ID: 1061062559

View in Genome Browser
Species Human (GRCh38)
Location 9:128257995-128258017
Sequence GGCCCCCTGCAGGGCCCGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 6, 1: 4, 2: 4, 3: 33, 4: 274}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061062549_1061062559 17 Left 1061062549 9:128257955-128257977 CCCATGCCAGGAGAGACTCATTC 0: 1
1: 0
2: 2
3: 11
4: 132
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274
1061062547_1061062559 27 Left 1061062547 9:128257945-128257967 CCCTTCTTGACCCATGCCAGGAG 0: 1
1: 0
2: 4
3: 21
4: 133
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274
1061062550_1061062559 16 Left 1061062550 9:128257956-128257978 CCATGCCAGGAGAGACTCATTCA 0: 1
1: 1
2: 1
3: 17
4: 159
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274
1061062545_1061062559 30 Left 1061062545 9:128257942-128257964 CCACCCTTCTTGACCCATGCCAG 0: 1
1: 0
2: 8
3: 22
4: 221
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274
1061062553_1061062559 -7 Left 1061062553 9:128257979-128258001 CCTGCAGCTTCTCCATGGCCCCC 0: 6
1: 3
2: 9
3: 65
4: 454
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274
1061062551_1061062559 11 Left 1061062551 9:128257961-128257983 CCAGGAGAGACTCATTCACCTGC 0: 1
1: 1
2: 2
3: 16
4: 179
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274
1061062548_1061062559 26 Left 1061062548 9:128257946-128257968 CCTTCTTGACCCATGCCAGGAGA 0: 1
1: 0
2: 2
3: 16
4: 142
Right 1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG 0: 6
1: 4
2: 4
3: 33
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061062559 Original CRISPR GGCCCCCTGCAGGGCCCGGT GGG Exonic