ID: 1061062559

View in Genome Browser
Species Human (GRCh38)
Location 9:128257995-128258017
Sequence GGCCCCCTGCAGGGCCCGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 6, 1: 4, 2: 4, 3: 33, 4: 274}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061062545_1061062559 30 Left 1061062545 9:128257942-128257964 CCACCCTTCTTGACCCATGCCAG 0: 1
1: 0
2: 8
3: 22
4: 221
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274
1061062550_1061062559 16 Left 1061062550 9:128257956-128257978 CCATGCCAGGAGAGACTCATTCA 0: 1
1: 1
2: 1
3: 17
4: 159
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274
1061062547_1061062559 27 Left 1061062547 9:128257945-128257967 CCCTTCTTGACCCATGCCAGGAG 0: 1
1: 0
2: 4
3: 21
4: 133
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274
1061062553_1061062559 -7 Left 1061062553 9:128257979-128258001 CCTGCAGCTTCTCCATGGCCCCC 0: 6
1: 3
2: 9
3: 65
4: 454
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274
1061062551_1061062559 11 Left 1061062551 9:128257961-128257983 CCAGGAGAGACTCATTCACCTGC 0: 1
1: 1
2: 2
3: 16
4: 179
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274
1061062548_1061062559 26 Left 1061062548 9:128257946-128257968 CCTTCTTGACCCATGCCAGGAGA 0: 1
1: 0
2: 2
3: 16
4: 142
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274
1061062549_1061062559 17 Left 1061062549 9:128257955-128257977 CCCATGCCAGGAGAGACTCATTC 0: 1
1: 0
2: 2
3: 11
4: 132
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061062559 Original CRISPR GGCCCCCTGCAGGGCCCGGT GGG Exonic
900369125 1:2323695-2323717 GGCCGGCTGCAGGGCTTGGTGGG - Intronic
900458238 1:2787568-2787590 GGCCACCAGCAGGGCCTTGTGGG + Exonic
900764422 1:4494509-4494531 GGCCCCCTGCAGCCCCTGGATGG + Intergenic
901197108 1:7446517-7446539 GGCCACCAGGAGGGCCCGGGTGG + Intronic
901254825 1:7813950-7813972 GGCACCATGCAGGACCGGGTGGG + Intronic
901332117 1:8418101-8418123 GGCTCCCTGCAGGGCAGGGATGG + Intronic
901631854 1:10651927-10651949 GGCCCACTCCAGGGCCACGTGGG - Intronic
901692972 1:10985779-10985801 GGCCTCCTCCAGGGCCCGTGAGG - Intergenic
902596978 1:17516332-17516354 GGGCCTTTGCAGGGCCCGCTGGG + Intergenic
902828634 1:18995362-18995384 AGCCCCCTCCAGGGCCCTGTTGG - Intergenic
903329874 1:22591868-22591890 AGACCACTGCAGGGCCCGGAAGG - Intronic
904303409 1:29570973-29570995 GGCTCCCTGCAGGGCCCAGGTGG - Intergenic
904964666 1:34362149-34362171 GGCACTCTGCAGGGCACGGAGGG + Intergenic
904971048 1:34419728-34419750 GGCCTCCTGCAGGTCCCAGATGG - Intergenic
905234294 1:36535241-36535263 GGCCCCGGGCACGGCCCGCTGGG + Intergenic
905362458 1:37430191-37430213 GTTCCCCTGCAGGGCCTTGTAGG - Intergenic
906157267 1:43621001-43621023 GGCCCCCTGGAGGGCTGGGGTGG + Intronic
906399015 1:45491173-45491195 ACCCCCCTGCTGGGCCGGGTAGG - Intergenic
910237294 1:85048587-85048609 GGCCCCCGACAGGGCGCGGCGGG - Intronic
912693432 1:111821764-111821786 GGCCTCCTGCAGGGGCCAGGGGG + Intronic
912737792 1:112165564-112165586 GGGCTCTTGCAGGGCCAGGTGGG - Intergenic
913180745 1:116318828-116318850 GGCCCCTTCCAGGGCCCTGGAGG + Intergenic
920745702 1:208625974-208625996 GCTCCCCTGCAGGGCCTTGTAGG + Intergenic
921300776 1:213749608-213749630 GGCACCCTGCAGTGCCCTTTTGG - Intergenic
922422354 1:225468397-225468419 GGCTTCCTGCATGGCCCTGTTGG - Intergenic
924502873 1:244653222-244653244 GGCCCCCTGAAGCGCCCGCGGGG + Exonic
924694308 1:246382879-246382901 GGCCCACTCCAGGGCCAGGCTGG + Intronic
1062997627 10:1881776-1881798 AGCCCCTTGCAGGGCACGGCAGG + Intergenic
1063481173 10:6377944-6377966 GGCCCCGTGCTGGGGCTGGTGGG + Intergenic
1067223896 10:44363187-44363209 GGAACCCTCCAGGGCCCTGTCGG - Intergenic
1067684609 10:48458960-48458982 GGCTGCCTGCAGGTCCTGGTGGG + Intronic
1067915847 10:50397246-50397268 GGCACTCTGCAGGACCAGGTAGG + Intronic
1069660975 10:70123345-70123367 GGCCCTCTGCAGGGCCTGGGCGG - Intronic
1069861582 10:71475067-71475089 GGCACCCTGCAGGGCCTGGAGGG - Intronic
1070922666 10:80197947-80197969 GGCCCCCTCCAAGACCCAGTGGG - Intronic
1072731963 10:97852336-97852358 GGCCCCCTGCTTGGCCTGGCTGG + Intronic
1072744153 10:97928281-97928303 GGCCCCCTGCAGGGCATGGTGGG - Intronic
1072926311 10:99620273-99620295 GGCCGGCGGCAGGGCCCGGGCGG - Exonic
1073030244 10:100519898-100519920 GGACCCCGGCAGGGCACCGTCGG + Intronic
1073071002 10:100793243-100793265 GGCCTGCTGCAGGGGCTGGTGGG - Intronic
1073266400 10:102230764-102230786 GGGGCCCTGCAGGGCCTGGGCGG - Exonic
1074377504 10:112951658-112951680 GGCCGCATGCGGGGCCCGGCGGG - Intronic
1074591879 10:114821736-114821758 CGCCCCCTGCAGGCCGCGGCGGG + Exonic
1075519712 10:123136268-123136290 GGCGCCCTCCAGGGCCCCCTTGG - Exonic
1075754756 10:124801912-124801934 GGCCCCCTGCCGCGCCCGCTGGG + Intronic
1076504551 10:130963201-130963223 GGTCCCCAGCAGGGCCCAGCAGG + Intergenic
1076907895 10:133372659-133372681 GGCCTCCTGCAGAGCCAGGCAGG + Intronic
1076998365 11:310446-310468 AGCCCCCAGCAGGGCCAGGGAGG + Intronic
1077000377 11:319312-319334 AGCCCCCAGCAGGGCCAGGGAGG - Intergenic
1077136574 11:1002489-1002511 CGCCCCCTGCACAGCCCGGCAGG - Intronic
1077169071 11:1158409-1158431 TGGCCCCTGCTGGGCCTGGTCGG + Intronic
1077215248 11:1392689-1392711 GGCGTCCTCCAGGCCCCGGTGGG - Intronic
1077326122 11:1964876-1964898 GGACCCCTGCAGTCCCCGCTGGG + Intronic
1077414366 11:2417958-2417980 GGTCCCAGGCCGGGCCCGGTGGG - Intronic
1077560307 11:3256453-3256475 GACCCCCTGCAGGGGCCACTAGG + Intergenic
1077566204 11:3302269-3302291 GACCCCCTGCAGGGGCCACTAGG + Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1082812101 11:57484597-57484619 GGCCCCTTCCAGGGCCAGGAGGG - Exonic
1083221993 11:61258706-61258728 GGCCCCCAGCAGCCCCCAGTGGG - Exonic
1083267127 11:61551862-61551884 GGCATCCTGCAGGGCAAGGTTGG + Intronic
1084608874 11:70188080-70188102 CGCTCCCACCAGGGCCCGGTGGG + Exonic
1084639379 11:70415457-70415479 GGCCCACTGCAAGGCCCAGTGGG - Intronic
1084705636 11:70814639-70814661 GGACCCCGGCAGGACCCAGTGGG - Intronic
1202809102 11_KI270721v1_random:20055-20077 GGACCCCTGCAGTCCCCGCTGGG + Intergenic
1091703849 12:2680684-2680706 GGCCCTCTGCAGGGACAGGCAGG - Intronic
1092810510 12:12267382-12267404 CGCCGCCGGCAGGGCCAGGTGGG + Intergenic
1094833657 12:34312258-34312280 GGCCCCGTGCAGGGACTGCTGGG + Intergenic
1094834895 12:34317717-34317739 GGCCCCGTGCAGGGGCTGTTGGG + Intergenic
1096539236 12:52295534-52295556 TGCCCTCTGCAGGGCCCTGCAGG + Intronic
1097188483 12:57208400-57208422 GGCCCCCAGCTGGGCCTGCTTGG + Intronic
1100980233 12:100157543-100157565 GGCCCCCTGCAGGGCCTGGTGGG + Intergenic
1101409884 12:104458651-104458673 AGCCCCCTGCCGGGCCACGTTGG + Intronic
1102594002 12:113978515-113978537 GGCCCCCAGCAGGGCCCACCAGG - Intergenic
1103400709 12:120641105-120641127 GGCGCACTGCAGGCCCCGGGAGG + Exonic
1103542083 12:121673127-121673149 GGCACCCTTCAGGGGCCGGGGGG - Intergenic
1103977920 12:124715710-124715732 AGCCCATTGCAGGGCCCGGCTGG + Intergenic
1105475133 13:20722011-20722033 AGCCGCCTGGAGGGCTCGGTCGG + Exonic
1105611706 13:21974688-21974710 AGCCCCCTGCGGGGCTAGGTGGG - Intergenic
1105814756 13:24024540-24024562 GGCCACCAGCAGGGCCCTGGTGG - Intronic
1106413158 13:29524998-29525020 GGCCCCTCCCAGGGCCCTGTCGG + Intronic
1107831024 13:44373908-44373930 TGCCACCTGCAGCGCCCGGGTGG + Exonic
1108373457 13:49792675-49792697 GGCCGACTGCCGGGCCGGGTGGG + Exonic
1111824235 13:93248661-93248683 GGCTCCCAGCAGTGCCCGGGAGG - Intronic
1119392917 14:74303262-74303284 GGCTTCCAGCCGGGCCCGGTGGG + Intronic
1121266230 14:92604209-92604231 GGGCGCCTGCAGGGCCCCATGGG - Intronic
1122226985 14:100285834-100285856 CGCCCCCTGGAGGGCGGGGTGGG + Intergenic
1123017110 14:105380751-105380773 GTCACCCTGCATGGCCCGGATGG + Intronic
1123224012 14:106883358-106883380 GGGCAACTGCAGGGCCCTGTAGG - Intergenic
1123450516 15:20356927-20356949 GACCCCCCGCAGGCCCTGGTGGG - Intergenic
1123473605 15:20571814-20571836 GACTTCCTGCAGGGCCCGGTGGG - Intergenic
1123644404 15:22428539-22428561 GACTTCCTGCAGGGCCCGGTGGG + Intergenic
1123665718 15:22608441-22608463 GACTTCCTGCAGGGCCCAGTGGG + Intergenic
1123733903 15:23166825-23166847 GACTTCCTGCAGGGCCCGGTGGG - Intergenic
1123752042 15:23364211-23364233 GACTTCCTGCAGGGCCCAGTGGG - Intronic
1124284408 15:28388136-28388158 GACTTCCTGCAGGGCCCGGTGGG - Intronic
1124298289 15:28523478-28523500 GACTTCCTGCAGGGCCCGGTGGG + Intronic
1124319540 15:28702855-28702877 GACTTCCTGCAGGGCCCAGTGGG + Intronic
1124482972 15:30092576-30092598 GACTTCCTGCAGGGCCCAGTGGG - Intronic
1124484205 15:30101229-30101251 GGCCTCCTGCCGGGCCCTGCTGG + Intergenic
1124489423 15:30144647-30144669 GACTTCCTGCAGGGCCCAGTGGG - Intronic
1124519377 15:30395995-30396017 GGCCTCCTGCCGGGCCCTGCTGG - Intergenic
1124520605 15:30404642-30404664 GACTTCCTGCAGGGCCCGGTGGG + Intronic
1124538052 15:30561577-30561599 GACTTCCTGCAGGGCCCAGTGGG - Intronic
1124539278 15:30570226-30570248 GGCCTCCTGCCGGGCCCTGCTGG + Intergenic
1124544512 15:30613638-30613660 GACTTCCTGCAGGGCCCAGTGGG - Intronic
1124564475 15:30801073-30801095 GACTTCCTGCAGGGCCCAGTGGG - Intergenic
1124754104 15:32393680-32393702 GACTTCCTGCAGGGCCCAGTGGG + Intronic
1124759372 15:32437346-32437368 GGCCTCCTGCCGGGCCCTGCTGG - Intergenic
1124760598 15:32446008-32446030 GACTTCCTGCAGGGCCCAGTGGG + Intronic
1124778035 15:32603054-32603076 GACTTCCTGCAGGGCCCAGTGGG - Intronic
1124959207 15:34382350-34382372 GACTTCCTGCAGGGCCCGGAGGG + Intronic
1124975833 15:34528571-34528593 GACTTCCTGCAGGGCCCGGAGGG + Intronic
1125714483 15:41811585-41811607 GGCCCCCTGCTGGGCTCAGGAGG + Intronic
1125726550 15:41871238-41871260 GGCCCCCTGCAGAGCCCCGTGGG + Intronic
1127772624 15:62243641-62243663 GGTCCCCTGCAAGGTCCGGTGGG + Intergenic
1128385731 15:67146991-67147013 GGCCCCTGGCAGGGCCTGGCGGG - Intronic
1129302293 15:74632346-74632368 AGCCCCCTGCACGGCCAGGTGGG - Exonic
1129656790 15:77529863-77529885 GTGCCCCTGCAGGGCCTGGCAGG + Intergenic
1129697161 15:77747193-77747215 GGCCCCCTGCTAGGCCTGGGCGG - Intronic
1130112458 15:80977071-80977093 GGCCCAGTGCAGGCCCAGGTTGG - Exonic
1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG + Intergenic
1130468533 15:84204802-84204824 GGCCCCCTGCAGGGCCCGGTGGG + Intergenic
1130485219 15:84394960-84394982 GGCCCCCTGCAGGGCCTGGTGGG - Intergenic
1130495731 15:84468740-84468762 GGCCCCCTGCAGGGCCCGGTGGG - Intergenic
1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG + Intergenic
1131188538 15:90294812-90294834 GGCCCCCTGCAGGGCCCGGTGGG - Intronic
1132184549 15:99792078-99792100 GACCTCCTGCATGGCCCGGTGGG - Intergenic
1132760434 16:1506241-1506263 GGCCCGAGGCAGGGCCCGGCAGG + Exonic
1132810303 16:1793927-1793949 GGCCCCCTGCAGGGCTGACTGGG + Intronic
1136040058 16:27571649-27571671 GGGGCCCTGCAGGGCCCTGCTGG + Intronic
1136399657 16:30010571-30010593 GGGGCCCTGCAGGGCCCCTTGGG - Intronic
1136408778 16:30064788-30064810 GGCCCCTTGCAGGACCGGGCCGG + Intronic
1138558944 16:57788614-57788636 GGCCCCCAGGCGGGCCCGGGAGG - Intronic
1139422224 16:66855851-66855873 GCCCCACTGCAGGGCCAGGAGGG + Intronic
1139431054 16:66911228-66911250 GGCGCCCTGCAGGGACTGGGCGG + Exonic
1141592227 16:85076884-85076906 GGCCCTCTGCAGGTCCCAGTGGG - Intronic
1141614327 16:85202127-85202149 GGCCCCCATCAGGGCCCGGGCGG + Intergenic
1142108592 16:88319231-88319253 GGCCACCTGCAAGGCCCCCTCGG - Intergenic
1142130075 16:88428297-88428319 GGCCCCATGCAGTGCCGGGAAGG - Exonic
1142416895 16:89948166-89948188 AGCCACCTGCAGGGCCCCGCGGG - Intronic
1143719286 17:8798855-8798877 GGCTCCCTGCTCGGCTCGGTGGG - Exonic
1144873202 17:18382915-18382937 GGCCCCGGGCAGGGTCCGGGCGG - Intronic
1145929677 17:28676150-28676172 GGCTTCTTGCAGGGCCCTGTAGG - Exonic
1146255665 17:31390665-31390687 GGGGCCCTGCAGGACCCGGCCGG - Intergenic
1146296603 17:31655096-31655118 GCCCCACTGCAGGGCTTGGTTGG - Intergenic
1146400196 17:32495478-32495500 GGTTCCCTGCAGCCCCCGGTGGG - Intronic
1147028484 17:37609636-37609658 GGCCCTCTGCAGGGCCCAGCTGG + Intergenic
1147450596 17:40501681-40501703 GGCCACGTGCAGGGCCCGCCCGG - Intergenic
1148086704 17:44997955-44997977 TGCCCCCTGCAGGGGCCTCTGGG - Intergenic
1148131020 17:45262644-45262666 GGCCCCATGCAGGGCTCAGGAGG + Intergenic
1148209627 17:45800372-45800394 GGCCTCCCCCAGGGCCCGGAAGG + Intronic
1148491250 17:48025239-48025261 TGCCACCTGCAGGGACCGGCAGG - Intergenic
1148795483 17:50194818-50194840 GGCCCTCTCCAGGGCCCTGTTGG - Exonic
1150124583 17:62627939-62627961 GGCCAACTTCAGGGCCCGGGCGG + Intronic
1151336595 17:73443647-73443669 GGCAGCCTGCAGGGCTCGATGGG + Intronic
1151748039 17:76022116-76022138 GGCCCCGGGCAGGGTCCGGGCGG + Intronic
1151827198 17:76530050-76530072 GGGCCCGTGCAGAGCCCGGCGGG + Intronic
1151999565 17:77637007-77637029 GGACACCTGCAGGGGCCGGGAGG + Intergenic
1152027504 17:77821374-77821396 GGCCACCTGCAGGGACCGTGTGG - Intergenic
1152337925 17:79708407-79708429 GGCCCCCCGCAGGCCCTGGTGGG + Intergenic
1152699844 17:81813399-81813421 GGCCCACAGCAGGTCCCGGTGGG + Intronic
1152703879 17:81833126-81833148 GGTGCCCTGCAGGGCCGGGCGGG - Intronic
1153851814 18:9102479-9102501 GGACCCCTGCAGCGGCCCGTAGG + Intergenic
1154197223 18:12275562-12275584 TGCCCCCTGCACGTCCCTGTGGG + Intronic
1155054013 18:22169768-22169790 GGCCCTCTCCAGGCCGCGGTCGG + Intronic
1157733558 18:50025767-50025789 GGACCCCAGCAGGGGCCCGTGGG + Intronic
1158019723 18:52827132-52827154 GGCCCCCTCCAGGCCCTGGCTGG - Intronic
1158140210 18:54247296-54247318 GGCCTCCTGCAGGCCCCGACAGG + Intergenic
1160053150 18:75455605-75455627 TGCGCCCTGCGGGGCCCTGTCGG + Intergenic
1160561885 18:79764151-79764173 AGTTCCCTGCAGGGCCTGGTGGG + Intergenic
1160583269 18:79899689-79899711 GTCCTCCTGCAGGGCCGGCTCGG - Exonic
1160769432 19:823688-823710 GCCCCCCTGCAGGAACCGGGGGG - Intergenic
1160800214 19:964194-964216 GGCTCCCTGCAGTGCCCAGGTGG + Intronic
1160810348 19:1010487-1010509 GGCCCCCAGCAGGGCCCAGCGGG + Exonic
1160858467 19:1227715-1227737 AGCGCCCTGCAGGGCCGGGCAGG + Exonic
1161149400 19:2699747-2699769 GGCACCCTGCAGTGCCCAGAAGG + Intronic
1161461467 19:4400236-4400258 GGCCCCCTCCCGGGCCAGGTCGG + Intronic
1161478483 19:4498987-4499009 GGCCCCCAGCAGGTTCCTGTCGG + Intronic
1161615673 19:5268888-5268910 TGCCCCCTTCAGGGCCCCGATGG - Intronic
1162498675 19:11038409-11038431 GGCCCCCTGCAGACCCAGGGCGG - Intronic
1162554506 19:11378432-11378454 GGCCCCCTGCTGGAGCCAGTGGG - Exonic
1162938502 19:13994066-13994088 GTCCCCCTGCAGTGACGGGTTGG - Intronic
1163023763 19:14497474-14497496 GCCCCTCTGCAGGTCCTGGTGGG - Intergenic
1163152901 19:15425335-15425357 GTCCTCCTGCAGGGGCCGCTTGG + Exonic
1163272692 19:16263601-16263623 GGCCGGCTTCAGGGCCCGCTGGG + Intergenic
1164156881 19:22602478-22602500 GGCACCCTGCAGGGCCCGGTGGG - Intergenic
1164423569 19:28119431-28119453 GGTCCCCTGCAGGGTCCAGATGG + Intergenic
1164576689 19:29409289-29409311 GGGCTCCTGCAGGGCCTGGCCGG + Intergenic
1165342838 19:35224888-35224910 CGCCCCCAGCAGGGCCAGGACGG + Exonic
1166301349 19:41913564-41913586 GGCCTCCTGCAGGGCGCTGGGGG - Intronic
1166368939 19:42291007-42291029 GGACCCCTGCTGGGCACTGTGGG + Exonic
1167433920 19:49468364-49468386 GGCTACCTGCAGGGACAGGTGGG - Exonic
1167660695 19:50794467-50794489 GGCCCCCTGGAGGGCCAGCAGGG - Exonic
926251872 2:11159417-11159439 GGGACCCTGCTGGGCACGGTGGG + Intronic
926914019 2:17876646-17876668 GGCTCCCTGCAGGGCTCAGCAGG + Intergenic
927698394 2:25252392-25252414 GCCCCGCTGGAGGGCCTGGTTGG + Intronic
927843326 2:26458608-26458630 GACCCTCAGCAGGGCCCGGTGGG - Intronic
928420161 2:31132097-31132119 GGCCTCCTGCAGGGACCTGGGGG + Intronic
928437694 2:31266342-31266364 GGCACCCTGCACGGCCCCTTTGG + Exonic
930028800 2:47045891-47045913 GGTCCCATGCTGGGCCCTGTGGG + Intronic
930781086 2:55225185-55225207 GGCCACCTGCAGGTCCGTGTGGG + Intronic
932421475 2:71603998-71604020 TGCCCCCTGCAGGGCCAAGCAGG + Intronic
932621932 2:73269715-73269737 GGCCCCCTGCGGGGTCAGGAAGG + Exonic
932827243 2:74952866-74952888 GGCTCTGTGCAGGGCCCTGTAGG + Intergenic
934553727 2:95276869-95276891 CGGCTCCTGCAGAGCCCGGTGGG + Intronic
934735601 2:96688364-96688386 GGACCCCTGCAGGCCCCAGTGGG + Intergenic
937203116 2:120218502-120218524 GGGCCCTGGCAGGGCCAGGTGGG + Intergenic
939629582 2:144516655-144516677 GGCCCCGCGCGGGGTCCGGTGGG - Intronic
942559753 2:177207925-177207947 GGTCCCCTTCAGTGCCCTGTTGG - Intergenic
948055779 2:235008351-235008373 GCCTCCCTGCAGGGCCCAGGAGG + Intronic
948208899 2:236178216-236178238 CGCCCCCTGCGGGCCGCGGTGGG + Intergenic
948600037 2:239102460-239102482 GGCTCCCTGCAGGGCAGGGCGGG + Intronic
948873621 2:240816442-240816464 GGACCCCTCCAGGGCACTGTGGG + Intronic
948916560 2:241037374-241037396 TGCCCCCAGCAGGGCCCCGTGGG - Intronic
949008594 2:241665635-241665657 GTCCCACTGCAGGCCCCGGATGG - Intronic
1168819028 20:761233-761255 GGCCACCTGCGGGGCCGGGAGGG + Exonic
1168892634 20:1304961-1304983 GGCCTCCTTCAGGGCCAGCTGGG - Exonic
1173838395 20:46140286-46140308 CGCCCCCTGCAGAGCCCCATGGG - Intergenic
1174357766 20:50009902-50009924 GGCCCCCTCCTCGGCCCGGCAGG - Intergenic
1175800080 20:61796531-61796553 GGGCCACTACAGGGCCCGGGAGG - Intronic
1175843780 20:62048394-62048416 GGCCACCTGCAAGGCCTGGCTGG + Intronic
1175998989 20:62823815-62823837 GGCCCCCTGCAGTGCCGGCCGGG + Intronic
1176202107 20:63865743-63865765 GGCCCCGCGCAGGGACCGGGGGG - Intronic
1180156838 21:45982109-45982131 GGCCCCGGCCAAGGCCCGGTGGG - Intronic
1180229217 21:46416546-46416568 GGGCCCCGGAAGAGCCCGGTCGG + Exonic
1180353971 22:11824160-11824182 GGCCCAGTGCAGGGCCTGATGGG + Intergenic
1180384274 22:12168165-12168187 GGCCCAGTGCAGGGCCTGATGGG - Intergenic
1182472411 22:30556621-30556643 CGCCCCCACCAGGGCCCCGTTGG + Intronic
1183701003 22:39451047-39451069 GGGCCCCTGCTGGTCCAGGTAGG - Intergenic
1184649959 22:45915191-45915213 AGCCCCCTGCCAGGCCCAGTGGG - Intergenic
1184717721 22:46291361-46291383 GGCCTTCTGCGGGGCCCAGTGGG + Intronic
1184733175 22:46382026-46382048 GGCCCCCTGCTGAGGCCGGCTGG - Exonic
1185231343 22:49685959-49685981 GGCCACCTGCAGAGCCTGGGAGG - Intergenic
1185340190 22:50287614-50287636 GGCCCCAGGCCGGGCCAGGTGGG - Intronic
950007970 3:9703773-9703795 GGCCGCCCGCAGGGCCGGGCGGG + Intergenic
950124796 3:10504697-10504719 TGCCCCCTGCAGGGTCAGGATGG - Intronic
950282396 3:11719449-11719471 GGTCCCCCGCAGGGCCAGGCCGG - Intronic
950408142 3:12817207-12817229 GGCTTCCTGCAGGCCCTGGTAGG + Exonic
950435043 3:12974444-12974466 GTCCCCCTGCAGAGCCTAGTTGG + Intronic
950649576 3:14398877-14398899 AGCTCCCTGCAAGGGCCGGTAGG + Intergenic
952982676 3:38750912-38750934 GGCATCCTGCAGGGCTCGCTGGG - Intronic
954214592 3:49117242-49117264 GGCCTCCTGCTTAGCCCGGTGGG + Exonic
954837462 3:53482323-53482345 GGCCACCTTCAGAGCCCTGTGGG + Intergenic
955186395 3:56718977-56718999 GGCCCCCTGGAGTTCCGGGTGGG + Intergenic
955911519 3:63863724-63863746 CGCCCGCTGCACGGCCCGCTGGG - Intronic
961012812 3:123447718-123447740 GGCCGCCAGCACGGCCAGGTAGG + Exonic
963082783 3:141409920-141409942 GAGCCCCTGCAGGGCTGGGTTGG + Intronic
967043056 3:185711640-185711662 GGCCACCTGCTGAGCCAGGTAGG - Intronic
968007877 3:195255354-195255376 AGCCCCCAGCAGGACCCAGTCGG + Intronic
968660918 4:1798359-1798381 GGCCCCCTTGAGGGCCCGCCTGG + Intronic
968709266 4:2101432-2101454 GGCAGCCTGCATGGCCCGGACGG + Intronic
968920454 4:3519617-3519639 GGGACCCAGCAGGGCCTGGTGGG - Intronic
969029783 4:4202720-4202742 GGCCCCCTGCCTGGCTGGGTGGG + Intronic
974096181 4:57367038-57367060 GGTCCCCTGCAGGGCCACTTTGG - Intergenic
979398812 4:120222337-120222359 GGCCCTATGCAGGCCCCGATAGG + Intergenic
985527556 5:414958-414980 GGCCCCCGCCTGGGCCCTGTGGG - Intronic
985539801 5:482653-482675 GGCCCCGCGCAGGCCCCCGTAGG + Exonic
985639949 5:1058922-1058944 GGGCCCCTCCTGGGCCAGGTGGG - Intronic
985699284 5:1360937-1360959 GGGCCCCTGCAGGGACCCCTTGG - Intergenic
987088070 5:14487787-14487809 GGCCGCCTGCTGGGCGCGCTGGG - Exonic
997608733 5:135195359-135195381 TGCCCTCTTCAGGGCCCGGCTGG + Intronic
998095630 5:139394336-139394358 GGCCCCCTGCAGGCCGCCGCGGG - Exonic
999696199 5:154190524-154190546 GGCATCCTGCAGCGCCCGGGCGG + Intronic
1001308778 5:170595502-170595524 GGCTCCCTGCAGGACCCTCTGGG + Intronic
1001942435 5:175750307-175750329 GGCCCCTTGCAGGTTCTGGTTGG - Intergenic
1002563463 5:180097641-180097663 GGCCCTCTGCAGGCCCTGCTGGG - Intergenic
1002700170 5:181118562-181118584 GGCCCTCTGCAGGGGCCGCCTGG + Intergenic
1002836764 6:871167-871189 GGCCCCTTGTGGGGCCCTGTGGG - Intergenic
1003425219 6:5994553-5994575 CACCCCCTGCAGGGCCCTTTTGG - Intergenic
1004909349 6:20268099-20268121 GGCCACCTGCAGTGCCACGTTGG - Intergenic
1005834080 6:29694762-29694784 AGCCTCCTGCAGGGCCAGGATGG + Intergenic
1006151704 6:31993408-31993430 GACCCACTGCAGGGCCAGGTGGG - Exonic
1006158005 6:32026146-32026168 GACCCACTGCAGGGCCAGGTGGG - Exonic
1006348535 6:33503076-33503098 GGCCCCCTGCAGGATCCATTAGG + Intergenic
1006494603 6:34413312-34413334 GGCCTCCTGCAGGGCAGTGTGGG - Intronic
1013420531 6:109962636-109962658 TGGCCACTGCAGGGCCTGGTGGG + Intergenic
1014452376 6:121596281-121596303 CTCCCAGTGCAGGGCCCGGTTGG - Intergenic
1014535718 6:122610817-122610839 GGCCACCTGCAGGGCAGAGTGGG - Intronic
1015880554 6:137867019-137867041 GGGCGCCTGCAGGGACCGGGCGG + Intergenic
1019215566 6:170440676-170440698 CGCGCCTTGCAGGGGCCGGTGGG - Intergenic
1019337375 7:491779-491801 GGCCTCCTTCAGTGCCCGCTCGG + Intergenic
1019429223 7:991031-991053 GGTCCCCTGCAGGGCCGGGAGGG - Intergenic
1019579147 7:1751488-1751510 GTCCCTCTCCAGGGCCCCGTGGG - Intergenic
1027029045 7:74875022-74875044 GGCTCCCGGCAGGCCCGGGTGGG - Intergenic
1029280952 7:99435149-99435171 GGACCCCTGTAGAGCCAGGTGGG - Exonic
1031887342 7:127255262-127255284 GGCCAGCTGCAGGGCCAGTTGGG + Intergenic
1032495208 7:132356197-132356219 GACCCACTGGAGGGCCCAGTTGG - Intronic
1034962745 7:155372704-155372726 TGCCCCCCGCAGCGCGCGGTCGG - Intergenic
1035074772 7:156170074-156170096 GGCTCCCTGCAGAGACCGGCTGG - Intergenic
1035238898 7:157517455-157517477 TGCCCTCTGCGGGGCCCGGCTGG + Intergenic
1036752364 8:11451307-11451329 GGCCCGCAGCTGGGCCCCGTGGG + Intronic
1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG + Intronic
1037910549 8:22741347-22741369 GGACCCCAGCAGGCCCTGGTGGG - Intronic
1039454583 8:37698349-37698371 GGCTCCCGGCAGGGCCGTGTGGG - Exonic
1043982484 8:86658071-86658093 GGCCCCCTGCAGGGCCGGGTGGG + Intronic
1044926585 8:97214483-97214505 CACCCTCTGCAGGGCCCTGTGGG - Intergenic
1045335997 8:101205241-101205263 GGCCACCTGCAGGGCCTGGCAGG + Exonic
1048963867 8:139601076-139601098 GCCCTCCTGCAGGGCCCGGCGGG - Intronic
1049374084 8:142280862-142280884 GGCCCCATACAGGGCCTGCTGGG - Intronic
1049495047 8:142926107-142926129 GGCCACCTGCATGGCCCAGTGGG - Intergenic
1049701986 8:144019516-144019538 GGCCCCGTGCACGGGCAGGTGGG + Intronic
1051629253 9:19127355-19127377 GGCCCCCAGCGGCGCCCAGTTGG - Intronic
1053021981 9:34701434-34701456 CGCCCCCTGCAGGCCCAGGAAGG - Intergenic
1053066282 9:35071886-35071908 AGGCCCCAGCCGGGCCCGGTGGG - Intronic
1060757264 9:126222966-126222988 GTCCCCCTCCAGGGCCCTGCCGG - Intergenic
1060820921 9:126661318-126661340 GGCCCCCTTCAAGGCCCTGTTGG + Intronic
1060827787 9:126696377-126696399 GGCTCCCTGCAGGCCCGCGTGGG + Exonic
1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG + Exonic
1062058894 9:134483960-134483982 GGCCTTCTCCAGGGCACGGTGGG + Intergenic
1062165908 9:135107113-135107135 GGCCTCCTCCCCGGCCCGGTGGG + Intronic
1062171545 9:135137499-135137521 GGCCCCCCACAGGGCCAGGGCGG - Intergenic
1062355906 9:136162185-136162207 GGCTCCCTGGAGGGCTGGGTGGG - Intergenic
1185466545 X:358409-358431 CTCCGCCTGCAGGGCCGGGTCGG + Intronic
1187915475 X:24149550-24149572 GGCCCCCTCCTCCGCCCGGTGGG - Intronic
1191253271 X:58269265-58269287 GGCCCGATGCAGGGCTTGGTGGG + Intergenic
1192223454 X:69212746-69212768 AGCTCCCTGGAGGGCCTGGTGGG - Intergenic
1199699164 X:150363680-150363702 GGCCGCCCGCAGCGCCAGGTGGG - Intronic
1200251387 X:154556100-154556122 GGGCCCAGGCAGGGCCCGGCAGG + Intronic
1200266380 X:154648316-154648338 GGGCCCAGGCAGGGCCCGGCAGG - Intergenic
1202372897 Y:24210330-24210352 GGCCTCCTGCAGGGCCCAGTGGG + Intergenic
1202497885 Y:25459790-25459812 GGCCTCCTGCAGGGCCCAGTGGG - Intergenic