ID: 1061064244

View in Genome Browser
Species Human (GRCh38)
Location 9:128267469-128267491
Sequence TCAGGTTAGCAGACGATGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061064237_1061064244 2 Left 1061064237 9:128267444-128267466 CCAGGGCCTCTTACCTCCAGATC 0: 17
1: 24
2: 4
3: 30
4: 268
Right 1061064244 9:128267469-128267491 TCAGGTTAGCAGACGATGCAGGG 0: 1
1: 1
2: 3
3: 30
4: 64
1061064235_1061064244 9 Left 1061064235 9:128267437-128267459 CCACGGCCCAGGGCCTCTTACCT 0: 9
1: 8
2: 22
3: 27
4: 293
Right 1061064244 9:128267469-128267491 TCAGGTTAGCAGACGATGCAGGG 0: 1
1: 1
2: 3
3: 30
4: 64
1061064238_1061064244 -4 Left 1061064238 9:128267450-128267472 CCTCTTACCTCCAGATCCTTCAG 0: 12
1: 33
2: 4
3: 24
4: 273
Right 1061064244 9:128267469-128267491 TCAGGTTAGCAGACGATGCAGGG 0: 1
1: 1
2: 3
3: 30
4: 64
1061064231_1061064244 26 Left 1061064231 9:128267420-128267442 CCTGCAGGGTCACTGGGCCACGG 0: 1
1: 0
2: 3
3: 24
4: 214
Right 1061064244 9:128267469-128267491 TCAGGTTAGCAGACGATGCAGGG 0: 1
1: 1
2: 3
3: 30
4: 64
1061064236_1061064244 3 Left 1061064236 9:128267443-128267465 CCCAGGGCCTCTTACCTCCAGAT 0: 18
1: 24
2: 5
3: 22
4: 196
Right 1061064244 9:128267469-128267491 TCAGGTTAGCAGACGATGCAGGG 0: 1
1: 1
2: 3
3: 30
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061064244 Original CRISPR TCAGGTTAGCAGACGATGCA GGG Exonic
901230321 1:7638298-7638320 GCAGGATATCAGACGCTGCAGGG - Intronic
901353486 1:8620771-8620793 TCAGGCAAGCAGAAGAGGCAGGG - Intronic
904787824 1:32995845-32995867 GCAGGTTGGCAGAGGGTGCAAGG + Intergenic
907557289 1:55355420-55355442 TCAGGTTAGCAGGCGTTGTGTGG + Intergenic
908124610 1:61017791-61017813 TAAGGTTAGCAAAAGATCCAGGG + Intronic
911214691 1:95179328-95179350 CCAGGTTGGCAAACCATGCATGG + Intronic
921683265 1:218059713-218059735 TAAGGATAGAAGACGGTGCAGGG + Intergenic
1065918473 10:30371076-30371098 TCAGGGTAGCAGATGATGCAGGG + Intronic
1074250013 10:111735638-111735660 TCAGGTGAGCAGAGGGGGCATGG + Intergenic
1085051752 11:73383561-73383583 TCAGGTTGGCAAACACTGCAAGG + Intronic
1094346803 12:29479336-29479358 TAAGGTTAGCATACGCTGTATGG - Intronic
1101316979 12:103638209-103638231 ACAGGTGAGCAAATGATGCAGGG + Exonic
1106586583 13:31062243-31062265 ACAGGTGAGGAGAGGATGCAGGG + Intergenic
1112753877 13:102609101-102609123 TCAGGTAACCACACCATGCAAGG + Intronic
1114534494 14:23414172-23414194 TCAGGATATCAGATGAAGCAGGG - Intronic
1119606302 14:76021004-76021026 CCAGGCTCGCAGACTATGCATGG + Intronic
1121917630 14:97850709-97850731 TCAGCTTAGCAGAATGTGCAAGG + Intergenic
1123472368 15:20564951-20564973 TCAGGGTAGCAGATGATGTAGGG - Intergenic
1123634143 15:22286401-22286423 TCAGGCGAGCAGAAGAGGCAGGG + Intergenic
1123645635 15:22435402-22435424 TCAGGGTAGCAGATGATGTAGGG + Intergenic
1123666888 15:22614967-22614989 TCAGGGTAGCAGATGATGTAGGG + Intergenic
1123732673 15:23159942-23159964 TCAGGGTAGCAGATGATGTAGGG - Intergenic
1123750806 15:23357322-23357344 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124283177 15:28381238-28381260 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124299522 15:28530375-28530397 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124320728 15:28709540-28709562 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124481765 15:30085809-30085831 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124488221 15:30137907-30137929 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124521826 15:30411392-30411414 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124536838 15:30554827-30554849 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124543312 15:30606881-30606903 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124563269 15:30794333-30794355 TCAGGGTAGCAGATGATGTAGGG - Intergenic
1124755305 15:32400413-32400435 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124761814 15:32452764-32452786 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124776815 15:32596304-32596326 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124960017 15:34386900-34386922 TCAGGGTAGCAGATGATGTAGGG + Intronic
1124976646 15:34533121-34533143 TCAGGGTAGCAGATGATGTAGGG + Intronic
1125182424 15:36892441-36892463 TCAGGTTTGCAGAGCATGCCAGG - Exonic
1126879995 15:53084153-53084175 TCAGGGTGGCAGAGGCTGCAAGG + Intergenic
1129029337 15:72607297-72607319 TTAGGGTAGCAGATGATGCAGGG - Intergenic
1129895684 15:79104210-79104232 TAACGTCAGCAGAGGATGCAGGG - Intergenic
1130062150 15:80577813-80577835 ACAGATTAGCAGACATTGCAGGG + Intronic
1130259945 15:82346838-82346860 GCAGGGTAGTAGAGGATGCACGG + Exonic
1130268780 15:82432598-82432620 GCAGGGTAGTAGAGGATGCACGG - Exonic
1130281283 15:82522171-82522193 CCAGGGTAGTAGAGGATGCACGG - Intergenic
1130472658 15:84238354-84238376 CCAGGGTAGTAGAGGATGCACGG - Exonic
1130480149 15:84352925-84352947 CCAGGGTAGTAGAGGATGCACGG - Intergenic
1130484380 15:84390496-84390518 CCAGGGTAGCAGATGATGCACGG - Intergenic
1130491620 15:84435204-84435226 CCAGGGTAGTAGAGGATGCACGG + Intergenic
1130503235 15:84514244-84514266 CCAGGGTAGTAGAGGATGCACGG + Intergenic
1130594953 15:85242988-85243010 CCAGGGTAGTAGAGGATGCACGG - Intergenic
1132433607 15:101779375-101779397 TCAGGGTAGCAGATGATGTAGGG + Intergenic
1132639096 16:969597-969619 TGAGGGAAGCAGACGATGGAAGG + Intronic
1135664665 16:24325743-24325765 TCAGGTTTGCAGAGCAGGCATGG + Intronic
1136011952 16:27369281-27369303 TAATGTTAGCAGACTAGGCATGG - Intergenic
1149749423 17:59130717-59130739 TAATGTTAACAGACGATGCTTGG + Intronic
1159869439 18:73743823-73743845 TCAGGTTAGAAGACGGTGGGAGG - Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1167417304 19:49381751-49381773 ACAGGAGAGCAGACCATGCAGGG + Intergenic
926234630 2:11029970-11029992 TCAGGTAGGCACACGATGCCTGG - Intergenic
928374307 2:30762630-30762652 TCAGGTAAGCAGGTGATGCCAGG - Intronic
929782297 2:44964928-44964950 TCAGGACAGCAAACAATGCAGGG - Intergenic
935503732 2:103873200-103873222 TTAGGTTAGCAGACGAAGGAAGG - Intergenic
935699861 2:105802099-105802121 TCAGATTTGCAGACGATGCATGG + Intronic
946865270 2:224036777-224036799 ACAGGTGAGCTGAGGATGCAGGG + Intronic
1170433502 20:16298774-16298796 TCTGGTTTTCAGAAGATGCAGGG + Intronic
1177902468 21:26933783-26933805 TCAGGTTATCTGATGATGAATGG + Intronic
1180956148 22:19742268-19742290 TCAGGTGAGCAGACAGTGCCTGG - Intergenic
950422043 3:12904989-12905011 TCAGGTCAGCAAGAGATGCAGGG + Intronic
952119162 3:30220738-30220760 GGAGGTGAGCAGACGCTGCAGGG + Intergenic
961103196 3:124219605-124219627 TCAGGTTAGCAGAGGCTCCTGGG + Intronic
966956751 3:184888457-184888479 TCAGGTTAGCAGACATATCATGG - Intronic
967156868 3:186700811-186700833 TCAGGTGATCAGACAATGTAAGG + Intergenic
968654062 4:1771122-1771144 TCTGGGTAGCAGAGGAGGCAGGG + Intergenic
969610702 4:8226327-8226349 TCAGGTTTTCAGACCATCCAAGG + Intronic
982083213 4:151810028-151810050 CCAGATTAGCAGACAATGCAAGG - Intergenic
994021238 5:95028539-95028561 TCAATTTAGCAGACAATCCACGG - Intronic
995857705 5:116610836-116610858 TCGGGTTAGCAGTCCAGGCATGG - Intergenic
997580275 5:135012596-135012618 TCAGGTTAGCAGAAAATGCATGG + Intergenic
1000153253 5:158524463-158524485 TTTGGTTGGCAGATGATGCAAGG + Intergenic
1010177662 6:73048455-73048477 TCAGGGTAGCAGAGGCTACATGG - Intronic
1021459774 7:20873038-20873060 TCAAGTTCCCAGATGATGCAGGG + Intergenic
1022451879 7:30523418-30523440 TCAGGGTAGCAGATGATGTAGGG + Intronic
1029464541 7:100716930-100716952 CAAGGTGAGCAGAGGATGCAGGG + Intergenic
1032528280 7:132597022-132597044 TGACTTTAGCAGACTATGCATGG - Intronic
1038441710 8:27575270-27575292 TCAGTGTAGCAGTCGAGGCAGGG + Intergenic
1043982754 8:86659857-86659879 TCAGGTTAGCAGATGATGCAGGG + Intronic
1048700376 8:137082017-137082039 TCTGGTTACCAGGGGATGCAAGG - Intergenic
1052563833 9:30120802-30120824 TCAGGTTACCAGACACTGCAAGG + Intergenic
1061064244 9:128267469-128267491 TCAGGTTAGCAGACGATGCAGGG + Exonic
1188141386 X:26556682-26556704 TCATATTAGCAGCCTATGCAAGG + Intergenic
1188405690 X:29806600-29806622 TCAGGTGAGCAGACAAGCCAAGG + Intronic
1192263304 X:69522276-69522298 TCAGGTGAGCAGAGGAGTCAGGG - Intronic
1202305524 Y:23466077-23466099 TCAGGTGAGCAGAAGAGGCTGGG + Intergenic
1202366689 Y:24170682-24170704 CCAGGGTAGCAGATGATGCAGGG - Intergenic
1202373715 Y:24214800-24214822 CCAGGGTAGCAGATGATGCATGG + Intergenic
1202497066 Y:25455320-25455342 CCAGGGTAGCAGATGATGCATGG - Intergenic
1202504093 Y:25499441-25499463 CCAGGGTAGCAGATGATGCAGGG + Intergenic
1202565285 Y:26204512-26204534 TCAGGTGAGCAGAAGAGGCTGGG - Intergenic