAGCAGGAGCAGCAGCAGCAGG - Exonic
1131188667 15:90295321-90295343 CCTGCTGGAGATGCAGGGGCAGG + Intronic
1131466053 15:92655614-92655636 GCAGCAGCAGCGGCAGGAGCGGG + Exonic
1131723801 15:95201375-95201397 ACTGCTGGAGCTAAAGCAGCTGG - Intergenic
1131901704 15:97094891-97094913 GCTGATGAAGATGCAGGGGCGGG + Intergenic
1132092429 15:98957196-98957218 GCTGCCCGAGCCGGAGGAGCTGG + Exonic
1132111550 15:99105472-99105494 GCTGCGGGAGCTGCAGCGCCTGG + Exonic
1132135727 15:99336789-99336811 TCTGCTGAAGTTGCAGGGGCCGG - Intronic
1132303825 15:100794091-100794113 ACGGCTGGAGCTGAAGCAGCTGG + Intergenic
1132404586 15:101534785-101534807 GAGGCTGGAGATGCTGGAGCGGG + Intergenic
1132426737 15:101724327-101724349 GCGCCTGGAGCGGCAGGAGGAGG - Exonic
1132499920 16:280716-280738 GCTGCTGGAGCTGCTCCGGCTGG + Exonic
1132583129 16:694358-694380 GCTGCAGGAGCTGGAGGAGCTGG - Exonic
1132583131 16:694367-694389 CCTGGTGCAGCTGCAGGAGCTGG - Exonic
1132589732 16:721421-721443 GCCGCTGCGGCTGCAGGTGCGGG + Exonic
1132702819 16:1229299-1229321 CCTGCTGGAGCTGGAGGAGCCGG - Exonic
1132705507 16:1241569-1241591 CCTGCTGGAGCTGGAGGAGCCGG + Exonic
1132732001 16:1367259-1367281 GCAGCTGGCGCTGCAGAAGAAGG - Intronic
1132892367 16:2210578-2210600 GCTGCTGCTGCTGCTGGTGCTGG - Exonic
1132892370 16:2210587-2210609 GCAGCAGCAGCAGCAGGAGCAGG + Exonic
1132902184 16:2263158-2263180 GCTGCTAGAGCTGGAGCTGCGGG + Exonic
1133046818 16:3092670-3092692 GATCCTGGAGCTGCTGGTGCTGG - Exonic
1133053078 16:3129566-3129588 GCTGCCCATGCTGCAGGAGCTGG + Intergenic
1133054233 16:3137529-3137551 GATCCTGGAGCTGCTGGTGCTGG + Exonic
1133067455 16:3219245-3219267 GCTGCTGGGAATGCAGGCGCCGG + Intergenic
1133164553 16:3937365-3937387 GCTGCTTGAGCGGCTGAAGCGGG + Intergenic
1133203445 16:4218633-4218655 GCTGCTGGTGATGGAGGAGCAGG - Intronic
1133210419 16:4260511-4260533 GCTGCAGCAGCAGCAGGAACAGG - Exonic
1133216200 16:4293966-4293988 GCTGCTGCTGCTGCTGAAGCCGG - Intergenic
1133234427 16:4381321-4381343 GCAGCTTGAGCTCCAGGAGGCGG - Exonic
1133298148 16:4765693-4765715 GATCCTGGAGCTGCTGGTGCTGG - Exonic
1133733586 16:8596742-8596764 GCAGATGGAGCTGCTGGAGCTGG - Intergenic
1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG + Intergenic
1134172107 16:11976854-11976876 GCAGCTGGAGCGGCGGGAGCCGG - Intronic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1134613884 16:15634168-15634190 GGTCCTGGAGCTGCAGTATCCGG - Intronic
1135709276 16:24701235-24701257 GCAGGGGGAGCTTCAGGAGCTGG + Intergenic
1136153306 16:28366047-28366069 GCAGCTGGAGTTGGAGGAGAAGG - Intergenic
1136209780 16:28749220-28749242 GCAGCTGGAGTTGGAGGAGAAGG + Intergenic
1136248716 16:28989846-28989868 TCTGCGGGAGGGGCAGGAGCTGG + Intronic
1136383273 16:29906984-29907006 GCAGCTGGAGCTGGTGGGGCTGG - Exonic
1136395553 16:29990912-29990934 GCTGCGGGAGCTGGAGCAGAGGG + Intronic
1136429343 16:30187739-30187761 GCCGCTGTCCCTGCAGGAGCTGG + Exonic
1136512790 16:30749105-30749127 GCTGCTGGTGGTGCTGGTGCTGG + Intronic
1136671719 16:31864593-31864615 GCTGCTGCTGCTGCAGGAGGAGG - Intergenic
1136872499 16:33820347-33820369 ACAGCTGGAGCTGAAGTAGCTGG + Intergenic
1137299738 16:47137343-47137365 GATGCAGAAGCTGCTGGAGCTGG + Intronic
1137580596 16:49631434-49631456 GGGGCTGAAGCTGCAGGAGGAGG - Intronic
1137613493 16:49834466-49834488 TCTGCTGGAGAGGCTGGAGCCGG - Intronic
1137638537 16:50008651-50008673 GTGGCTGGAGCTGGAGTAGCTGG - Intergenic
1137668623 16:50266503-50266525 GCTGCTGCCGCTGCCGGAGCAGG + Exonic
1138130877 16:54478927-54478949 GCTGCTGGAGCTGCAGGTGTTGG - Intergenic
1138520812 16:57569924-57569946 GCTGATGGAGGTGGAGGAGATGG - Intronic
1138782655 16:59807923-59807945 GCTACTGGGGCTCCAGGATCTGG - Intergenic
1139477122 16:67208356-67208378 GCTGCGGGCCCTGCAGGAGTTGG - Exonic
1139582756 16:67883126-67883148 GCTGCAGCAGCTGCAGGATATGG - Exonic
1139593801 16:67947077-67947099 GCTGCTGGTGCTGCTGAAGCTGG - Exonic
1139849303 16:69940990-69941012 CCTCCTGGAGCTCCAGGGGCTGG - Exonic
1139853128 16:69962468-69962490 GCTGGTGGGTCTGCAGGTGCAGG - Intronic
1139882099 16:70185376-70185398 GCTGGTGGGTCTGCAGGTGCAGG - Intronic
1139890646 16:70251504-70251526 GCTGCAGGAGGCGCTGGAGCCGG - Exonic
1139930613 16:70523405-70523427 CCTGACAGAGCTGCAGGAGCTGG - Exonic
1140188862 16:72797392-72797414 GCAGCAGGAGCTGCAGCAACAGG - Exonic
1140370409 16:74410128-74410150 GCTGGTGGGTCTGCAGGTGCAGG + Intronic
1141140845 16:81495926-81495948 GCTGGGGGAGCTGGGGGAGCTGG - Intronic
1141172789 16:81701779-81701801 GCAGCGGGAGCTGAAGGAGCTGG + Exonic
1141222886 16:82088198-82088220 GCTGCTGGAGATTCTGAAGCAGG + Intronic
1141463146 16:84190146-84190168 GCTGCTGCTGCTGCTGAAGCTGG - Intergenic
1141470772 16:84236960-84236982 GCTGGAGGAGCTGGAGGAGCTGG - Exonic
1141470774 16:84236969-84236991 GCTGAGGAAGCTGGAGGAGCTGG - Exonic
1141573714 16:84950858-84950880 GCTGGTGTGGCTGCAGCAGCAGG - Intergenic
1141608718 16:85169710-85169732 GCTCCTGCTGCTGCAGGAACGGG - Intergenic
1141608720 16:85169713-85169735 GTTCCTGCAGCAGCAGGAGCCGG + Intergenic
1141755127 16:85985933-85985955 CCTGCTGGAGGTGCAAGACCAGG - Intergenic
1141967532 16:87456398-87456420 GCTGCTGGGGCTACAGGTGCCGG - Intronic
1142132581 16:88437720-88437742 GTTGCAGGAGCTGCAGGCGAAGG - Exonic
1142212548 16:88815350-88815372 GAGGCTGAAGCTGCAGGAGAGGG - Intronic
1142220674 16:88853487-88853509 GCTGCTGTGGCAACAGGAGCTGG + Intronic
1142242059 16:88952045-88952067 GCTCCTGGGGCTGCTGGGGCCGG - Intronic
1142255796 16:89013299-89013321 GGAGCTGGGGCTGCAGGAGGCGG + Intergenic
1142268248 16:89075244-89075266 GCAGCTGGAGCTGCAGGGGAGGG + Intergenic
1142302811 16:89268576-89268598 GCAGCTGAAGGTGCAGGAACTGG - Exonic
1142355936 16:89602082-89602104 GCTACAGGAGCTGCTGGAGGTGG - Intergenic
1142451024 16:90173256-90173278 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1203099673 16_KI270728v1_random:1295721-1295743 ACAGCTGGAGCTGAAGTAGCTGG - Intergenic
1142456539 17:60439-60461 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1142475110 17:184076-184098 GCTCTTGGCTCTGCAGGAGCTGG + Intergenic
1142733600 17:1879998-1880020 GCTCCTGGAGCTGGCGGAGGGGG + Intronic
1142890071 17:2937436-2937458 GAGGCTGGGGCTGCAGGAACGGG + Intronic
1142903247 17:3026400-3026422 GCTGCTGACGCTGCTGGTGCTGG - Exonic
1142938765 17:3362947-3362969 ACAGCTGGAGCTGCAGCAGCTGG + Intergenic
1143164163 17:4889667-4889689 GCAGCGGAAGCTGCAGGAGAAGG + Exonic
1143465054 17:7131063-7131085 GCTGATGGAGGTGTGGGAGCCGG - Intergenic
1143608255 17:8003155-8003177 GAAGCAGGAGCAGCAGGAGCGGG - Exonic
1143811935 17:9478873-9478895 GCTGCTGCAGCTTCAGGAATGGG - Intronic
1143842615 17:9744989-9745011 GCTGCCTCTGCTGCAGGAGCTGG + Intergenic
1143898610 17:10156550-10156572 GGTGCAGGAGCTGCAGGAGAAGG - Intronic
1144122218 17:12165998-12166020 ACAGCTGGAGCTGTAGCAGCAGG + Intergenic
1144439323 17:15267156-15267178 GCTGCTGGAGATGGAGGACCTGG - Intergenic
1144605209 17:16658621-16658643 GCGACTGGAGCTGCAGCAGCTGG + Intergenic
1144675871 17:17161284-17161306 TCAGCTGGTCCTGCAGGAGCCGG - Exonic
1144702118 17:17346857-17346879 GGGGCTGCAGCTGCAGGTGCTGG - Exonic
1144733369 17:17541325-17541347 GCTGGAGGAGCTGAAAGAGCTGG - Intronic
1144751821 17:17653988-17654010 GACGCTGGAGCTGGAGCAGCTGG + Intergenic
1144872861 17:18381390-18381412 CCTGCTGGTGCTGCAGGGCCTGG - Exonic
1145098622 17:20054307-20054329 GCTGCAGGAGAGACAGGAGCTGG - Intronic
1145722807 17:27089083-27089105 GCGGCTGGAGCGGTAGGAGAAGG - Intergenic
1145772212 17:27501594-27501616 ATTGCTGGAGCTGGAGCAGCTGG - Intronic
1145993024 17:29090531-29090553 GAAGCAGGAGCTGCAGGAGAAGG - Exonic
1147318846 17:39633962-39633984 GCTGGGGGAGCTTCGGGAGCTGG + Exonic
1147325019 17:39665941-39665963 GCTTCAGGAGCTGCTGGCGCTGG + Exonic
1147512627 17:41084451-41084473 GCAGCTGGGGCGGCAGCAGCTGG - Exonic
1147513866 17:41097683-41097705 GCAGCTGGAGATGCTGCAGCTGG + Exonic
1147513882 17:41097773-41097795 GCAGCTGGGGCGGCAGCAGCTGG + Exonic
1147514365 17:41101871-41101893 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147514832 17:41105843-41105865 GCAGCTGGAGATGCTGCAGCTGG - Exonic
1147515961 17:41117884-41117906 GCAGCTGGAGATGCTGCAGCTGG + Exonic
1147515978 17:41117989-41118011 GCAGCTGGAGATGCAGCATCTGG + Exonic
1147515994 17:41118094-41118116 GCAGCTGGAGATGCAGCATCTGG + Exonic
1147516584 17:41123673-41123695 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147517952 17:41140041-41140063 GCAGCTGGAGATGCAGCAGCTGG + Exonic
1147517968 17:41140146-41140168 GCAGCTGGAGATGCTGCAGCTGG + Exonic
1147518887 17:41149378-41149400 GCAGCTGGAGATGCAGCAGCTGG + Exonic
1147520488 17:41167756-41167778 GCAGCTGGAGATACAGCAGCTGG + Exonic
1147521535 17:41177970-41177992 GCAGCTGGGGCTGCAGCAGGTGG + Exonic
1147597685 17:41727369-41727391 GCTGATTGAGATGCAGGAGGAGG - Intronic
1147597868 17:41728212-41728234 GCTGCTGCAGCTTCAGCACCTGG + Exonic
1147670100 17:42171929-42171951 GCTGCGGCTGCTGCAGAAGCTGG - Exonic
1147679015 17:42227600-42227622 GGTGCAGGAGCTGCAGAAGAAGG - Exonic
1147686647 17:42289929-42289951 GGTGCAGGAGCTGCAGAAGAAGG + Exonic
1147768905 17:42854548-42854570 GCTGCTGGAGATGGAGGAGCAGG + Exonic
1147793072 17:43025265-43025287 GCGGCTGCAGTTGCAGGGGCGGG + Exonic
1148105951 17:45118959-45118981 GCTGCTGAAGCGGCCGGAGCTGG - Exonic
1148164760 17:45475596-45475618 GAAGCTGCTGCTGCAGGAGCAGG - Exonic
1148195059 17:45707275-45707297 GAGGCTGGAGCTGGATGAGCAGG + Intergenic
1148225222 17:45894571-45894593 GCTGCTGTTGGTGCCGGAGCTGG - Exonic
1148464712 17:47857928-47857950 GCTGCTGGAGTTGGGGGAGGTGG - Intergenic
1148655259 17:49278398-49278420 GCTGCTCACACTGCAGGAGCTGG + Intergenic
1148675805 17:49444247-49444269 GCTGGTGGAGCTGCAGTAAAGGG + Intronic
1148686531 17:49504044-49504066 GCAGCTGGAGGTGGAGGAGGGGG - Intronic
1148774467 17:50087889-50087911 GCTGGTGGAGGTCCCGGAGCAGG - Intronic
1148839311 17:50484501-50484523 GGTGCAGGAGCTGCTGGAGCGGG + Exonic
1149072186 17:52556372-52556394 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
1149386361 17:56146644-56146666 GTGGCTGGAGCTGAAGCAGCTGG + Intronic
1149575007 17:57705592-57705614 GCTGCTTGAGCTGAAGGAAGAGG - Intergenic
1149598579 17:57878561-57878583 TGTGCTGGGGCTGCTGGAGCTGG - Intronic
1150265471 17:63829871-63829893 GCTACAGCTGCTGCAGGAGCAGG + Exonic
1150302188 17:64055867-64055889 GCTGCTGCTGCTGCAGGAGCTGG + Exonic
1150395979 17:64822263-64822285 GAAGCTGCTGCTGCAGGAGCAGG - Intergenic
1150760846 17:67959637-67959659 GCTGGAGGGGCTGGAGGAGCTGG - Exonic
1151045651 17:70917164-70917186 GGAGCTGGAGCTGGAGCAGCTGG - Intergenic
1151045926 17:70919469-70919491 GGAGCTGGAGCTGGAGCAGCTGG - Intergenic
1151297540 17:73196494-73196516 GCTGCTGTGGCTGCAGGGGAAGG - Exonic
1151561622 17:74872912-74872934 GCTGCTGGCGCTGGTGGGGCTGG - Exonic
1151565129 17:74893442-74893464 GCTGCGGGAGCTGGAGGTGCTGG - Exonic
1151580143 17:74972831-74972853 GCGGCGGGCGCTGCAGGTGCAGG - Intronic
1151709844 17:75797695-75797717 GCAGCAGGAGCTGCAGGAACAGG + Intronic
1151723712 17:75872990-75873012 GCTGCTGAGGCTGCTGGGGCTGG + Intergenic
1151746628 17:76015100-76015122 TCCGCTGGCGCTGCAGGAGGAGG + Exonic
1151748387 17:76023609-76023631 CCTGCTGGTGCTGCAGGGCCTGG + Exonic
1151969556 17:77450723-77450745 GAGGCTGGAGAGGCAGGAGCTGG + Intronic
1152021175 17:77781159-77781181 ACTGCTGGAGTTGGAGGGGCAGG - Intergenic
1152152278 17:78609609-78609631 GCTTCTGTGGCTGTAGGAGCTGG - Intergenic
1152218447 17:79047950-79047972 GATGCTGGAGCTGCGAGAGCAGG + Exonic
1152222189 17:79074992-79075014 GCGGCGGCAGCTGCAGGGGCTGG + Exonic
1152279109 17:79374988-79375010 GCTGGTGGAGCGGCAGGGGAAGG - Intronic
1152317253 17:79588416-79588438 GCTCCTGGAGTGGCAGGAGGAGG - Intergenic
1152554484 17:81046101-81046123 GCAGCTGGGCGTGCAGGAGCCGG - Intronic
1152586647 17:81192347-81192369 GCAGCTGGAGCTGGAGAGGCAGG - Exonic
1152587092 17:81193972-81193994 GCTGCGGGAGCAGCTGGAGCGGG - Exonic
1152662164 17:81547546-81547568 GGTGCTGGTGGTGCAGGAGATGG + Exonic
1152677901 17:81651094-81651116 CCACCTGGAGCTGCACGAGCTGG - Exonic
1152730644 17:81967977-81967999 GCCGCTGTTGCGGCAGGAGCAGG - Intergenic
1152749152 17:82054603-82054625 GCTGCTGAAGCTGGAGAAGCTGG + Exonic
1152775854 17:82201578-82201600 GCTGCAGCAGCAGCAGCAGCTGG - Exonic
1152799081 17:82322769-82322791 CCTGCTGGGGCTCCAGGAGAGGG - Intronic
1152919640 17:83059530-83059552 GGTGGTGGATCTGCAGGTGCTGG - Intergenic
1152986418 18:325526-325548 CCTGCTAGACCTGCGGGAGCCGG - Intronic
1153429341 18:4999078-4999100 GCTGCTGGGGATGAAGGAGGGGG - Intergenic
1153447071 18:5186039-5186061 GCAGCTGGAGCTGTAGGAGCTGG + Intronic
1153757870 18:8301971-8301993 GCTGCCGGAGCAGCGGGAGTGGG + Intronic
1153988568 18:10374926-10374948 GGTGCTGGAGCTGGGAGAGCAGG + Intergenic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1154060676 18:11056705-11056727 GCTGCTAGACCTTCAGGAGAAGG + Intronic
1155037815 18:22039980-22040002 GATCCTGGAGATGCAGGAGAGGG - Intergenic
1155086397 18:22463372-22463394 GCATGTGGAGCTACAGGAGCAGG - Intergenic
1155086886 18:22467599-22467621 GTTGCAGGAGCAGCAGGAGGGGG + Intergenic
1155526084 18:26717424-26717446 GCAGCGGAAGCAGCAGGAGCTGG + Intergenic
1155544780 18:26903808-26903830 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
1155588816 18:27400756-27400778 GGTGCTGGAGGTGAAGGAGATGG + Intergenic
1156008580 18:32470973-32470995 GCCGCGGGAGCTGCGGGAGGCGG - Intergenic
1156253437 18:35374001-35374023 GATCCTGGAGCTGCTGGTGCTGG - Exonic
1156270019 18:35522035-35522057 GCTGCTGGAGTGGCAGGAAGGGG + Intergenic
1157063506 18:44320881-44320903 GCTGATGCAGCTGAAGGAGCTGG + Intergenic
1157131242 18:45009234-45009256 GCAGCTGCAGCAGCAGGTGCTGG + Intronic
1157279093 18:46334164-46334186 GCTGCGGGAGCCGCCGGGGCGGG - Intronic
1157289585 18:46400125-46400147 AGAGCTGGAGCTGGAGGAGCAGG - Intronic
1157461241 18:47896671-47896693 GCTGGTGGGTCTGGAGGAGCAGG - Exonic
1157479035 18:48040978-48041000 GCTCCTGGTGGTGCAGGAGCAGG - Exonic
1157721846 18:49931410-49931432 GCTGTTGGAGCTGGAGGAGTCGG - Intronic
1157754072 18:50202951-50202973 ACTGCTGAAGCTGCAGAGGCTGG - Intergenic
1157764379 18:50285919-50285941 GCTGGTGATGCTGCAGGAGGGGG + Exonic
1157867095 18:51196930-51196952 CCTGCTGGAGGAGGAGGAGCTGG - Exonic
1158016571 18:52791039-52791061 GATGGTGGAGATGGAGGAGCTGG + Intronic
1158666461 18:59437274-59437296 GCTGCTGTAGCAGCAGTTGCGGG - Intronic
1159265262 18:66071960-66071982 GTGGCTGGAGCTGGAGCAGCTGG - Intergenic
1160086802 18:75783889-75783911 TCATCTGGAGCTGCAGGAGTCGG - Intergenic
1160345548 18:78129116-78129138 ACTGCTGGAGCCCCAGAAGCTGG + Intergenic
1160419102 18:78732007-78732029 GCTGCTGTGGCAGCTGGAGCAGG - Intergenic
1160443579 18:78911537-78911559 GGGGCTGGAGCTGGAGGACCTGG - Intergenic
1160443609 18:78911620-78911642 GGGGCTGGAGCTGGAGGACCTGG - Intergenic
1160493167 18:79354768-79354790 GCAGCTGGAGCTGAAGGAGCCGG + Intronic
1160497464 18:79383722-79383744 GGGGCTGGAGCTGCAGGCTCTGG - Intergenic
1160510311 18:79449787-79449809 GGTCCTGGGGCTGCAGGAGTGGG + Intronic
1160526190 18:79539533-79539555 GCAGCTGCAGCTGCTGGAGGAGG - Intergenic
1160646457 19:195792-195814 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1160701091 19:507773-507795 GCTGCTGCTGCAGCAGGAGCTGG - Exonic
1160748819 19:724097-724119 GCTTCTGGAGCTGCAGGGCGAGG + Intronic
1160790423 19:920394-920416 GTTCCTGGTGCTGCAGGCGCTGG + Exonic
1160792617 19:929555-929577 GCTGTTGCAGCGGCAGCAGCGGG + Exonic
1160810067 19:1009407-1009429 GCCCGGGGAGCTGCAGGAGCTGG + Exonic
1160818333 19:1046540-1046562 CCTGCTGCAGCGGGAGGAGCAGG + Intronic
1160972053 19:1773877-1773899 GCTGCTGGAGCAGGAAGAGCAGG + Intronic
1161077182 19:2291527-2291549 GCTGCCCGCGCTGGAGGAGCTGG - Exonic
1161101783 19:2425137-2425159 GCTGCTGGAGCTGGCGGGGCCGG + Exonic
1161384285 19:3982750-3982772 GCAGCGGGATCTGCAGGAGCCGG - Intronic
1161483375 19:4521891-4521913 CCTCCTGGTCCTGCAGGAGCTGG - Intergenic
1161483738 19:4523818-4523840 GCTGCTGGAGCTGGTGGTGCAGG - Exonic
1161484010 19:4525106-4525128 GCTGGGGGAGCTGGGGGAGCTGG + Intronic
1161484133 19:4525632-4525654 GCTGCAGGAGACGCTGGAGCTGG - Exonic
1161953833 19:7482205-7482227 GCTCCTGGTCCTGCAGGAGGAGG - Exonic
1162100356 19:8335187-8335209 GCTGCCCGAGCTGCAGGAGCAGG - Exonic
1162336178 19:10061936-10061958 GCTACTAGAGAAGCAGGAGCTGG + Intergenic
1162453611 19:10769308-10769330 GGTGCTGGAGCCGCAGGTCCTGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162523093 19:11193464-11193486 GCTGCGGCAGCTGGAGGAGCAGG - Exonic
1162535487 19:11261318-11261340 GCTGCTTGAGATGCGGGAGGTGG - Intronic
1162551793 19:11362103-11362125 GCTGTAGGAGCTGTAGGAGGTGG - Intronic
1162904961 19:13817894-13817916 GCTGCTGGCCCTGCTGGAGGAGG + Exonic
1162935045 19:13978068-13978090 CCTGCTGGAGCTGCTGCACCTGG + Exonic
1163128400 19:15256963-15256985 GCTGGCTGAGCTCCAGGAGCAGG - Exonic
1163287113 19:16355758-16355780 GCGGCTGCGGCGGCAGGAGCAGG - Exonic
1163314005 19:16530656-16530678 TCTCCCAGAGCTGCAGGAGCTGG + Exonic
1163484394 19:17577408-17577430 GCTGCGGGCGCTGCAGGCACAGG + Exonic
1163702029 19:18790843-18790865 GCTGCTGCGGCAGCAGGTGCGGG - Exonic
1163722747 19:18905990-18906012 TCTGCTGCAGGTGCAGGTGCAGG - Intronic
1163766267 19:19165122-19165144 GGTGCTGGGGATGCAGGAGCAGG + Intronic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1164317199 19:24101653-24101675 CCTGGTGGAGCTGCAGAACCTGG - Intronic
1164594853 19:29526130-29526152 GCTGCGGGAGCCGAAGGAGGTGG + Intergenic
1164602732 19:29574177-29574199 GCAGGTGGAGGTGCAGGGGCGGG - Intergenic
1165284174 19:34825467-34825489 GATCCTGGAGCTGCTGGTGCTGG + Intergenic
1165636467 19:37344391-37344413 GATGCTGGTGCTGCAGGTTCAGG + Intronic
1165683868 19:37801136-37801158 GCGGCTGGAGCTGCAGCCTCTGG - Intronic
1165860677 19:38907613-38907635 GCTACTGCTGCTGCAGGGGCCGG - Exonic
1166091552 19:40512664-40512686 CCTGGCGGAGCTGCAGGAGCAGG + Exonic
1166213970 19:41323895-41323917 TCTGCTGGGGGAGCAGGAGCCGG - Exonic
1166253912 19:41589136-41589158 TCAGCTGGGGCTGGAGGAGCAGG - Intronic
1166299120 19:41904241-41904263 GGCGCTGGAGCAGCAGCAGCAGG - Exonic
1166326050 19:42051824-42051846 GCGGCAGGAGGGGCAGGAGCTGG - Intronic
1166331171 19:42078873-42078895 GCTCCTGGTGCTCCAGGAGCTGG - Exonic
1166409642 19:42547907-42547929 TCAGCTGGGGCTGGAGGAGCAGG + Intronic
1166545745 19:43634185-43634207 GCTCCCTGAGCTTCAGGAGCGGG - Intronic
1166677256 19:44747714-44747736 GAGGCCGGTGCTGCAGGAGCGGG - Intronic
1166748340 19:45152510-45152532 GCTGCAGCAGCAGCAGCAGCAGG - Exonic
1166748341 19:45152513-45152535 GCTGCTGCTGCTGCTGCAGCAGG + Exonic
1166748368 19:45152699-45152721 GCTGCTGGCGGTGCAGGCGCAGG - Exonic
1166862174 19:45816875-45816897 GCTGCTGGGGCGGCAGCTGCAGG + Exonic
1166892655 19:46003099-46003121 GGTGCTGGAGCTGGAGGTGGAGG + Exonic
1166898070 19:46036441-46036463 GCAGCTGCAGCTGCAGGGGCAGG - Intergenic
1167145998 19:47681072-47681094 GCTGCTGGAGGCCCAGGGGCAGG - Exonic
1167217104 19:48171847-48171869 GGAGCAGGAGCTGCGGGAGCGGG + Exonic
1167233073 19:48297500-48297522 GCAGGTGGAGCTCCAGGAGCAGG - Exonic
1167233973 19:48302790-48302812 GCTGCAGGAGCAGCAGCAGAAGG - Exonic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167376355 19:49114413-49114435 GCTGGTGGAGCCGCTGGGGCTGG + Exonic
1167569288 19:50276871-50276893 GCTGGCGGAGCAGCTGGAGCAGG + Exonic
1167569531 19:50278211-50278233 GCTGCAGGAGGTGCAGGGCCGGG + Exonic
1167589945 19:50398998-50399020 GCTGCAGGAGCAGGAGGAGGAGG + Exonic
1167702690 19:51059933-51059955 GCTTCTGGAGCTGCAGTCCCCGG - Exonic
1168189763 19:54729559-54729581 GCTCCGGGAGCTGCAGGACAAGG - Exonic
1168191767 19:54743861-54743883 GCTCCGGGAGCTGCAGGACAAGG - Exonic
1168194042 19:54760498-54760520 GCTCCGGGAGCTGCAGGACAAGG - Intronic
1168196086 19:54775231-54775253 GCTCCGGGAGCTGCAGGACAAGG - Exonic
1168197984 19:54790091-54790113 GCTCCGGGAGCTGCAGGACAAGG - Intronic
1168322611 19:55518839-55518861 GCTGCTGGGGCTGACGCAGCTGG + Exonic
1168412209 19:56147085-56147107 GATGTTGGAGCTGCTGGTGCTGG + Exonic
1168642214 19:58038064-58038086 GATGCTGGAGCTGCTGGTGCTGG + Exonic
1168645861 19:58059141-58059163 GCTGCTGGAGCTGGAGTGACTGG - Intergenic
1168650633 19:58089985-58090007 GATGCTGGAGCTGCTGGTGCTGG - Exonic
1168666210 19:58207060-58207082 GATCCTGGAGCTGCTGGTGCTGG + Exonic
1168683663 19:58335063-58335085 GATACTGGAGCTGCTGGTGCTGG + Exonic
1168707306 19:58477410-58477432 GATGCTGGAGATGCTGGTGCTGG + Exonic
1168724079 19:58571122-58571144 GATGCTGGAGCTGTTGGTGCTGG - Exonic
925191949 2:1892238-1892260 GCTGCTGGTGCTGCTGCTGCTGG + Exonic
925268722 2:2586579-2586601 GCAGGAGGAGCTGGAGGAGCCGG + Intergenic
925354390 2:3227771-3227793 ACAGCTGGAGCAGCAGCAGCTGG - Intronic
925725209 2:6865390-6865412 GCAGCTGGTGCAGCAGGCGCTGG + Exonic
925845304 2:8028500-8028522 TCTGCCACAGCTGCAGGAGCTGG + Intergenic
926149188 2:10415298-10415320 ACTGCGGGAGCTGGAGGGGCTGG + Intronic
926153867 2:10439802-10439824 AACGCTGGAGCTGCAGGAGGAGG - Intergenic
926330192 2:11818098-11818120 GCTTCTGCAGCTGTGGGAGCTGG - Intronic
927140870 2:20130002-20130024 GCTGCTGTAGGTGCAGCAGAAGG - Intergenic
927384329 2:22515730-22515752 GCAGCAGGAGCTGGAGGAGAAGG - Intergenic
927419227 2:22912611-22912633 GCAGCTGGAGCGCCAGAAGCAGG + Intergenic
927682598 2:25149799-25149821 CCTGCTGCATCTGCAGGAACAGG - Intronic
927872395 2:26631884-26631906 AGAGCTGGAGCTGCAGAAGCTGG - Intronic
927881531 2:26692992-26693014 GCGGCTGGAGCTGCGGCAGCAGG + Exonic
927919910 2:26964260-26964282 GCAGATGGAGATGCAGAAGCTGG + Intergenic
927980447 2:27371322-27371344 GCTCCTGGGGCTGCACGAGCAGG + Exonic
928249506 2:29662624-29662646 GTTGTTGTAACTGCAGGAGCTGG - Intronic
928537048 2:32251137-32251159 GCTGCTGAAGCTGCGGCAGAGGG - Exonic
929326431 2:40616954-40616976 ACAGCTGGAGCTGAAGCAGCAGG - Intergenic
929600172 2:43199774-43199796 GGGGCTGGAGAAGCAGGAGCTGG + Intergenic
929604366 2:43225380-43225402 TCTGCTGCTGCTGCAGGTGCAGG + Exonic
929678534 2:43964891-43964913 GGTGCTGGAGCTGCAGGCAGTGG + Intronic
929687800 2:44049361-44049383 ACTGCTGAAGCAGCGGGAGCTGG + Intergenic
929819459 2:45261651-45261673 TCAGCTGAAGCTGCAGGGGCTGG + Intergenic
930021345 2:47003868-47003890 GCTGCTGGAGGTGGTGGAGTGGG + Intronic
932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG + Exonic
932812805 2:74838301-74838323 GCTGCAGGAAGTGGAGGAGCTGG + Intronic
933220640 2:79683744-79683766 GTTGCAGGAGCTGCAGGTGCTGG + Intronic
933526319 2:83444851-83444873 GCTGCTGAAGCTGAGGGAGCAGG - Intergenic
933776375 2:85773622-85773644 GCTGCTGGGGCTTCTGGATCTGG - Intronic
933833299 2:86227367-86227389 GCTGCTCCACCTGCAGGACCTGG - Intronic
933985798 2:87591301-87591323 ACAGCTGGAGCTGTAGCAGCTGG - Intergenic
934118230 2:88815671-88815693 ACTGCTGGAGCTGGAGCAGCTGG - Intergenic
934588599 2:95526961-95526983 GCTGCAGGCACTGCAGGGGCAGG - Intergenic
935314255 2:101815994-101816016 GCCGCTGCAGCTGCAGTCGCAGG - Intronic
935634841 2:105242371-105242393 GCTGGTGGAGGTGCCGGCGCGGG + Exonic
935797950 2:106663792-106663814 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
936014534 2:108947681-108947703 GCAGCTGGAGCTGGAGTGGCTGG + Intronic
936153067 2:110032175-110032197 GCTGGAGGAGCTTTAGGAGCAGG - Intergenic
936161783 2:110088948-110088970 GCTGCTGGAGCTGGGGCAGCCGG - Intronic
936182880 2:110282406-110282428 GCTGCTGGAGCTGGGGCAGCCGG + Intergenic
936191613 2:110339237-110339259 GCTGGAGGAGCTTTAGGAGCAGG + Intergenic
936308044 2:111359503-111359525 ACAGCTGGAGCTGTAGCAGCTGG + Intergenic
937264098 2:120605361-120605383 GCGCCTGGAGGTGCAGGAGTTGG - Intergenic
937449777 2:121992606-121992628 GATGCTGGAGGTGCTGGAGGAGG + Intergenic
937995446 2:127690811-127690833 CCAGCTGGAGCTGGAGCAGCTGG + Intergenic
938305473 2:130251650-130251672 TCTGCTGCAGCTGCTGGGGCAGG - Intergenic
938337099 2:130510145-130510167 GGAGCTGGGGCTGGAGGAGCTGG + Intergenic
938352738 2:130610586-130610608 GGAGCTGGGGCTGGAGGAGCTGG - Intergenic
938380599 2:130834373-130834395 GCTGCTGCCGCTGCCGTAGCCGG + Intergenic
938598259 2:132811439-132811461 GCTGCTGCTGCTGTAGGAGATGG + Intronic
938718187 2:134040001-134040023 ACAGCTGGAGCTGGAGCAGCTGG + Intergenic
938907654 2:135854095-135854117 GCAGCTGGAACTACAGGTGCAGG - Intronic
939667089 2:144965428-144965450 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
939688042 2:145223871-145223893 TCAACTGGAGCTGCAGGGGCTGG - Intergenic
939977635 2:148737456-148737478 GTTGCTGGAGATGGAGGAGTGGG + Intronic
940533130 2:154905023-154905045 ACGGCTGGAGCTGAAGCAGCTGG + Intergenic
940647082 2:156402967-156402989 GCTGGTGGAACTGAGGGAGCAGG + Intergenic
941360966 2:164550975-164550997 TTTGCTGGAGCTGCTGGAACTGG + Intronic
941525203 2:166598160-166598182 ATTGCTGGAGCTGGAGCAGCTGG + Intergenic
941666370 2:168247311-168247333 GCCGCGGGAGCTGCCGGGGCCGG + Exonic
941819165 2:169827657-169827679 GCTGCAGGCGCTGCTGGAGCGGG + Exonic
942465231 2:176201020-176201042 GCAGCTGGTGCTGCACCAGCAGG - Intergenic
942558703 2:177198447-177198469 GCTGCTGTGGCTGAAGGAGCTGG - Intergenic
942791828 2:179769507-179769529 GCTGCTGTTGCTGCTGGGGCTGG + Exonic
942792806 2:179779999-179780021 GCTGCTGGGGTTGGAGGAGAGGG + Intronic
943064380 2:183071124-183071146 GCTGATGCAGCTGAAGGAACTGG + Intergenic
943124753 2:183782627-183782649 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
943183983 2:184581582-184581604 CCTGATAGAGCTGAAGGAGCTGG + Intergenic
943352002 2:186806553-186806575 GTTGCTGCAGCTGCAGTCGCTGG + Intergenic
943553571 2:189372083-189372105 GCAGCTGGAGCTGGAGCAACTGG - Intergenic
944128157 2:196317580-196317602 GCAGGGGAAGCTGCAGGAGCGGG - Intronic
944477940 2:200126018-200126040 GGAGCTGGAGCTGAAGCAGCTGG + Intergenic
944772200 2:202925750-202925772 GCTGCTTGAGTAACAGGAGCTGG + Intronic
944772237 2:202925995-202926017 GCTGGTGCAGCTGAAGGAGGTGG - Intronic
945395232 2:209307813-209307835 GCAGCTGGGGCTGCAGAACCAGG - Intergenic
945796806 2:214374635-214374657 GCTTTTGGGGCTGCAGGTGCAGG - Intronic
945871937 2:215236464-215236486 GCTGCTTGGGCTGCTGGGGCAGG + Intergenic
945952359 2:216051522-216051544 CATTCTGGAGCTGCAAGAGCAGG - Exonic
945978263 2:216287323-216287345 AATGCTGGAGCCGCAGTAGCTGG - Intronic
946253897 2:218429804-218429826 TCTGATGGAGCTGGAGGTGCTGG - Intronic
946291673 2:218750113-218750135 GCTGCTGCAGCTGCTGGGGCTGG - Exonic
946295679 2:218782006-218782028 GACGCGGGAGCTGCAGGAGAGGG - Exonic
946320826 2:218953489-218953511 GCTGGTGCAGCTGAAGGAGCTGG + Intergenic
946415437 2:219537715-219537737 GCTTCAGGAGCTGAAGGAACAGG + Exonic
946692269 2:222318987-222319009 GGGGCTGGAGGTGCAGGCGCCGG + Intergenic
946805021 2:223463271-223463293 CCAGCTGGAGCTGAAGTAGCTGG - Intergenic
947740685 2:232483505-232483527 GCTGCTGCACCTGCAGGGTCAGG + Exonic
947873657 2:233453781-233453803 GCTGGGGGAGCTGCAGGAGCAGG + Intronic
948456408 2:238106525-238106547 GCTGCTCCAGCAGGAGGAGCTGG - Intronic
948464608 2:238146159-238146181 CTTGCTGTAGCTGCAGGTGCTGG - Intronic
948477224 2:238227826-238227848 GTCGCTGGCGCTGCAGAAGCTGG + Intronic
948482149 2:238256965-238256987 GCTGCTGTAGCTGCACTGGCTGG + Exonic
948585347 2:239015634-239015656 GCTCATGGCCCTGCAGGAGCTGG + Intergenic
948660161 2:239501974-239501996 AGTGCTGGAGCAGAAGGAGCTGG - Intergenic
948746123 2:240095571-240095593 GGTGCAGGAGCTGCGGGTGCAGG + Intergenic
948746191 2:240095795-240095817 GGTGCAGGAGCTGCGGGTGCTGG + Intergenic
948766857 2:240226904-240226926 GGTGCAGGAGCTGCAGGCCCGGG - Intergenic
948775737 2:240287986-240288008 GCTGAGGGAGGTGCTGGAGCTGG - Intergenic
948863237 2:240763018-240763040 CCTGCTGGAGCAGCAGCGGCTGG - Exonic
948899455 2:240949036-240949058 GCTGCAGGAGCAGCTGGAGGAGG + Intronic
948902970 2:240965455-240965477 GGTGCTGGAGCTGCGGAGGCAGG + Intronic
948907605 2:240987146-240987168 GCTGCTGGGGGTGGAGGAGCAGG + Intronic
948929002 2:241118877-241118899 GCTCCTGGACCCGCAGCAGCTGG + Intronic
949001354 2:241615994-241616016 GCTGCTCCAGCTGCAGGACTGGG - Intronic
1169059768 20:2652883-2652905 GCTGCTGGCGCTGAAGGAAGTGG + Exonic
1169068642 20:2708316-2708338 GCTGCTGGGGTTGCGGGAACAGG + Intronic
1169091254 20:2862605-2862627 CCTGCGGGAGATCCAGGAGCTGG + Exonic
1169193303 20:3670927-3670949 TCTGCTGGGGCTGTGGGAGCTGG - Intronic
1169196629 20:3686543-3686565 GCTGCTGAAGCTGCAGCTACTGG - Intergenic
1169498004 20:6133244-6133266 GCTGCTGGAGCCTCACGACCTGG + Intergenic
1170595222 20:17800406-17800428 ACTGCTGGAGCTGCCAGAGCAGG + Intergenic
1170617783 20:17968386-17968408 GTTGCTGCAGCAGCAGGAGGAGG - Exonic
1170938529 20:20829947-20829969 GTGGCTGGAGCTGGAGCAGCTGG - Intergenic
1171087072 20:22247341-22247363 GATGCTGGAGCCACAGTAGCAGG + Intergenic
1171292343 20:23989538-23989560 TCCCGTGGAGCTGCAGGAGCTGG - Intergenic
1171391512 20:24804444-24804466 GCTCCTCGAGATGCAGGAGAAGG - Intergenic
1171953804 20:31443746-31443768 ACTGCTGCTGCTGCGGGAGCTGG + Intronic
1172231901 20:33342331-33342353 GTTCCGGGAGCTGCACGAGCTGG - Intergenic
1172398716 20:34630366-34630388 GCTGCTGGAGTTGTGAGAGCAGG - Intronic
1172446802 20:34997436-34997458 GCGGCGGGAGCTGGAGGAGGCGG + Exonic
1172507439 20:35473912-35473934 GCAGCTGGAGGTGCTAGAGCAGG + Exonic
1172522725 20:35578835-35578857 GCTGCAGGAGCTCCAGGGGCAGG - Intergenic
1172587051 20:36092479-36092501 GCCGCCGGAGCCGCCGGAGCTGG - Intronic
1172642112 20:36446797-36446819 GCTGCGGGAGCGGAAGTAGCTGG - Exonic
1172666421 20:36603644-36603666 GTAGCTGGAGCTGCAGGCACAGG - Intronic
1172846946 20:37935236-37935258 GCTGCAGGAATTGCAGGGGCTGG - Intronic
1172966034 20:38835946-38835968 GCTGACGGAGCTGCAGCTGCTGG + Exonic
1173101369 20:40091813-40091835 ACAGCTGGAGCTGGAGGAGCAGG + Intergenic
1173454062 20:43189682-43189704 GCAGCTGCAGCCTCAGGAGCAGG + Exonic
1173519998 20:43692262-43692284 GCTGCTGGAGCTCGAGGACAAGG + Exonic
1173690867 20:44960153-44960175 GTTGCGGGAGTTGGAGGAGCAGG + Intronic
1174021670 20:47535311-47535333 GCCACTGGGGCTTCAGGAGCTGG - Intronic
1174943647 20:54960359-54960381 GCTGCTGCAGCTGCTGGTCCAGG - Intergenic
1175166053 20:57045473-57045495 GCTGCTGATGCTGCAGGCCCGGG - Intergenic
1175169420 20:57069878-57069900 GCTGGTGGAGATGCAGGTGGAGG - Intergenic
1175381759 20:58568603-58568625 GCTGGTGCTGCTGCAGGAGGGGG + Intergenic
1175392170 20:58634414-58634436 TCTGCTGGATGGGCAGGAGCCGG - Intergenic
1175503567 20:59466899-59466921 GCGGCTGGGGCTGCAGGGGCAGG + Intergenic
1175541040 20:59747813-59747835 GCTGCTGGAGATGATGGAGCAGG + Exonic
1175678155 20:60965038-60965060 GCTGCTGGGGCTGCTAAAGCGGG - Intergenic
1175687245 20:61040606-61040628 TGTGCTGGAGCTGCAGGTGGAGG - Intergenic
1175777716 20:61663588-61663610 GCTGCTGGGACGGCAGGACCGGG + Intronic
1175888961 20:62307657-62307679 GCTGCTGGAGCAGAAGGGGCTGG - Exonic
1176020247 20:62959007-62959029 ACTGCAGGAGCTGGAGGAGGAGG + Intronic
1176088752 20:63309736-63309758 GCTGCTGGAGTAGCGGGAGTGGG - Exonic
1176107407 20:63395886-63395908 GCGGCCGGGGCTGCAGGAGGAGG + Intergenic
1176201307 20:63861906-63861928 GCTGCTGCCGCTGCTGCAGCAGG + Exonic
1176218167 20:63957892-63957914 ACTGGTGGAGCTGGAGGAGCCGG - Exonic
1176229929 20:64027276-64027298 GCTGATGGAGCTGCAGACTCAGG + Intronic
1176267782 20:64219792-64219814 GCTGCTGCAGCTGCTGCTGCTGG - Exonic
1176284501 21:5012367-5012389 GCTGCTGGAGGGACAGGGGCAGG + Intergenic
1176309645 21:5142818-5142840 GCTGGTGAAGCTGCAGCATCGGG - Intronic
1177041381 21:16115515-16115537 GCTGTTTGAGATACAGGAGCTGG + Intergenic
1177496165 21:21894897-21894919 ACTACTGGAGCTGAAGCAGCTGG + Intergenic
1177835760 21:26184707-26184729 GCAGCTGGAGCTGGAGTGGCTGG + Intergenic
1177918745 21:27124193-27124215 ACTGCTGGAGCTGAAGCATCTGG + Intergenic
1179022981 21:37656598-37656620 GCAGCTGGAGCTGGAGCGGCTGG + Intronic
1179485981 21:41711027-41711049 GCTAGTGGAGCTGGAGGAGAAGG - Intergenic
1179595980 21:42443571-42443593 GCTGCTGCTGCTGCAGTAACCGG + Intronic
1179847413 21:44119215-44119237 GCTGGTGAAGCTGCAGCATCGGG + Intronic
1179872680 21:44251108-44251130 GCTGCTGGAGGGACAGGGGCAGG - Intronic
1179889915 21:44330287-44330309 CCTGCTGCTGCTGCGGGAGCTGG - Exonic
1179936975 21:44612258-44612280 GCAGCTGGAGGCACAGGAGCGGG - Exonic
1179997263 21:44979804-44979826 ACTGTAGGAGCTTCAGGAGCAGG + Intergenic
1180061015 21:45385114-45385136 GGAGCTGGAGCTGCTGGAGCTGG - Intergenic
1180074423 21:45455499-45455521 GCGGCTGGAGCTGCGGGCGGCGG - Exonic
1180099124 21:45576161-45576183 GCTGCGTGAGCTGCAGATGCAGG + Intergenic
1180222749 21:46369851-46369873 GGTGCTGATGCTCCAGGAGCAGG - Intronic
1180222764 21:46369933-46369955 GCAGGCGGAGCTGGAGGAGCCGG + Intronic
1180614707 22:17119960-17119982 GCCGCTGGGGCTGCAGCAGCAGG + Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180976365 22:19850984-19851006 TCTGCTGGAGTTGGGGGAGCTGG + Exonic
1181001456 22:19989637-19989659 GCGGGTGGAGGTGCAGGTGCTGG + Intronic
1181033725 22:20160152-20160174 GCTGGAGGAGCTGGAGGAACTGG - Intergenic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181174972 22:21030163-21030185 GCTGCTGGACCTGGAGTCGCTGG - Exonic
1181495256 22:23283964-23283986 GCTGCCGGTGCTGCAGGCACAGG - Exonic
1181832363 22:25571089-25571111 GCTCCTGAAACTGCAGGAGAAGG - Intronic
1182442417 22:30372133-30372155 GGTGCAGCAGCTGGAGGAGCAGG + Exonic
1182442810 22:30374012-30374034 GCTGGAGGAGCTGAAGGAGCGGG + Exonic
1182460745 22:30481878-30481900 GCAGCAGCAGCAGCAGGAGCAGG + Intergenic
1182867263 22:33614597-33614619 CCTGCAGGAGGAGCAGGAGCTGG - Intronic
1183301408 22:37060837-37060859 GCTGGAGGAGCAGCAGCAGCAGG + Exonic
1183411734 22:37658908-37658930 GCTGCTGGAGCGGCTGGCGCGGG + Exonic
1183641704 22:39096820-39096842 GCAGCTGGAACTACAGGCGCAGG + Intergenic
1183655588 22:39182841-39182863 GTTGCTGGAGATGCAGGAAGAGG + Intergenic
1183731783 22:39622428-39622450 GGGGAGGGAGCTGCAGGAGCTGG + Intronic
1183850888 22:40586896-40586918 GCTGCTGGTGCTGCTGGTGCTGG + Intronic
1183978203 22:41525273-41525295 GCTCCAGGAGCTGCAGGCGCTGG - Exonic
1184040318 22:41939260-41939282 GCTGCAGGGGCTGCCAGAGCAGG + Intronic
1184209156 22:43025088-43025110 GCTGGAGGAGCGGCAGGAGGGGG - Intergenic
1184263809 22:43335575-43335597 TCTGGTGGGGCTGCATGAGCTGG - Intronic
1184352323 22:43952346-43952368 GCTGGTGGGACTGCAGGAGCTGG - Intronic
1184530149 22:45050383-45050405 GTTCCTGGATTTGCAGGAGCTGG + Intergenic
1184750235 22:46481712-46481734 GCTGCAGCAGCTGCGGGTGCAGG - Intronic
1184792269 22:46707485-46707507 GCTTCTGGACCTGAAGGAACCGG - Intronic
1184799003 22:46748778-46748800 GTTGCAGGAGCTACAGGGGCAGG - Intergenic
1184955886 22:47885651-47885673 TCTGCTGGAGCTGCCAGAGGCGG + Intergenic
1185011492 22:48317024-48317046 GCTCCCTGAGCTGCAGGTGCAGG + Intergenic
1185050444 22:48551451-48551473 ACTGGAGGAGCTGCATGAGCAGG + Intronic
1185053850 22:48567762-48567784 GTGGCTGGGGCTGCAGGAACAGG + Intronic
1185227533 22:49661395-49661417 GCTGTGGGGGCTGCAGGAGCTGG - Intergenic
1185258133 22:49848113-49848135 GGTGCTGGAGCCGGGGGAGCTGG - Intergenic
1185272072 22:49934425-49934447 GCTGAGGGAGCAGCAGGGGCAGG - Intergenic
1185278901 22:49961558-49961580 GGTGCTGGAGCGGCCCGAGCCGG + Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950181848 3:10918938-10918960 GCTGGTGGGGCCACAGGAGCCGG - Intronic
950408003 3:12816555-12816577 CCTGGTGGTGCTGCAGGAGCTGG + Exonic
950589603 3:13927192-13927214 GCTTCTGGGGCTGCAGGTGATGG - Intergenic
950604244 3:14064355-14064377 GCTGCTGGGGCTGCTGCTGCTGG - Exonic
950604250 3:14064382-14064404 GCTGCTGGGGCTGCTGCTGCTGG - Exonic
950604257 3:14064424-14064446 GCTGGTGGAGCTGCTGCTGCTGG - Exonic
950604312 3:14064796-14064818 GGTGCTGGAGCTGCTGCTGCTGG - Exonic
950604313 3:14064811-14064833 GCTGCTGGGACTGCTGGTGCTGG - Exonic
950604318 3:14064841-14064863 GCTGCTGGGGCTGCTGCTGCTGG - Exonic
950841753 3:15974697-15974719 GCTACAGGAGCTGCTGCAGCTGG + Intergenic
950894273 3:16433957-16433979 GCTCCTGGAGCTGTACCAGCAGG - Exonic
950894274 3:16433960-16433982 GCTGGTACAGCTCCAGGAGCTGG + Exonic
950990681 3:17434476-17434498 ACAGCTGGAGCTGAAGCAGCTGG + Intronic
951937017 3:28033190-28033212 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
952141141 3:30480372-30480394 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
952480247 3:33753901-33753923 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
952504549 3:33995994-33996016 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
952611487 3:35215786-35215808 GCTGGTGCGGCTGAAGGAGCTGG + Intergenic
952777466 3:37060253-37060275 GCTGCAGAAGCAGCAGGAGAGGG - Intronic
952946666 3:38482485-38482507 GTTGGAGGAGCTGCAGGAGGTGG + Exonic
953224929 3:41009976-41009998 GAGGCTGGGTCTGCAGGAGCTGG + Intergenic
953626836 3:44578922-44578944 TCAGCTGGTCCTGCAGGAGCCGG + Intronic
953632310 3:44629394-44629416 GATCCTGGAGCTGCTGGTGCTGG + Exonic
953748904 3:45595044-45595066 GCTGCTGCTGCTGCTGGAGGTGG - Exonic
953844429 3:46416158-46416180 CCAGCTGCAGCTGCAGGATCAGG + Intergenic
954140362 3:48601857-48601879 GCTGCTGGCCCTGCAGGGGGTGG + Intronic
954404999 3:50340766-50340788 GCTCATTGAGCTGCGGGAGCTGG - Exonic
954707606 3:52489397-52489419 GCTGCTGCAGGGGCTGGAGCTGG - Exonic
955395536 3:58554498-58554520 GTGGCTGGAGCTGGAGCAGCTGG + Intergenic
957374293 3:79336381-79336403 ACAGCTGGAGCTGAAGCAGCTGG - Intronic
957403112 3:79742362-79742384 ACAGCTGGAGCTGGAGCAGCTGG - Intronic
957783481 3:84849421-84849443 ACAGCTGGAGCTGGAGGGGCTGG + Intergenic
957857264 3:85894732-85894754 ACAGCTGGAGCTGAAGCAGCTGG - Intronic
958006025 3:87812784-87812806 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
959508236 3:107178255-107178277 ACAGCTGGAGCTGGAGGAGCTGG + Intergenic
960688147 3:120314238-120314260 GCTGCTGCTGCTGCTGCAGCTGG + Intergenic
961406756 3:126685112-126685134 CCTGGTGGAGCTGTGGGAGCAGG + Intergenic
961468644 3:127097436-127097458 GCTGCTGCATCTGGAGGAGGAGG + Intergenic
961503837 3:127356965-127356987 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
961656550 3:128445603-128445625 GCTGCTGGTGGTGCTGGAGGTGG + Intergenic
961819435 3:129567728-129567750 GCTGCTGCAGATGGAGGAGATGG - Exonic
961835142 3:129651732-129651754 GCTGCAGCAGCAGCAGCAGCAGG - Exonic
962162379 3:133013036-133013058 GCAGCTAGAGCTGGAGCAGCTGG - Intergenic
962207095 3:133443801-133443823 GCAGCTAGAGCTGCAGGTGTGGG - Intronic
962247239 3:133805926-133805948 GCGGCAGGAGCTGCAGCAGACGG + Exonic
962712762 3:138101565-138101587 GCTGGTGCGGCTGAAGGAGCTGG + Intronic
962754710 3:138458717-138458739 GCTGCTGGGGCTGGTGGAGGTGG - Intronic
963404436 3:144844331-144844353 ACCGCTGGAGCTGAAGCAGCTGG + Intergenic
963515809 3:146306624-146306646 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
963671589 3:148258377-148258399 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
963969722 3:151416308-151416330 GCTGCTGGGGCTGCTGCATCTGG - Exonic
964054216 3:152432861-152432883 GCTGCAGCAGCTGCAGGTACAGG - Exonic
964279880 3:155052570-155052592 ACAGCTGGAGCTGAAGTAGCTGG + Intronic
964314015 3:155424295-155424317 GCTGCTCGTGCTGCAGGGTCTGG - Intronic
964477447 3:157109774-157109796 GCTCCTGGAGCTGCAAGCCCAGG + Intergenic
965670240 3:171140467-171140489 GCTGCGGAAGCAGCAGGAGAGGG - Exonic
965672060 3:171157546-171157568 GCAGCTGGAGCAGCAGCAGCGGG - Exonic
965884218 3:173424137-173424159 ACAGCTGGAGCTGGAGCAGCTGG + Intronic
966346921 3:178990414-178990436 ACAGCTGGAGCTGGAGCAGCTGG + Intergenic
966558035 3:181285713-181285735 GCTGCTGGGGTTAAAGGAGCCGG - Intergenic
967208484 3:187145556-187145578 CCAGCTGGAGCTGGAGCAGCTGG + Intronic
967281222 3:187825923-187825945 GCTGCTGGGGAAACAGGAGCAGG - Intergenic
967406177 3:189118625-189118647 ACAGCTGGAGCTGAAGCAGCTGG - Intronic
967577168 3:191107724-191107746 GGAGCTGGAGCAGCTGGAGCTGG - Intergenic
967577169 3:191107730-191107752 GGAGCTGGAGCTGGAGCAGCTGG - Intergenic
968172581 3:196522502-196522524 GCAGTTTGAGCTGCTGGAGCAGG - Intergenic
968224769 3:196966861-196966883 GCTACTGGAGATGCAGGATTTGG - Intronic
968371224 3:198223734-198223756 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
968495284 4:911973-911995 GCAGGAGGAGCTGCAGGAGAGGG + Intronic
968503526 4:961731-961753 GCAGGTGGAGCGGCAGGAGGTGG - Exonic
968509606 4:989648-989670 GCTGCTGGTGCTGCTGGCGCTGG - Exonic
968578986 4:1380957-1380979 GCGGCGGCAGCTGCAGAAGCAGG + Exonic
968753498 4:2402369-2402391 GCTGCAGGAGCAGAAGGTGCTGG + Intronic
968870853 4:3241449-3241471 GCTGCTGCTGATGTAGGAGCTGG + Exonic
968871656 4:3245707-3245729 GCTGCTGGGGCTGCAGAGCCTGG - Intronic
968894089 4:3388654-3388676 GCAGCAGGGGCTGCAGGCGCTGG - Intronic
968894841 4:3393423-3393445 GTGGCTGGAGCTGCAGGTGCAGG - Intronic
968956940 4:3724272-3724294 TCGGCTGGAGCTGCAGGAGGGGG - Intergenic
969088920 4:4678022-4678044 GCTGCTGGAGCTAAAGGTGGGGG - Intergenic
969107951 4:4822255-4822277 GCAGCTGGAGCTGGAGTGGCTGG - Intergenic
969321783 4:6417069-6417091 GCTGCCGGTGCTGCAGGACCTGG - Intronic
969411593 4:7031951-7031973 GCTCCTCGAGGTGCAGGAGCAGG + Exonic
969423630 4:7111285-7111307 GCTGCAGGTTCTGGAGGAGCCGG - Intergenic
969432419 4:7163272-7163294 CCTGCTGCAGCTGCATGAACGGG + Intergenic
969485104 4:7467783-7467805 GCTGCTGTGGCTCCCGGAGCCGG + Intronic
969625006 4:8297890-8297912 GCAGGTGGGGCTGCAGGAGCAGG - Intronic
969665185 4:8553359-8553381 GATTCTGGAGCTGCAGGGCCAGG + Intergenic
969978570 4:11130474-11130496 GCACATGGAGCTGCAGGTGCAGG - Intergenic
970001797 4:11372309-11372331 GCTGCTAGAGCTGGAGCTGCGGG - Intergenic
970047853 4:11876197-11876219 ACAGCTGGAGCTGGAGCAGCTGG + Intergenic
970208429 4:13680530-13680552 TCTGAAGGAGCTGCAGGACCTGG + Intergenic
970312696 4:14798975-14798997 ACAGCTGGAGCTGCAGTGGCTGG + Intergenic
970536906 4:17039078-17039100 CCTGCAGGAGCAGAAGGAGCAGG - Intergenic
970664307 4:18319337-18319359 GGTGCTGGGGGAGCAGGAGCGGG + Intergenic
972330238 4:38057410-38057432 CCTGCAGGAGCTGCCGGAGATGG - Intronic
972773343 4:42218867-42218889 GCTGCTTGTTCTTCAGGAGCAGG + Intergenic
972828459 4:42787461-42787483 ATTGCTGGAGCTGCAGCTGCTGG + Intergenic
973279232 4:48341778-48341800 GGTGCGGAAGCTGCAGGAGCTGG + Exonic
973605100 4:52579065-52579087 GCTGCTGGTGCTGCTGGTGCTGG + Intergenic
973888467 4:55346423-55346445 GCGGCAGGAGCTGCAGCAGTAGG - Exonic
973916077 4:55636111-55636133 GCAGCAGCAGCAGCAGGAGCGGG + Exonic
974702774 4:65472657-65472679 ACAGCTGGAGCTGGAGCAGCTGG + Intronic
974811996 4:66956991-66957013 ACAGCTGGAGCTGAAGCAGCCGG + Intergenic
975658816 4:76668071-76668093 GCACCAGGAGCTGCAGGAGGAGG - Intronic
976074720 4:81284742-81284764 GCGGCTGGAGCAGAGGGAGCTGG - Intergenic
976155374 4:82138734-82138756 GCTGCAAGAGCTGCGAGAGCTGG - Intergenic
977197525 4:94081503-94081525 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
977507536 4:97921262-97921284 GATCCTGGGGCTGCCGGAGCAGG - Intronic
977915973 4:102593496-102593518 GGTGCTGGAGCTGGAGGCGGAGG + Exonic
977928620 4:102728830-102728852 GCTGGTGCGGCTGAAGGAGCTGG + Intronic
977979769 4:103307727-103307749 GTTGCAGGAGCTGCAGCTGCTGG + Intergenic
978637461 4:110826857-110826879 CCAGGTGGAGCTGCAGAAGCCGG + Intergenic
979122373 4:116920028-116920050 GGAGCTGGAGCTGGAGCAGCTGG - Intergenic
979328474 4:119404418-119404440 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
979378786 4:119983451-119983473 GTTCCTGGAGCTCCAGGAGCAGG - Intergenic
980153732 4:129080003-129080025 ACAGCTGGAGCTGAAGCAGCTGG + Intronic
980482576 4:133405933-133405955 GTTGCTGTAGCTACAGCAGCAGG - Intergenic
981370365 4:143952544-143952566 ACAGCTGGAGCTGGAGTAGCTGG - Intergenic
981391520 4:144196791-144196813 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
981483397 4:145260158-145260180 GGAGCTGGAGCTGGAGCAGCAGG + Intergenic
981550596 4:145937725-145937747 GCGGCTGGAGCAGGAGGAGGCGG - Intronic
982073163 4:151713497-151713519 GCTGATGGAGTTGCAGCAGCTGG - Intronic
982202568 4:152974710-152974732 GCTGCAGAGGCTGAAGGAGCAGG + Exonic
983020482 4:162670104-162670126 ACGGCTGGAGCTGAAGCAGCTGG + Intergenic
983075201 4:163317182-163317204 ACAGCTGGAGCTGGAGCAGCTGG + Intergenic
983379092 4:166968480-166968502 ATTGCTGGAGCTGGAGCAGCTGG - Intronic
983475064 4:168203487-168203509 ACTCCTGGAGCTGGAGTAGCTGG - Intergenic
983889462 4:173015969-173015991 CATGCTGGAGCTGAAGCAGCTGG - Intronic
984063348 4:175019556-175019578 GCTGCCGCTGCTGCAGGAGGAGG - Intergenic
984436738 4:179719031-179719053 ACTGCTAGAGCTGGAGCAGCTGG + Intergenic
984445769 4:179833643-179833665 GATGCTGGAGCTGGAAGAGTAGG - Intergenic
984466174 4:180101777-180101799 GTTGCTGGAGCTGCAGCCCCTGG + Intergenic
984725377 4:183014841-183014863 GCTGCTAGAGCCGCTGGAACCGG + Intergenic
985077121 4:186226778-186226800 GGTGCTGGATCTGCAGGGGATGG + Intronic
985093820 4:186392077-186392099 GCTGCTGCTGCTGCAGGACAGGG - Intergenic
985279452 4:188270835-188270857 GCTGCTGCTGCTGCTGGTGCTGG - Intergenic
985279462 4:188270901-188270923 GCTGCTGCTGCTGCTGGTGCTGG - Intergenic
985279468 4:188270940-188270962 GCTGCTGCTGCTGCTGGTGCTGG - Intergenic
985544345 5:501661-501683 TCTGCTGGACCTGCAGGGGCGGG - Intronic
985566343 5:620236-620258 GCTGCTGGAGCTTGGGGAGCAGG - Exonic
985577605 5:680904-680926 GCTGCTGGGTCTGGAGGAGCAGG + Intronic
985592535 5:773002-773024 GCTGCTGGGTCTGGAGGAGCAGG + Intergenic
985617061 5:929425-929447 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
985763799 5:1765820-1765842 GCTGCTGGAGCTCCAGATGTGGG + Intergenic
985774095 5:1831695-1831717 TGTGCTGAAGCAGCAGGAGCAGG + Intergenic
985894587 5:2740770-2740792 GGTGCGGGAGCTGGAGGCGCTGG - Intergenic
986281878 5:6330192-6330214 ACCGCTGGAGCTGGAGCAGCTGG - Intergenic
986392739 5:7300994-7301016 GATGCGGGAGCAGGAGGAGCAGG - Intergenic
986557652 5:9027335-9027357 ACGGCTGGAGCTGAAGCAGCTGG - Intergenic
986733198 5:10649846-10649868 GCCGCAGGCGCTGCAGGGGCAGG - Exonic
987016988 5:13830704-13830726 CCTGCTGGACCTGCAGGCACAGG - Exonic
987169583 5:15240388-15240410 ACTGCTGGAGCTGGAGTGGCTGG - Intergenic
987201736 5:15584085-15584107 GCAGCTGGAGCTGGAGTGGCTGG + Intronic
987313396 5:16701619-16701641 GCTGCAGGAGCGGCGGGACCAGG - Exonic
987636237 5:20545597-20545619 ACTGCTGGAGCTAGAGCAGCTGG + Intronic
987802904 5:22721206-22721228 ACAGCTGGAGCTGGAGCAGCTGG - Intronic
987849986 5:23339398-23339420 GCAGCTGGGACTACAGGAGCAGG + Intergenic
987909424 5:24122483-24122505 ACAGCTGGAGCTGAAGCAGCTGG + Intronic
987969289 5:24921325-24921347 GCAGCAGGAGCAGCAGCAGCGGG + Intergenic
988100460 5:26669800-26669822 GCAGCTGAAGGTGCAGGAGCTGG - Intergenic
988236457 5:28551235-28551257 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
989132810 5:38124431-38124453 ACTGCTGGAGCTGAAGCAGCTGG + Intergenic
989186811 5:38633969-38633991 GCTACTGGAGCTGCTGAGGCGGG - Intergenic
989218322 5:38927532-38927554 ACAGCTGGAGCTGAAGCAGCTGG + Intronic
989484084 5:41968009-41968031 GCGGCAGGAGGTGGAGGAGCAGG - Intergenic
989515701 5:42340044-42340066 ACAGCTGGAGCTGGAGCAGCTGG + Intergenic
990521874 5:56588779-56588801 GCTGCTGGGGCTGCAGCCACCGG + Intronic
990671088 5:58130784-58130806 GCTGGTGGGGATGAAGGAGCAGG - Intergenic
991446123 5:66702169-66702191 GCTGCTGGACCTGCTGGCCCAGG + Intronic
991535890 5:67669130-67669152 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
991772747 5:70054772-70054794 GTTGCTAGAGCTACAGTAGCTGG + Intronic
991852040 5:70930196-70930218 GTTGCTAGAGCTACAGTAGCTGG + Intronic
992084848 5:73269287-73269309 GGTCCTGGAGCAGCTGGAGCTGG + Intergenic
992350281 5:75921297-75921319 GCTCCACGAGCTGCAGGTGCTGG + Intergenic
993307143 5:86287687-86287709 GCTGCCAGAGGTGAAGGAGCAGG + Intergenic
993344717 5:86768915-86768937 GAAGCTGGAGCTGGAGCAGCTGG + Intergenic
993520075 5:88889544-88889566 CCTGCTGGACCTGCTGGACCTGG + Intronic
994137253 5:96302205-96302227 ACAGCTGGAGCTGGAGCAGCTGG + Intergenic
995956451 5:117782702-117782724 GTTGATTGAGCTGCTGGAGCAGG + Intergenic
996432858 5:123401000-123401022 GCTGGTGCGGCTGAAGGAGCTGG + Intronic
996720765 5:126628126-126628148 GCTGGTGGACTTGCAGCAGCTGG - Intergenic
996790755 5:127290707-127290729 GCTGCTGCAGCTGCTGCTGCCGG - Intergenic
997013373 5:129904520-129904542 GCTGGAGGAGCTGCAGGAGGAGG - Exonic
997022068 5:130013623-130013645 GCAGCTGGAGCTAAAGCAGCTGG + Intronic
997102100 5:130980668-130980690 ACAGCTGGATCTGAAGGAGCTGG + Intergenic
997243053 5:132322308-132322330 GCTGCTGGCGCTGACGGTGCCGG + Exonic
997303479 5:132823083-132823105 GCTCCTGCAGCGGCAGGAGGAGG - Exonic
997303481 5:132823086-132823108 CCTCCTGCCGCTGCAGGAGCCGG + Exonic
997681842 5:135761939-135761961 GCTGCTTGAGCTCCATGGGCTGG + Intergenic
998011594 5:138699704-138699726 GTGGCTGGAGCTGGATGAGCAGG + Intronic
998141532 5:139702278-139702300 GTGGCTGGAGCAGAAGGAGCAGG - Intergenic
998192958 5:140042626-140042648 GCTGTTGGAGCTGGAGCCGCCGG + Exonic
998250509 5:140549033-140549055 GCTGGAGGAGCTGAAGGAGCAGG + Exonic
998266728 5:140672565-140672587 GCTGCTCGCGCTGCAGCCGCTGG - Exonic
998279779 5:140795120-140795142 GGGGCTGGAGCTGGAGGAGCTGG + Exonic
998280360 5:140801353-140801375 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998282748 5:140828247-140828269 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998283341 5:140834539-140834561 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998284051 5:140841477-140841499 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998284707 5:140848651-140848673 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998285439 5:140856201-140856223 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998286652 5:140869259-140869281 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998287290 5:140875628-140875650 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998287950 5:140882424-140882446 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998337816 5:141389170-141389192 GATGCTGGAACTGGAGGAGAGGG - Exonic
998377305 5:141699720-141699742 GCTCCTCCAGCTGGAGGAGCTGG + Intergenic
998887132 5:146706285-146706307 GCTGGTGCGGCTGAAGGAGCTGG + Intronic
999249211 5:150172065-150172087 GCTGGTGAAGATGCAGGAGAGGG - Intronic
999264177 5:150255728-150255750 GCTGCTGAGGAAGCAGGAGCTGG + Intronic
999462039 5:151766008-151766030 GCAGCTGGTGCTGCACCAGCAGG - Intronic
999755831 5:154663728-154663750 CCTACTGGAGCTGCAGGAAGGGG - Intergenic
999768178 5:154756070-154756092 GCTGCCGGAGCCGCGGGCGCGGG + Intronic
1000705527 5:164506039-164506061 GGTGCTGCAGCAGCAGGAGAGGG - Intergenic
1000784619 5:165528454-165528476 ACGGCTGGAGCTGAAGCAGCTGG - Intergenic
1001929871 5:175665263-175665285 GGTACAGGAGCTGCAGGAGCTGG + Intronic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002196435 5:177504087-177504109 GCTGCTGGAGCTGGATCAGGTGG - Exonic
1002204510 5:177553793-177553815 GCTGCAGGCGCTGCAGGGGACGG + Intronic
1002255204 5:177953372-177953394 GCTCCGGGGGCTGCAGGAGGTGG - Intergenic
1002338672 5:178499448-178499470 GCTGATGGAGATGTAGGAGGAGG - Intronic
1002436003 5:179231223-179231245 GCTGCCAGAGCTGGGGGAGCGGG + Intronic
1002443190 5:179274818-179274840 GCTGGTGGAGGTGCAGGGCCTGG + Intronic
1002465445 5:179406053-179406075 GCTGCTGGACCTGGGGAAGCTGG + Intergenic
1002482932 5:179515362-179515384 GCTCCGGGGGCTGCAGGAGGTGG + Intergenic
1002717098 5:181234487-181234509 GCTGCTGGGGCAGGTGGAGCCGG - Exonic
1003083863 6:3045392-3045414 GCTGCAGCAGCTGCGGGTGCAGG + Intergenic
1003230057 6:4243666-4243688 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
1003675461 6:8200572-8200594 GCTACTGGAGTTGCAGGTTCAGG + Intergenic
1004571485 6:16850069-16850091 ACTGCTGGGGCTGCGGGAGGAGG - Intergenic
1004755021 6:18601617-18601639 GCTGCTGGCGATGGAGCAGCTGG + Intergenic
1004755779 6:18608726-18608748 GCATCTGGAGCTGGAGCAGCTGG + Intergenic
1004911100 6:20285040-20285062 ACTGCAGGAGCGGGAGGAGCAGG + Intergenic
1005302107 6:24481188-24481210 ACTGTGGGAACTGCAGGAGCAGG - Intronic
1005463658 6:26091543-26091565 GCTGCAGCAGTTGCTGGAGCTGG + Exonic
1005675333 6:28148674-28148696 GATCCTGGAGCTGCTGGTGCTGG + Exonic
1005685713 6:28251686-28251708 GATCCTGGAGCTGCTGGTGCTGG - Exonic
1005687829 6:28272186-28272208 GATCCTGGAGCTGCTGGTGCTGG + Exonic
1005696896 6:28359838-28359860 GATCCTGGAGCTGCTGGTGCTGG + Exonic
1005700722 6:28398132-28398154 GATTCTGGAGCTGCTGGTGCTGG - Exonic
1005848987 6:29804584-29804606 CCTAGTGGAGCTGCAGGAACAGG + Intergenic
1005869058 6:29959804-29959826 CCCAGTGGAGCTGCAGGAGCAGG + Intergenic
1005908207 6:30284127-30284149 GAAGCTGGAGCTGGAGCAGCTGG + Intergenic
1006101337 6:31688045-31688067 GCTGCAGGAGCTTCAGCAGGAGG + Exonic
1006117424 6:31782579-31782601 GCTGGTGGCGCTGAAGGAGCGGG - Exonic
1006183453 6:32167408-32167430 GCGCCTGGAGCGGCTGGAGCAGG + Exonic
1006258592 6:32850496-32850518 GTTGCTGGAAGTGCAGGTGCGGG - Exonic
1006277104 6:33013819-33013841 CCTGCTGGAGTGGGAGGAGCTGG - Intergenic
1006396211 6:33789068-33789090 GCGGCGGGAGCTGCAGGCCCTGG - Exonic
1006581427 6:35079817-35079839 GCAGCTGGACCTTCAGGACCTGG - Exonic
1006614678 6:35318327-35318349 GGAGCGGAAGCTGCAGGAGCTGG + Exonic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1006848270 6:37078260-37078282 GCTGCTGCACCTAGAGGAGCTGG - Intergenic
1007072529 6:39048081-39048103 GAGGCTGGAGCTGCAAGAGGTGG + Intergenic
1007473996 6:42107190-42107212 GATGCTGGAGCTGGGGGTGCTGG + Exonic
1007619998 6:43206154-43206176 GCCGCTGGAGCTGGAAGAGGTGG - Exonic
1007809403 6:44475685-44475707 GCTGCTGGAGCTGCGGGCTCTGG - Intergenic
1007962092 6:45969230-45969252 GCAGCTGGATCTGCAGGGGAGGG + Intronic
1008516821 6:52326342-52326364 ACTACAGGAGCTGCAGGACCTGG - Intergenic
1008643859 6:53493447-53493469 GTTGCTGGAGCTGCTGGATAGGG + Intergenic
1008817085 6:55580543-55580565 GCTGCTGGGACTACAGGCGCCGG + Intergenic
1010061227 6:71625346-71625368 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
1010360432 6:74987061-74987083 ACTGCAGGAGCTGGAGCAGCCGG - Intergenic
1010651046 6:78455742-78455764 ACAGCTGGAGCTGAAGAAGCTGG + Intergenic
1010900530 6:81422664-81422686 ACGGCTGGAGCTGAAGCAGCTGG - Intergenic
1010985134 6:82414851-82414873 GCTGCTGGAGGAGCAGCAGTGGG + Intergenic
1011090544 6:83593579-83593601 GCAGCTGCAACGGCAGGAGCAGG + Exonic
1011933030 6:92737868-92737890 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
1012064905 6:94537677-94537699 ACGGCTGGAGCTGAAGCAGCTGG + Intergenic
1014042940 6:116850662-116850684 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
1014895187 6:126892691-126892713 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
1015029774 6:128580663-128580685 GGTGCAGGAGCTGCAGCAGGCGG - Intergenic
1015178599 6:130338136-130338158 CCAGCTGGAGCTGGAGCAGCTGG - Intronic
1015239584 6:131008214-131008236 ACAGCTGGAGCTGAAGCAGCTGG - Intronic
1015571062 6:134621905-134621927 GCTGCTGGAGCTCCCTGACCAGG - Intergenic
1016284988 6:142462889-142462911 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
1016295967 6:142574011-142574033 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
1017672125 6:156778262-156778284 GCTGCTGCTGCTGCTGGAACTGG - Exonic
1017987917 6:159460672-159460694 GTGGCTGGAGCTGCAGGAGCAGG - Intergenic
1018029337 6:159829893-159829915 GCTGCTGAAGATGGAGGAACAGG - Intergenic
1018174129 6:161164359-161164381 GGGGATGGAGTTGCAGGAGCTGG - Intronic
1018277936 6:162153222-162153244 CCTGCTGGTGCCGAAGGAGCAGG - Intronic
1018317313 6:162569622-162569644 GCTGGTGCAGCTGAAGGAGCTGG - Intronic
1018919076 6:168158436-168158458 GTTGCTTTAGCTGCAGAAGCTGG - Intergenic
1019129739 6:169864849-169864871 TTTGCTGGAGCTGCGGCAGCAGG + Intergenic
1019282217 7:206254-206276 GCTGCGGCAGCTGCAGGAGACGG - Intronic
1019307208 7:341415-341437 GATGCTGGAGCTGCAGGCCCAGG - Intergenic
1019343351 7:518626-518648 GCAGCGGGCGCTGCAGCAGCGGG - Intronic
1019409301 7:899686-899708 GCTGGGGGACCTGGAGGAGCAGG - Intronic
1019530095 7:1498998-1499020 GCTGCTGGCGGTGCAGAAGCTGG - Exonic
1019552674 7:1610872-1610894 GCTGCTGGAGATGCCAGCGCGGG - Intergenic
1019589411 7:1823179-1823201 ACAGCTGGAGCCGGAGGAGCTGG + Intronic
1019729504 7:2622519-2622541 GCAGCTGGGGCAGGAGGAGCTGG - Intergenic
1019751159 7:2730643-2730665 GCGGCTGGGGCTGCAGGGCCGGG + Exonic
1019772186 7:2890628-2890650 GATGCAGGAGATTCAGGAGCGGG + Intergenic
1019883584 7:3884685-3884707 GGAGCTGGAGCTGGAGGGGCCGG - Intronic
1020275456 7:6622074-6622096 GCAGGAGGAGCTGCAGCAGCTGG + Exonic
1020542039 7:9470477-9470499 TCAGCTGGAGCTGGAGCAGCTGG - Intergenic
1021096307 7:16539702-16539724 GCAGCTGGAGCTGGAGTGGCTGG - Intronic
1021451288 7:20785451-20785473 GCTGCTGGAGGTGAGGGAGAAGG + Exonic
1021501391 7:21335792-21335814 CCCACTGGGGCTGCAGGAGCAGG + Intergenic
1021610644 7:22454673-22454695 GCTGCAGGTGCTGCAGGAGCTGG + Intronic
1022094481 7:27130313-27130335 GCAGCTGGGGCTGCAGGACGTGG + Exonic
1022094551 7:27130562-27130584 GCTGCTGCAGCGGCAGGTGCTGG + Exonic
1022192734 7:28032901-28032923 GTTGCTGGAGCTGCAGTGGGAGG - Intronic
1022269658 7:28793738-28793760 GCTGCAGGAGGTGCAGGATTTGG - Intronic
1022482483 7:30753007-30753029 GCTGCTGAGCCTGGAGGAGCAGG + Intronic
1022857751 7:34332231-34332253 ACTGCTGAAGTTGCAGGTGCAGG - Intergenic
1023254827 7:38302465-38302487 GCTGCTGGAGTTGCAGGGTCTGG - Intergenic
1023289706 7:38656510-38656532 GCTGGTGTGGCTGAAGGAGCTGG - Intergenic
1023353063 7:39339661-39339683 GGAGCTGGAGCTGCTGGAGCTGG - Exonic
1023353066 7:39339682-39339704 GCTGCTGCTGCTGCTGGAGCTGG - Exonic
1023520468 7:41045674-41045696 GCTTCTGAGGCTGGAGGAGCAGG - Intergenic
1023638618 7:42237247-42237269 GATGCCGGAGCTGCACGAGCGGG - Intronic
1023780104 7:43647470-43647492 TCTGATGGAGGAGCAGGAGCAGG + Intronic
1024045376 7:45582312-45582334 GGAGCTGGAGGTGCAGGAACTGG - Intronic
1024075609 7:45816453-45816475 GCTGCTGGGGCAGCATGAGCAGG - Intergenic
1024085535 7:45889018-45889040 GCGGCAGGAGGTGCTGGAGCAGG - Intronic
1024236313 7:47401768-47401790 GCTGGGGGAGCTGCAGGGACAGG + Intronic
1024279917 7:47710372-47710394 TCTGCTGGTGCTGCAGGAGTTGG - Intronic
1024487148 7:49931890-49931912 ACAGCTGGAGCTGAAGCAGCTGG - Intronic
1024520377 7:50300596-50300618 GCTGCTGGGGGTGAAGGAGCAGG - Intergenic
1024647990 7:51384844-51384866 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1025051844 7:55739343-55739365 GCTGCTGGGGAAGCATGAGCAGG + Intergenic
1025128802 7:56365011-56365033 GCTGTTGGGGCAGCATGAGCAGG + Intergenic
1025177183 7:56807889-56807911 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1025258288 7:57399841-57399863 GCTGCAGGAGCCGCAGGAGCTGG + Intergenic
1025610347 7:63071889-63071911 GCTGCAGGAGCTGCAGGAGCTGG - Intergenic
1025694609 7:63768497-63768519 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1025783372 7:64621572-64621594 GCAGTTTGAGCTGCTGGAGCTGG - Intergenic
1025943336 7:66089057-66089079 GGTGCTGGCGCTGAAGGGGCTGG - Intronic
1026688587 7:72533489-72533511 GCAGCTGGAGCAGGAGGAGAGGG - Intergenic
1026723819 7:72855386-72855408 GCAGCTGGAGCAGGAGGAGAGGG - Intergenic
1026797264 7:73374325-73374347 GCTGCTGGAGAGGCTGAAGCGGG + Intergenic
1027056333 7:75052451-75052473 GCTTCTTGGGGTGCAGGAGCTGG - Intronic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1027240980 7:76328644-76328666 GCTGCAGCAGCTTCAGAAGCGGG + Exonic
1027307524 7:76916130-76916152 GCTGCAGAAGCTGCAGCATCTGG + Intergenic
1027506348 7:79020973-79020995 ACAGCTGGAGCTGAAGCAGCTGG - Intronic
1028582689 7:92423591-92423613 GCTGCTGGAGCTGGAGAAATAGG - Intergenic
1029290613 7:99499766-99499788 GATCCTGGAGCTGCTGGTGCTGG - Exonic
1029291674 7:99506308-99506330 GATCCTGGAGCTGCTGGTGCTGG + Exonic
1029305877 7:99619846-99619868 GATCCTGGAGCTGCTGGTGCTGG + Exonic
1029366575 7:100120197-100120219 TCTGCAGAGGCTGCAGGAGCCGG + Intronic
1029374323 7:100168684-100168706 GCTGCAGCAGCTGCTGGGGCTGG - Exonic
1029458858 7:100684256-100684278 ACTGCTGGTGCTGCAGCTGCTGG + Exonic
1029506482 7:100966482-100966504 GCTGCTGGTGCTGCTGCTGCTGG + Exonic
1029508199 7:100975640-100975662 GCTGCTGGAGCTACGAGAGGGGG + Intronic
1029537012 7:101163034-101163056 GCTGCAGGAGCAGGAGGAGCTGG - Exonic
1029702129 7:102254145-102254167 GCTGCTGGAGCTTTGGGAACAGG - Exonic
1029833057 7:103280672-103280694 ACTGCGGGTGCTGCAGGCGCTGG - Intergenic
1029850558 7:103457303-103457325 ACTGCTGGAGCTTCAGTAGGCGG - Intergenic
1030012945 7:105189387-105189409 GCAGCAGCAGCTGCTGGAGCAGG - Intronic
1030216015 7:107044652-107044674 GCGGCTGGAGCGGGAGGAGCAGG + Exonic
1030249777 7:107429511-107429533 ACTGCTTGAGCTCCAGGAGTTGG - Intronic
1030722407 7:112885109-112885131 ACAGCTGGAGCTGAAGCAGCTGG + Intronic
1031182151 7:118432815-118432837 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
1031360698 7:120845132-120845154 ACAGCTGGAGCTGAAGCAGCTGG + Intronic
1031396944 7:121285197-121285219 ACAGCTGGAGCTGAAGCAGCTGG + Intronic
1031918201 7:127582649-127582671 GCCGGTGGAGCTGCTGCAGCCGG + Exonic
1031966148 7:128029971-128029993 CCTGGTGGGGCTGGAGGAGCTGG - Exonic
1032052134 7:128656200-128656222 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1032151592 7:129434308-129434330 GCTGCTCGACCGGCCGGAGCGGG - Intronic
1032159880 7:129502297-129502319 GCTGCCGGAGCGGCGGGCGCGGG - Intergenic
1032675620 7:134127547-134127569 GGTGCATGAGCTGCTGGAGCAGG - Exonic
1032833457 7:135652005-135652027 GCTGCAGGAGCTGGTGGAGTGGG - Intergenic
1033119356 7:138653226-138653248 GCTGCTGGAGAAGCTGCAGCAGG + Intronic
1033164358 7:139026755-139026777 GCAGCTGGAGCTGCAGAAGCTGG - Exonic
1033542282 7:142368013-142368035 ACAGCTGGAGCTGGAGCAGCTGG + Intergenic
1033903236 7:146168956-146168978 GCGGCTGGAGCTGAGTGAGCAGG - Intronic
1034172239 7:149071523-149071545 GCTGGTGGACCTGCAGCAGGCGG + Exonic
1034336933 7:150329921-150329943 GCAGCTGCAGATGCTGGAGCAGG + Exonic
1034342837 7:150369054-150369076 GCTGCTGGATCTGCGGGGGTGGG + Intronic
1034411977 7:150946697-150946719 GCTTCAGGAGCTGCAGGCTCAGG - Intronic
1034904827 7:154934671-154934693 GCAGCTAGAGCTGAAGCAGCTGG + Intronic
1034908082 7:154968613-154968635 GTTGCTGCTGCTGCTGGAGCAGG + Exonic
1034937985 7:155211995-155212017 GAGGCTGGTGCTGCAGGAGCTGG - Intergenic
1035081608 7:156220722-156220744 CATGCTGGAGCTGGAGCAGCTGG - Intergenic
1035168042 7:157003209-157003231 CCTGCTGGAGGCGCAGGGGCCGG + Intronic
1035563475 8:626395-626417 TCTGCCGGGTCTGCAGGAGCTGG + Intronic
1035617564 8:1013431-1013453 GCTGCTGGACCAGCAGGAATCGG + Intergenic
1036078009 8:5522588-5522610 GCTGCTGCAGAAGCTGGAGCTGG - Intergenic
1036182333 8:6596323-6596345 TCTGCTGCAGCTGCATGAGTGGG + Intronic
1036453932 8:8892431-8892453 GCTGGTGGCCCTGGAGGAGCTGG - Exonic
1036656399 8:10679949-10679971 GAGGCTGGAGCTGCCGGAGAGGG + Intronic
1037459578 8:19095443-19095465 TCTGCAGGAGCTGCTGGACCTGG - Intergenic
1037581863 8:20250069-20250091 GCTGCAGGAGCTGCGGGCCCAGG - Exonic
1037582307 8:20252919-20252941 GCTGCAGTACCTGCAGGTGCAGG + Exonic
1037751812 8:21687130-21687152 GCTGCTGGAGACGGAGGAGAAGG + Intergenic
1037949057 8:23007049-23007071 CATCCTGGTGCTGCAGGAGCGGG + Exonic
1038017944 8:23530374-23530396 GATGCTGGTCCTGCATGAGCAGG + Intronic
1038020571 8:23549149-23549171 GCTGCTGGAACTGAGGGAGCAGG - Intronic
1038484143 8:27921733-27921755 GCTGCAGGACCTGCGGGTGCTGG - Exonic
1038484199 8:27922009-27922031 GCTGTGGGGGCTGCAGGCGCAGG - Exonic
1038536849 8:28359722-28359744 GCTGCTGGAGCAGAAGCTGCAGG - Exonic
1039082352 8:33745481-33745503 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
1039168580 8:34714826-34714848 GCAGCTGGAACTGGAGCAGCTGG + Intergenic
1039309207 8:36297595-36297617 GCGGCTGGAGCTGAGGCAGCTGG - Intergenic
1039649627 8:39327904-39327926 GCAGTTTGAGCTGCTGGAGCTGG + Intergenic
1040091297 8:43401339-43401361 ACAGCTGGAGCTGGAGCAGCTGG + Intergenic
1040103814 8:43527880-43527902 GCAGCTGGAGCTGGAGCTGCAGG - Intergenic
1040386654 8:46918901-46918923 GCTGGGTGAGCTCCAGGAGCAGG - Intergenic
1040401177 8:47051439-47051461 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
1041491479 8:58438065-58438087 GCGGCTGGAGATGCAGCAGCTGG - Intronic
1042052967 8:64731799-64731821 GCAGCTGGAGCTGAAGCATCTGG - Intronic
1042821601 8:72935997-72936019 GCTGCCGGAGCTGCAGGAAACGG + Exonic
1043811973 8:84752660-84752682 ACTGCTGGAGATGGAGCAGCTGG - Intronic
1043982422 8:86657724-86657746 GCTGCAGGAGCTGCAGGAGCTGG - Intronic
1043982619 8:86658900-86658922 GCTGCTGGAGCTAGAGCAGAAGG - Intronic
1044395681 8:91708235-91708257 ACAGCTGGAGCTGAAGTAGCTGG - Intergenic
1045059714 8:98401211-98401233 GCAGCTGGAGCTGGAGCACCTGG - Intergenic
1045252183 8:100491460-100491482 ACTGCTGGGACTGCAGGAGAGGG + Intergenic
1045276056 8:100706757-100706779 GCGGCTGCAGCTGCAGGACGTGG + Exonic
1045484685 8:102621904-102621926 GCTGCAGGAGTGGCAGAAGCTGG - Intergenic
1046034210 8:108821629-108821651 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
1046311265 8:112440792-112440814 GTGGCTGGAGCTGAAGCAGCTGG + Intronic
1047254971 8:123207604-123207626 GCGGCTGCAGCTGGAGCAGCTGG + Exonic
1047807236 8:128373210-128373232 GCTGCTGGAGATGCAGGTGCTGG + Intergenic
1047807283 8:128373627-128373649 GCTGCTAGTGATGCAGGTGCTGG + Intergenic
1047807293 8:128373702-128373724 GTTGCTGGTGCTGCTGGTGCTGG + Intergenic
1047995759 8:130333940-130333962 GCAGCTGGAGCTGCAAGGACTGG + Intronic
1048245512 8:132793085-132793107 GCTGTCAGAGCAGCAGGAGCCGG + Intronic
1048697957 8:137049782-137049804 GCTGCTGGAGCTGCTGGAGCTGG - Intergenic
1048752622 8:137697326-137697348 GCTGCTGGAGCTGGAGTACCCGG - Intergenic
1048802319 8:138205947-138205969 GCTGCTGGAGCTGTGTGAACGGG - Intronic
1048861449 8:138727176-138727198 GGTGCTGGAGCTGAGGGAGGAGG - Intronic
1049023694 8:139974390-139974412 GATGCTGCAGCTGCTGGAACGGG - Intronic
1049114509 8:140674386-140674408 TTTGGTGGAGCTGCAGGATCTGG + Exonic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049296546 8:141843503-141843525 GCTGAATGAGCAGCAGGAGCAGG + Intergenic
1049417814 8:142503541-142503563 GCTGCAGGTGCAGCAGGTGCGGG + Intronic
1049474330 8:142789735-142789757 GCTGCCTGGGCTGGAGGAGCTGG + Intergenic
1049497520 8:142943309-142943331 CCTTCGGGAGCTGCGGGAGCTGG + Intergenic
1049639326 8:143707548-143707570 GGTGCTGCAGCTGGAGCAGCTGG - Exonic
1049674813 8:143884728-143884750 GCTGTGGCAGCTGCAGGAACAGG - Intergenic
1049681790 8:143922092-143922114 GCAGGAGGAGCTGCAGCAGCTGG - Exonic
1049724215 8:144138027-144138049 GCTGCAGGCGCTGATGGAGCTGG + Exonic
1049788459 8:144462447-144462469 GCAGCTACAGCTGCAGGAGGCGG - Intronic
1049789896 8:144467731-144467753 GCAGCTGGAACAGCAGGAGGAGG + Exonic
1049847015 8:144807738-144807760 ACTTCTGGTGCTGCAGCAGCCGG - Exonic
1049945106 9:586854-586876 CCTGCTGGGGGTGCAGGGGCAGG - Intronic
1049958074 9:711585-711607 CCTGAAGGAGCTGGAGGAGCAGG + Exonic
1050153687 9:2643316-2643338 GCTGATGGGGATGCAGGAGGAGG - Exonic
1050402441 9:5270707-5270729 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
1050412487 9:5381354-5381376 ACAGCTGGAGCTGGAGCAGCTGG - Intronic
1050878999 9:10675665-10675687 GTTGCTGGAGCTGCAGCCACTGG + Intergenic
1051250301 9:15152256-15152278 GCTGCAGGAGCAGCAGGCTCAGG - Intergenic
1051745390 9:20290613-20290635 CCTGCAGGAGCTGCAGGTGGTGG - Intergenic
1051756457 9:20406140-20406162 GCTGCTGGGGGTACAGGAGAAGG - Intronic
1052716132 9:32119787-32119809 GTGGCTGGAGCTGCATGAGAAGG + Intergenic
1052820566 9:33135218-33135240 GCTGCTGGCGCTGCAGGACTGGG + Exonic
1053285737 9:36848531-36848553 GCTGATGGATATGCCGGAGCCGG - Intronic
1053371318 9:37564089-37564111 ACTGCTGCAGCTGAAGCAGCTGG - Intronic
1053372740 9:37576280-37576302 CCCGCTGGAGCCGCAGCAGCCGG + Intronic
1053391610 9:37740246-37740268 GCTGCTGGCCCCGCAGGTGCTGG - Exonic
1053418349 9:37960971-37960993 GCTGCTGGTCTGGCAGGAGCTGG + Intronic
1053435179 9:38069333-38069355 GGTGCTGGGTCTGCGGGAGCGGG - Intergenic
1053486652 9:38462202-38462224 ACTGCGGGATCTGCAGGGGCTGG - Intergenic
1053619628 9:39802286-39802308 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
1053877798 9:42561602-42561624 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
1053882681 9:42611641-42611663 GTGGCTGGAGCTGAAGCAGCTGG + Intergenic
1053889988 9:42682661-42682683 GTGGCTGGAGCTGAAGCAGCTGG - Intergenic
1053894857 9:42732764-42732786 ACAGCTGGAGCTGGAGCAGCTGG + Intergenic
1054221708 9:62419109-62419131 GTGGCTGGAGCTGAAGCAGCTGG + Intergenic
1054229006 9:62490064-62490086 GTGGCTGGAGCTGAAGCAGCTGG - Intergenic
1054233895 9:62540092-62540114 ACAGCTGGAGCTGGAGCAGCTGG + Intergenic
1054264530 9:62905157-62905179 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
1054906533 9:70418634-70418656 GTCGCTGGAGCTGGAGGGGCTGG - Intergenic
1055223803 9:73969924-73969946 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
1055774392 9:79752165-79752187 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
1056021257 9:82440681-82440703 ACAGCTGGAGCTGGAGCAGCAGG - Intergenic
1056312325 9:85353017-85353039 CCTGGTGGAGCTGCAGGAAAGGG - Intergenic
1056456532 9:86766162-86766184 GCAGCAGCAGCTGCAGGAGGAGG + Intergenic
1056462064 9:86818096-86818118 GCTGCTGTAGCTGCCAGAGAGGG - Intergenic
1056527340 9:87455532-87455554 ACAGCTGGAGCTGGAGTAGCTGG + Intergenic
1057075407 9:92135800-92135822 GCTGCTGCAGCAGCTGGAGGAGG + Intergenic
1057126428 9:92619556-92619578 ACTGCTGCACCTGCAGGGGCGGG + Exonic
1057138951 9:92715318-92715340 GCGGCTGGAGCTGCTCGAGCTGG - Exonic
1057212318 9:93206850-93206872 GCGGCTGGATGTGCAGCAGCTGG + Intronic
1057245632 9:93451972-93451994 GCCGGTGGAGCTGCAGAAGCTGG + Exonic
1057258171 9:93567650-93567672 CCTACTGGAGCTTCAGGAGCGGG - Intergenic
1057263542 9:93599386-93599408 CTTGCTGGAGCAACAGGAGCTGG - Intronic
1057300288 9:93874628-93874650 GAGGCTGGAGCTGGAGCAGCTGG + Intergenic
1057354585 9:94323054-94323076 GGTCCTGGAGCTTGAGGAGCAGG + Intronic
1057361172 9:94374834-94374856 GCCGCCGGAGCTGGAGGAGAAGG + Exonic
1057653172 9:96934581-96934603 GGTCCTGGAGCTTGAGGAGCAGG - Intronic
1057662191 9:97013330-97013352 GCCGCCGGAGCTGGAGGAGAAGG - Exonic
1057806112 9:98221012-98221034 CCTGCGGGAGCAGCAGGTGCAGG - Exonic
1057943713 9:99306505-99306527 GCTGGTGCGGCTGAAGGAGCTGG - Intergenic
1058288589 9:103210124-103210146 ACAGCTGGAGCTGGAGTAGCTGG + Intergenic
1058609328 9:106757754-106757776 GTTGCTGGAGCTGCTGGGGGTGG + Intergenic
1058619103 9:106864157-106864179 GCTGCTGCAGCTGCTGGTGCCGG + Intronic
1058976127 9:110127126-110127148 AAGGCTGGACCTGCAGGAGCAGG + Intronic
1060219028 9:121754747-121754769 GCTCCTGGGGTTGCAGGACCAGG + Intronic
1060267587 9:122121388-122121410 GCTGCTGGAGCCCAAGGGGCTGG - Intergenic
1060552330 9:124491517-124491539 GCTGCTGGTGCTGCTGGGCCTGG - Intronic
1060945823 9:127568978-127569000 GCGGCGGGAGCGGCGGGAGCGGG - Exonic
1060965914 9:127712223-127712245 GCAGCTGGAGCAGCAGCAGGTGG + Exonic
1061048229 9:128178928-128178950 GCAGCTGCAGCTGCAGAAGCAGG - Exonic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061063098 9:128260611-128260633 GCTGCTGGAGCTGGAGCGGGCGG - Exonic
1061137156 9:128741505-128741527 GCAGCTGCTGCTGCAGGAGGTGG + Intronic
1061208527 9:129177680-129177702 GCTGCTGGAGGTGCAGCTGGTGG + Exonic
1061208530 9:129177695-129177717 GCTGGTGGAGCTGGTGGAGCTGG + Exonic
1061208531 9:129177704-129177726 GCTGGTGGAGCTGGTGCAGCTGG + Exonic
1061238910 9:129357992-129358014 GCTGCTGGAGCTGCACCACAAGG - Intergenic
1061390486 9:130314952-130314974 GCTGGGGGAGCAGCAGGCGCAGG + Intronic
1061582357 9:131545815-131545837 GCTGCTGGAGGGGCAGGTGCTGG + Intergenic
1061673833 9:132204228-132204250 GAAGCTGGGTCTGCAGGAGCCGG - Intronic
1061895113 9:133643115-133643137 CCCACTGGGGCTGCAGGAGCTGG + Intronic
1061970391 9:134041759-134041781 GCTGGCGGAGCTGCAGGAGCAGG - Exonic
1062192045 9:135253129-135253151 GCTCCTGGAGCTGGAGGAGCAGG + Intergenic
1062228181 9:135465666-135465688 GCTGCCGGAGCTGCCGGACCTGG + Intergenic
1062252186 9:135603905-135603927 GCAGCTGGAGCTCCCGGGGCTGG + Intergenic
1062378639 9:136276283-136276305 GCAGCTGGACCAGCAGAAGCAGG - Intergenic
1062400442 9:136370353-136370375 GCTGCGGGACCACCAGGAGCAGG - Exonic
1062460095 9:136659401-136659423 GCTGCAGGAGGTGCAGGAGGAGG - Exonic
1062475165 9:136723102-136723124 GCTGCTGTCCCTGCAGGAGAAGG + Exonic
1062612994 9:137383342-137383364 TCTGCAGGGCCTGCAGGAGCAGG + Exonic
1062697234 9:137881622-137881644 GCTGAGGGAGCTGCATGTGCAGG - Intronic
1062754873 9:138281790-138281812 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1203578781 Un_KI270745v1:25959-25981 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1186374320 X:8981903-8981925 GCTGCTTGAGCTGGAGTACCTGG + Intergenic
1186620460 X:11235308-11235330 ACAGCTGGAGCTGAAGCAGCTGG + Intronic
1186723116 X:12327033-12327055 GCTGATGGAGCTGCAGGTCCTGG - Intronic
1187133618 X:16526164-16526186 ATGGCTGGAGCTGCAGCAGCTGG + Intergenic
1187217011 X:17287002-17287024 GCTGCAAGTGCTTCAGGAGCAGG + Intergenic
1187246345 X:17555819-17555841 CCTGCTGGCACTGCAGTAGCAGG + Intronic
1187269801 X:17769368-17769390 GCAGCTGCAGGTGCAGGAGGTGG - Intergenic
1187269803 X:17769374-17769396 GGTGCAGCAGCTGCAGGTGCAGG - Intergenic
1187650001 X:21391515-21391537 GCAGCTGGAGCTGGAGTGGCTGG + Intronic
1187940702 X:24378068-24378090 GCTGCTGCTGCTGCTGGATCAGG + Intergenic
1188305791 X:28558568-28558590 ACAGCTGGAGCTGGAGCAGCTGG + Intergenic
1188475471 X:30587137-30587159 CCTAGTGGAGCTGTAGGAGCAGG - Intergenic
1189010654 X:37043211-37043233 CCTCCTGGAGCTGCACCAGCTGG - Intergenic
1189014141 X:37078038-37078060 CCTCCTGGAGCTGCACCAGCTGG - Intergenic
1189035136 X:37487871-37487893 GCAGCTGGAGCTGGATCAGCTGG + Intronic
1189035749 X:37492344-37492366 CCTCCTGGAGCTGCACCAGCTGG + Intronic
1189037234 X:37505657-37505679 CCTCCTGGAGCTGCACCAGCTGG + Intronic
1189463316 X:41259748-41259770 CCTGCTGGGGATGCAGGACCAGG - Intergenic
1189695148 X:43655384-43655406 TATGCTGGAGCTCCAGGAGGCGG - Intronic
1189840629 X:45072617-45072639 GCTGCTCTAACTGCTGGAGCAGG + Intronic
1189893724 X:45632371-45632393 GCTGGTGCGGCTGAAGGAGCTGG + Intergenic
1190055777 X:47180220-47180242 CCTGCAGGATCTGCAGCAGCTGG - Exonic
1190108442 X:47574510-47574532 GCTGCTGGCCCTGCGGGGGCGGG + Exonic
1190733046 X:53236976-53236998 GCTCCTGGAAGGGCAGGAGCAGG + Intronic
1191220816 X:57986027-57986049 GCTGGTGTGGCTGAAGGAGCTGG - Intergenic
1192382783 X:70635769-70635791 GATCCTGGGGCTGCAGGGGCTGG - Intronic
1192682516 X:73266888-73266910 GCAGCTGCAAGTGCAGGAGCTGG + Intergenic
1192788137 X:74354401-74354423 GAGCCTGGGGCTGCAGGAGCTGG - Intergenic
1193027095 X:76856151-76856173 AGTGCTGGAGCTGAAGCAGCTGG + Intergenic
1193043157 X:77024775-77024797 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
1193256460 X:79354870-79354892 ACAGCTGGAGCTGGAGCAGCTGG - Intergenic
1193743288 X:85244170-85244192 GCAGCTGTAGCTGCAGCAGCAGG + Exonic
1193900278 X:87167870-87167892 GTGGCTGGAGCTGGAGCAGCTGG + Intergenic
1194360356 X:92942193-92942215 ACAGCTGGAGCTGAAGGAACTGG + Intergenic
1194582805 X:95697438-95697460 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
1194835226 X:98673111-98673133 ATTGCTGGTGGTGCAGGAGCAGG + Intergenic
1194905924 X:99576302-99576324 ACTGCTGGAGCTGAAGCAGCTGG - Intergenic
1194929397 X:99867812-99867834 ATGGCTGGAGCTGCAGCAGCTGG - Intergenic
1195536286 X:106012688-106012710 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
1195608379 X:106835321-106835343 ACAGCTGGAGCTGAAGCAGCTGG + Intronic
1195671950 X:107477328-107477350 GCTGGTGGAAATGCAGGAGGGGG + Intergenic
1195779015 X:108440097-108440119 GCTGAAGGAGCTGCGGGAGCCGG + Exonic
1195803210 X:108735310-108735332 GATGCTGTAGCTGCGGCAGCGGG + Exonic
1196117579 X:112014135-112014157 GCTGCTGGTGCTGCTGGTCCAGG + Intronic
1196871219 X:120115508-120115530 GCTGTTGCAGGTGGAGGAGCTGG - Exonic
1197873877 X:131084259-131084281 GCTGCAGGGTCTGCAGCAGCAGG - Exonic
1198313029 X:135438506-135438528 GCAGCTGGAGCTGCAGTAGAAGG + Intergenic
1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG + Intergenic
1198947069 X:142027160-142027182 ACAGCTGGAGCTGAAGCAGCTGG + Intergenic
1199003015 X:142662841-142662863 ACAGCTGGAGCTGAAGCAGCTGG - Intergenic
1199218503 X:145289895-145289917 GGTGCTGGAGCTGCAAAGGCTGG + Intergenic
1199250758 X:145659379-145659401 ACTGCTGGAGATGGAGCAGCTGG - Intergenic
1199335977 X:146619685-146619707 GCAGCTGAAGGTGCAGGAACTGG - Intergenic
1200119536 X:153783832-153783854 GCTGCGGGACCTGCAGAGGCTGG + Exonic
1200292628 X:154886881-154886903 GCAGCTGGGGCAGCTGGAGCTGG - Exonic
1200339472 X:155382621-155382643 GCAGCTGGGGCAGCTGGAGCTGG - Exonic
1200346998 X:155458072-155458094 GCAGCTGGGGCAGCTGGAGCTGG + Exonic
1200668559 Y:6058011-6058033 ACAGCTGGAGCTGAAGGAACTGG + Intergenic
1200766911 Y:7087894-7087916 TATGGTGGAGCTGCAGGAGCTGG - Intronic
1201739737 Y:17311116-17311138 GCTGCAGCAGCAGCAGGAGGAGG - Intergenic
1202372795 Y:24209850-24209872 CCTGCTGGAGCTGCAGGGGCAGG - Intergenic
1202381403 Y:24278577-24278599 GCTGCTGGGGCAGCAAGGGCAGG - Intergenic
1202489382 Y:25391549-25391571 GCTGCTGGGGCAGCAAGGGCAGG + Intergenic
1202497987 Y:25460270-25460292 CCTGCTGGAGCTGCAGGGGCAGG + Intergenic