ID: 1061067150

View in Genome Browser
Species Human (GRCh38)
Location 9:128285668-128285690
Sequence GTGACCCTGGCCACAGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 347}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061067150_1061067155 -4 Left 1061067150 9:128285668-128285690 CCCTCAGCTGTGGCCAGGGTCAC 0: 1
1: 0
2: 2
3: 29
4: 347
Right 1061067155 9:128285687-128285709 TCACATGGTACCACTGTGGCTGG No data
1061067150_1061067158 19 Left 1061067150 9:128285668-128285690 CCCTCAGCTGTGGCCAGGGTCAC 0: 1
1: 0
2: 2
3: 29
4: 347
Right 1061067158 9:128285710-128285732 CAACCCCACCCTAAGGAGACAGG No data
1061067150_1061067157 12 Left 1061067150 9:128285668-128285690 CCCTCAGCTGTGGCCAGGGTCAC 0: 1
1: 0
2: 2
3: 29
4: 347
Right 1061067157 9:128285703-128285725 TGGCTGGCAACCCCACCCTAAGG No data
1061067150_1061067154 -8 Left 1061067150 9:128285668-128285690 CCCTCAGCTGTGGCCAGGGTCAC 0: 1
1: 0
2: 2
3: 29
4: 347
Right 1061067154 9:128285683-128285705 AGGGTCACATGGTACCACTGTGG No data
1061067150_1061067159 20 Left 1061067150 9:128285668-128285690 CCCTCAGCTGTGGCCAGGGTCAC 0: 1
1: 0
2: 2
3: 29
4: 347
Right 1061067159 9:128285711-128285733 AACCCCACCCTAAGGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061067150 Original CRISPR GTGACCCTGGCCACAGCTGA GGG (reversed) Intronic
900437715 1:2639466-2639488 GAGAGCCTGGTCACAGCAGAAGG - Intronic
900712450 1:4122932-4122954 GTGACCATGACCACAGCGGCAGG + Intergenic
900724801 1:4208916-4208938 GAGTCCCTGGCCTCACCTGATGG + Intergenic
902163950 1:14554295-14554317 GTGAACCTGGGCAGAGCTGGGGG + Intergenic
902551843 1:17224004-17224026 TTGACCCTGGCCCTGGCTGAAGG - Intronic
902605711 1:17568145-17568167 GTGTCCCAGGCTAGAGCTGAAGG - Intronic
902747915 1:18485389-18485411 GTGTTCCAGGCCCCAGCTGATGG + Exonic
902993522 1:20206020-20206042 GTGGCCTTGGCCACTGCAGAAGG - Intergenic
903540244 1:24092677-24092699 GTGATTCTGGCCACTGCTTAGGG - Intronic
903579445 1:24359771-24359793 CTGACCATGGCCAAAGCTGGTGG - Intronic
903799687 1:25957434-25957456 CTGTCCCTGGCCATAGCTGCAGG - Intergenic
904401640 1:30260498-30260520 GGGACCACTGCCACAGCTGAAGG - Intergenic
905562389 1:38937797-38937819 GTGACCCAGTATACAGCTGAGGG + Intronic
905905829 1:41617969-41617991 GTGACCCTGGTCTCAGCTTAGGG - Intronic
907911312 1:58829091-58829113 ATCACTCTGGCCACAGTTGAGGG + Intergenic
908660656 1:66431848-66431870 TTAACCCTGCCCACACCTGATGG - Intergenic
908669868 1:66534064-66534086 GTGACGCGGTCCAAAGCTGAAGG + Intronic
912260969 1:108111394-108111416 GAGAGGCTGGCCACAGCTGAGGG - Intergenic
913163549 1:116166283-116166305 GTGCCCCTGGCCACATTTGTAGG + Intergenic
913349524 1:117842457-117842479 GTCACACTGGCCCCATCTGATGG - Intergenic
913960433 1:143334646-143334668 ATCGCCCTGGCCACAGCTGTAGG - Intergenic
914054789 1:144160219-144160241 ATCGCCCTGGCCACAGCTGTAGG - Intergenic
914124357 1:144806142-144806164 ATCGCCCTGGCCACAGCTGTAGG + Intergenic
920250023 1:204617374-204617396 GTGACCCCAGCCAGATCTGAAGG - Exonic
1064135450 10:12746766-12746788 GTGAGCCACGCCACAGCTGGGGG + Intronic
1064364663 10:14696844-14696866 GTGTCCCTGGGCACAGCCTACGG - Intronic
1065439792 10:25739724-25739746 TTGTCCCTGGCAAAAGCTGAGGG + Intergenic
1070313817 10:75293055-75293077 CTAACCCTTGCCACAACTGATGG - Intergenic
1072697654 10:97615860-97615882 GTGATCCTAGCCCCAGCTTAGGG - Exonic
1074507207 10:114081913-114081935 GTCACCTTGCCCACAGCAGAAGG - Intergenic
1075252315 10:120890797-120890819 GTGATCTTGGCCTCAGATGATGG + Exonic
1076152669 10:128175350-128175372 GTGACCCAGGCCACATGTGCTGG - Intergenic
1076539384 10:131204556-131204578 GTGACTGTGGCCACCGCTGCTGG - Intronic
1076816411 10:132917162-132917184 CTCACCCTGACCCCAGCTGAGGG + Intronic
1076836508 10:133023727-133023749 GTGTTCCAGGCCACAGCGGAAGG + Intergenic
1076907201 10:133368700-133368722 GTGACTGTGCCCACATCTGATGG - Intronic
1078934936 11:15941879-15941901 GTGAGCCAGGCCACAGCCCAGGG + Intergenic
1079116994 11:17646250-17646272 GTGACCCTGGCCACAGCTCTTGG + Intronic
1079347045 11:19662310-19662332 GTGACTCTGACCACAGCAAACGG - Intronic
1080041377 11:27762956-27762978 GTGGCCATGTCCACAGCCGAGGG - Intergenic
1081526808 11:43933281-43933303 GTGTCCCTGTCCACATATGAGGG + Intronic
1083822736 11:65182045-65182067 TTGACCCTGGCCACTGCTCCTGG + Intronic
1084795534 11:71502255-71502277 GGGACACAGACCACAGCTGAGGG + Intronic
1085049073 11:73370608-73370630 GCCTCCCTGCCCACAGCTGATGG - Intergenic
1085312082 11:75522759-75522781 CTGAGCCTGCCCCCAGCTGAGGG + Intronic
1085478129 11:76800558-76800580 GTGAGCTGGGCCACAGCTGACGG - Intergenic
1085729637 11:78985846-78985868 GGGAGCCTGGGCAAAGCTGATGG - Intronic
1087894949 11:103576754-103576776 GGGGCCCTGGCCAAGGCTGATGG + Intergenic
1088280545 11:108130250-108130272 CTGCCTCTGGCCAGAGCTGATGG - Intronic
1088462596 11:110097420-110097442 GTGACCCAGGCAAAAGGTGAGGG - Intronic
1088663895 11:112074731-112074753 GTGGCCTGGGCCACAGGTGAGGG + Exonic
1091590577 12:1840637-1840659 GTGGCCCTGGCCACATGTGCAGG + Intronic
1091785789 12:3242678-3242700 GTGACTCAGGCCTCAGCTGGAGG + Intronic
1091937825 12:4447320-4447342 GGGACCCAGGGCACAGCAGAAGG - Intergenic
1095176303 12:39095939-39095961 CTAACCCTGCCCCCAGCTGATGG + Intergenic
1097167455 12:57093391-57093413 GTGCCCATGCCCACAGCTGTGGG + Exonic
1097234629 12:57530735-57530757 GAAAACCTGGCCACAGTTGAGGG - Exonic
1100979425 12:100153304-100153326 GTGTCCCTGGCCCCAGCTGAAGG + Intergenic
1101964569 12:109273648-109273670 GTGACCCTGGCGGCAACTAAAGG - Intergenic
1102536116 12:113582810-113582832 CTGACCCAGGTCACAGCTGAGGG - Intergenic
1102719721 12:115005683-115005705 ATCACCCTGTCCCCAGCTGAAGG + Intergenic
1102720100 12:115008525-115008547 ATCACCCTGTCCCCAGCTGAAGG - Intergenic
1103845670 12:123900557-123900579 GTGACCCTGGACAAGGATGATGG - Intronic
1103912497 12:124360138-124360160 CTGACGCTGGCCAAAGCTGCTGG + Intronic
1104021533 12:124995163-124995185 GTGCCCCTGCCCACAGGAGAGGG - Intronic
1107064266 13:36195653-36195675 GTGATCCAGGCAAGAGCTGATGG + Intronic
1107423252 13:40269212-40269234 ATGACACTGGCCAGAGCTGCAGG + Intergenic
1108225407 13:48284520-48284542 GGGACCTTGGCCACAGCTGTAGG - Intergenic
1113767086 13:112888423-112888445 GTGACCCTGCCCACTGCCCAAGG + Intergenic
1113881677 13:113630429-113630451 GTGGCCCTGGGAGCAGCTGACGG - Intronic
1113930716 13:113967555-113967577 GGGACGCTGGGCAGAGCTGACGG + Intergenic
1113964146 13:114142962-114142984 GTGACCCTGGCTCCTGCTGCAGG + Intergenic
1114424952 14:22613741-22613763 GTGGTCCAGGCCAGAGCTGATGG + Intergenic
1118582870 14:67321699-67321721 GTTACCCTGGCCTCATGTGACGG - Intronic
1119677790 14:76568966-76568988 AGGACCCTGGCCCCAGGTGAGGG + Intergenic
1121261502 14:92569538-92569560 GTGAGCCTGTCCCCAGCTGGAGG + Intronic
1121312380 14:92942117-92942139 CACACCCTGGCAACAGCTGAAGG - Intronic
1121573005 14:94961740-94961762 GCTACCCAGGCCACAGCTGATGG - Intergenic
1122036175 14:98950726-98950748 GTGAGCCTGGCCACAGGGGTTGG + Intergenic
1122714602 14:103687868-103687890 GTGACCCTGGACACTGCGGCAGG - Intergenic
1122810528 14:104285470-104285492 AGGACCCTGGCCACTGCTCACGG - Intergenic
1124089520 15:26585100-26585122 GTGCCCCAGGCCACAGCGGGTGG + Intronic
1127256976 15:57300773-57300795 GAGACCCCGGCCACAGCGGGAGG - Intergenic
1128980012 15:72179230-72179252 GTGACCCTGGCCACAGCCAGCGG + Intronic
1129388975 15:75211071-75211093 CTCACCCTGCCCACAGCTGCTGG + Exonic
1129631701 15:77267249-77267271 CTAACCCTGTCCACATCTGATGG + Intronic
1129658011 15:77537471-77537493 AAGACCGTGGGCACAGCTGAGGG + Intergenic
1129786957 15:78315995-78316017 GAGACCCTGGCCACTGCAGAGGG - Intergenic
1133345947 16:5070574-5070596 GTGTCCCTGGGCTCAGCTCAGGG - Intronic
1135590635 16:23702506-23702528 CTGACCCTGGCCCCCGCAGATGG - Exonic
1136040350 16:27573963-27573985 GTGTCCCTGGCGAGGGCTGATGG + Intronic
1136393441 16:29979430-29979452 GTGATCCTGGCCATGGATGAGGG + Exonic
1137478766 16:48833646-48833668 GTGGCCATGGCCACAGCAGGTGG + Intergenic
1138583418 16:57956069-57956091 GAGGCCCTGGCCACAGCTGGCGG + Intronic
1138760827 16:59541977-59541999 GTGAGTGTGGCCACAGATGATGG - Intergenic
1140388837 16:74567316-74567338 GTGAGCCAGGCCAGAGCTGAGGG - Intronic
1140447540 16:75043214-75043236 ATGAAGCTGGCCACAGCTCAGGG - Intronic
1140998018 16:80279844-80279866 GAGACCCTGTGGACAGCTGATGG + Intergenic
1142522236 17:513130-513152 GTGACCCTGGCCGCTCCTGGTGG - Exonic
1143109023 17:4543284-4543306 GCGACCCAGGCCACAGAGGAGGG + Intronic
1143112103 17:4558616-4558638 GTGGGCCTGGGCACAGCCGAGGG + Exonic
1144329954 17:14214159-14214181 TTGATCCTGGCCACAGCTCTTGG + Intergenic
1144586098 17:16488747-16488769 GCACCCCTGGCCACAGCTCAGGG + Intronic
1144617141 17:16787150-16787172 ATGACCCAGCCCACAGCAGATGG - Intronic
1144643806 17:16954830-16954852 GTCTCCTTGGACACAGCTGAGGG + Intronic
1144887957 17:18476859-18476881 GGGAGCCTGGCAACCGCTGAAGG - Exonic
1144895553 17:18528523-18528545 ATGACCCAGCCCACAGCAGATGG + Intergenic
1145136663 17:20415707-20415729 ATGACCCAGCCCACAGCAGATGG - Intergenic
1145204981 17:20979555-20979577 GTCTCCTTGGACACAGCTGAGGG - Intergenic
1145313201 17:21711772-21711794 TTGACTCTGTCCACAGCTGGTGG - Intergenic
1147742137 17:42675644-42675666 CTGACCCGGGCCACAGCACACGG + Intronic
1151476077 17:74344993-74345015 TTGACCCAGGCAACAGCGGAGGG + Intronic
1151752113 17:76045208-76045230 ATGACCCAGCCCACAGCAGATGG - Intronic
1152252932 17:79221168-79221190 GTGGCACTGGCCAGAGATGATGG - Intronic
1152401886 17:80071355-80071377 GCTGCCGTGGCCACAGCTGAGGG - Intronic
1159671827 18:71229758-71229780 GTGAGCCTGGCCTAATCTGAAGG - Intergenic
1160427914 18:78790868-78790890 GTGGCCCTCCCCACAGCTGGCGG - Intergenic
1160797554 19:952950-952972 GTGACCTTGGGCACTGCTGGGGG + Intronic
1160975147 19:1789387-1789409 GTGACCCTGGCCATCGGGGACGG - Exonic
1161315302 19:3614749-3614771 CCCACCCTGGCCACAGCGGAGGG + Intronic
1161410130 19:4112494-4112516 CTGACCGTGGCCACAGCACAGGG + Intronic
1162716894 19:12639959-12639981 GTGATCCTGGCCCCAGCAGGGGG + Intronic
1163020115 19:14477208-14477230 GGGACCCTGGCCAGACCTGGAGG - Intergenic
1163782242 19:19256696-19256718 GTCACCCTGGCGACAGCTTCGGG + Exonic
1163991986 19:21007410-21007432 GGGACACTGGCCAAAGCTGGTGG + Intergenic
1164503763 19:28841321-28841343 GTGACTCTGTGCAAAGCTGAAGG + Intergenic
1165119853 19:33552057-33552079 GTGGACCAGGCCACAGCCGAAGG + Intergenic
1165245604 19:34496806-34496828 GCGACCCTGCCGACAGCTGTGGG + Intronic
1165834210 19:38744359-38744381 GCTACCTTGGCCACAACTGAAGG - Exonic
1167036690 19:46999084-46999106 GTGTCCCAGGCCCCCGCTGAAGG - Intronic
1167172397 19:47842072-47842094 CTGACCCTGGCTGCTGCTGACGG - Exonic
1167212156 19:48139964-48139986 GTGGCCCAGGCCACAGGTAAGGG - Exonic
1167674479 19:50875879-50875901 GTGGCCCGGCCCACAGCTCAGGG - Intronic
925060379 2:885811-885833 GAGTTCCTGGCCAAAGCTGAGGG + Intergenic
927207274 2:20618486-20618508 GTCACCCAGGCTACAGCTTAGGG + Exonic
927281986 2:21317158-21317180 CTGAAACTGGGCACAGCTGAAGG - Intergenic
932476177 2:72007584-72007606 GAGACCCCGGCCAGACCTGAGGG + Intergenic
932698817 2:73979135-73979157 GTGGTCCTGTCCACAGCTGAGGG + Intergenic
933952290 2:87341671-87341693 ATCGCCCTGGCCACAGCTGTAGG + Intergenic
934236531 2:90238010-90238032 ATCGCCCTGGCCACAGCTGTAGG + Intergenic
935810334 2:106791240-106791262 CTGACCCTGACCACAGCAGAGGG - Intergenic
937849446 2:126619811-126619833 GTGACTCTGCCCACAGCTCCCGG - Intergenic
938116535 2:128606330-128606352 GAAAGCCTGGCCACACCTGAGGG - Intergenic
938116556 2:128606447-128606469 GAAAGCCTGGCCACACCTGAGGG - Intergenic
938116564 2:128606486-128606508 GAAAGCCTGGCCACACCTGAGGG - Intergenic
938116572 2:128606525-128606547 GAAAGCCTGGCCACACCTGAGGG - Intergenic
939682895 2:145160845-145160867 GTGACCCAGGCCAATGGTGAAGG + Intergenic
939897197 2:147806509-147806531 TTGATCCTGCCCTCAGCTGAAGG - Intergenic
946449093 2:219764399-219764421 GTGAACCTGGCCAAAGCATATGG - Intergenic
947460513 2:230299987-230300009 CTAACCCTGCCCCCAGCTGATGG + Intronic
947529305 2:230898720-230898742 GAGCCCCTGGCCCCAGCTGGGGG - Intergenic
948818442 2:240525890-240525912 GTGACCCTTCCCACCCCTGAGGG - Intronic
948979012 2:241483284-241483306 GTGACCAAGGGCACTGCTGAGGG + Intronic
1171386681 20:24774181-24774203 GGGACCCTGGCCAGAGCTACTGG - Intergenic
1172243801 20:33431874-33431896 GTGACCCTGGCTGCTGCTGGTGG - Intronic
1172520145 20:35560810-35560832 ACCACCCTGGCCACAGCAGATGG + Intergenic
1178509708 21:33194147-33194169 GTGACCCTGCCCAGAGCCTAGGG + Intergenic
1178678777 21:34654021-34654043 GTGATCCAGGCCACAGATGAAGG + Intergenic
1179318503 21:40268456-40268478 GTGCCACTGGCCACAGGGGAAGG + Intronic
1180917475 22:19499185-19499207 GTGCACCTGGCCACAGCACAGGG - Intronic
1180984534 22:19896698-19896720 GTGAAGCTGGCCACAGCTTCTGG + Intronic
1180994894 22:19960644-19960666 GTGCCCCTGTCCACAGCTGCAGG - Intronic
1181633836 22:24165212-24165234 GTGCCCCAGGCCCCAGCTGGAGG - Intronic
1182280111 22:29213648-29213670 GTGACCCTGTGCAGGGCTGAGGG - Intronic
1183256745 22:36767248-36767270 GAGACCCTGGGCCCAGCTGGGGG + Intronic
1183371696 22:37436157-37436179 GTCACCCTGGCCACAGCAATTGG - Intergenic
1183599137 22:38829933-38829955 GTGACACTGGACACTGCTGGTGG + Intronic
1183740207 22:39664841-39664863 GTGTCCCTGGCCTCAGCCGGGGG + Exonic
1184175946 22:42788761-42788783 GTGTCCTTGGCCCCAGCAGAAGG - Intergenic
1184692548 22:46123803-46123825 GCCACCCTGCCCACTGCTGATGG - Intergenic
949209222 3:1477983-1478005 GTGGACCTCACCACAGCTGAAGG + Intergenic
950416660 3:12872818-12872840 GTGACCCTGCCCACTACTGATGG + Intergenic
950466052 3:13154236-13154258 GTGACCCTGCCCACTAATGATGG - Intergenic
954129780 3:48554520-48554542 GTGGCTCTGGCCTGAGCTGAGGG - Intronic
954317414 3:49808664-49808686 GTGACCCTGTCCTCACCTGCAGG + Intronic
954711346 3:52506523-52506545 GTGTCGTTGGCCAGAGCTGAAGG + Intronic
955994732 3:64668328-64668350 GTGACACTAGCCACATCTCAAGG + Intronic
959227453 3:103603641-103603663 GTGACTCTGGACACCACTGAGGG + Intergenic
960042154 3:113161662-113161684 GGGACACTGGCCTCATCTGAAGG - Intergenic
961313080 3:126016219-126016241 GTGGACCTGGGCTCAGCTGAAGG + Intronic
961360597 3:126364879-126364901 CTGCCCCTGGCCACAGCAAATGG - Intergenic
961861374 3:129919128-129919150 GTGACCCTGCCCACTACTGATGG + Intergenic
962091205 3:132246039-132246061 GTGACCCTAGCCAAACCTCAAGG + Intronic
962241617 3:133755305-133755327 GTGAGGCTGGCCACAGCCAATGG - Intronic
962370058 3:134813869-134813891 GTGACACAGGGCCCAGCTGATGG - Intronic
963355109 3:144201615-144201637 GTTACCTTGGACACATCTGATGG + Intergenic
964306687 3:155348186-155348208 GTGACCCTAGCCATGGCTCAAGG - Intergenic
968382930 4:110590-110612 GTGACACTGGCCAGAGCAAAGGG + Intergenic
968911673 4:3479635-3479657 GTGACCCTGGCCCAAGGCGATGG + Intronic
970421691 4:15910972-15910994 GTGCCCCTGCCCTCAGCAGAGGG + Intergenic
971357566 4:25908796-25908818 GTGCCTGTGGTCACAGCTGATGG - Intronic
971748067 4:30610915-30610937 GTGTCCCTGCCCACATCTCATGG - Intergenic
975691427 4:76967987-76968009 GTGAGCAGGCCCACAGCTGAGGG + Intronic
977762767 4:100759229-100759251 CTAACCCTGGCCCCACCTGATGG + Intronic
978721752 4:111918056-111918078 GTGACCCTGGGCAGGGCTGCAGG + Intergenic
981139881 4:141255345-141255367 GTAACCCTGGCCACAGAGGAAGG - Intergenic
985570786 5:643687-643709 GGGACCCTGGCCGCAGGTGCTGG + Intronic
986259905 5:6134975-6134997 CTGAGCCTGGCCTCTGCTGAAGG + Intergenic
986428202 5:7655412-7655434 GTGACCCAGGCCAAATCTGAAGG + Intronic
987793967 5:22604912-22604934 GTGTCACTGACCAGAGCTGATGG - Intronic
991587717 5:68216407-68216429 GCGACCCTGGCTGCAGCTGGAGG - Intronic
994819683 5:104633408-104633430 GTAACCCTGCCCAAAGCTGAGGG + Intergenic
996508010 5:124289273-124289295 CTGGCCCTGGCCACGGCTCAAGG - Intergenic
997609837 5:135208119-135208141 CTGAGCCTGGCCACAGCTGGGGG - Intronic
997762663 5:136464368-136464390 GTCAGTCTGGCCACAGCCGAGGG + Intergenic
998262879 5:140644620-140644642 GGGGCCCTGGCCACAGCCGCTGG - Exonic
998274659 5:140741216-140741238 GTGAGCCTAGACACAGCTGGGGG + Intergenic
998589574 5:143463396-143463418 ATGACCCTGGCTTCCGCTGAAGG + Intergenic
999227113 5:150034814-150034836 GTGACTCTCGCCAGAGATGAAGG - Intronic
999642541 5:153686377-153686399 GGGACTCTGGCCAGAGCTGAGGG + Intronic
1001975208 5:175993231-175993253 GTCACGCTGGCCAGAGGTGATGG - Intronic
1002242223 5:177850539-177850561 GTCACGCTGGCCAGAGGTGATGG + Intergenic
1002351217 5:178585067-178585089 GTGCTGCCGGCCACAGCTGAAGG - Intronic
1002476346 5:179468718-179468740 GCGACCCTGGGCAGAGATGATGG - Intergenic
1003119445 6:3307694-3307716 GTGACACTGTCCACAGCAGCTGG + Intronic
1003331596 6:5133991-5134013 TTGACCCTTTCCTCAGCTGAAGG + Intronic
1003569924 6:7248918-7248940 CCAATCCTGGCCACAGCTGATGG + Exonic
1003999760 6:11586769-11586791 GTGACTATGTGCACAGCTGATGG - Intergenic
1006286333 6:33097203-33097225 CTAACCCTGTCCACACCTGAGGG + Intergenic
1006517636 6:34553636-34553658 GGGGCCCTGGGCACAGGTGAGGG + Intronic
1006670752 6:35728447-35728469 GTGTGCCTGGCCACACCTGTCGG - Intronic
1007340103 6:41185970-41185992 GTGCTCCTGGCCTCAGGTGAGGG - Intergenic
1013512343 6:110856563-110856585 GTCTCCCTAGCCACAGCTGATGG - Intronic
1014088375 6:117373500-117373522 GTGCCCCTCTCCACAGCTGCTGG + Intronic
1016581194 6:145630662-145630684 CTCAGCCTGGCCACAGCTGGAGG + Intronic
1017939310 6:159037001-159037023 GTGCCCATGGCCACAGCTGCTGG - Exonic
1018573025 6:165230582-165230604 GTGACCTTGGTCAGAGCTTATGG - Intergenic
1019120625 6:169801133-169801155 GCGTCCCTGGCCAGAGCTGTCGG - Intergenic
1019579753 7:1755522-1755544 AGGACACTGGGCACAGCTGAAGG - Intergenic
1021598277 7:22340134-22340156 GTTTGCCTGGCCCCAGCTGAGGG - Intronic
1024360697 7:48464379-48464401 GTGTTTCTGGCCACAGCTGTAGG + Intronic
1024705028 7:51947645-51947667 GTGGCCCTGGCAGCAGGTGATGG + Intergenic
1024736618 7:52312085-52312107 GTGACACAAGCCACATCTGAAGG + Intergenic
1026472686 7:70707696-70707718 GCGACTCTGGCCACAGGTGATGG - Intronic
1029670395 7:102026295-102026317 GTTACCCTAGCCACAGTTCAAGG - Intronic
1030418166 7:109271687-109271709 CTGCTCCTGACCACAGCTGAGGG + Intergenic
1032792086 7:135249912-135249934 CTGCTTCTGGCCACAGCTGAGGG - Intronic
1032874571 7:136023841-136023863 CCAACACTGGCCACAGCTGAAGG - Intergenic
1033367877 7:140685032-140685054 GAGACCCTGGGCAGAGCTGAGGG + Intronic
1034339374 7:150341828-150341850 CTGACCCTGGCCGCGGCTGCAGG + Intergenic
1034508770 7:151518426-151518448 GTGCACCGGGCCACAGTTGAGGG - Intronic
1035136552 7:156709045-156709067 CTGACCTTGCCCCCAGCTGATGG + Intronic
1035473733 7:159128185-159128207 TGGACCCTGGGCACAGCTGCTGG - Intronic
1035848911 8:2894244-2894266 CTGACCCTGGGGTCAGCTGAGGG + Intergenic
1038933112 8:32217368-32217390 GTGACCCTGCCCACACCTAACGG + Intronic
1039948508 8:42150306-42150328 GTGACCCAGGCGAGAGGTGATGG - Intergenic
1041960444 8:63609459-63609481 CTGACCCAGGCCACAGCTTCAGG + Intergenic
1042599169 8:70481054-70481076 GCAGCCCTGGCCACAGCTGGTGG - Intergenic
1044146669 8:88724695-88724717 CTGACACTGACCTCAGCTGATGG - Intergenic
1044219156 8:89649486-89649508 GAGACCAGGGCCACATCTGAAGG + Intergenic
1046569298 8:115942872-115942894 GCTACCCTGGCCACAGGTGATGG + Intergenic
1049683234 8:143929076-143929098 GTGCACCTGGCCACAGGCGAGGG - Intronic
1049805352 8:144536336-144536358 GAGGCCCTGGCCACACCTGGTGG - Intronic
1051835605 9:21334684-21334706 GTGACCCTGGTACCAGGTGATGG - Exonic
1052350886 9:27457341-27457363 CTGAATCTGGCCACAGCTGTTGG - Intronic
1052833717 9:33235215-33235237 GTGACCCAGGCCACACCTCCTGG + Intronic
1054866851 9:70011551-70011573 GTGACAGAGGCCACAGCTGGTGG - Intergenic
1055593331 9:77840842-77840864 GTGACCCTGGGCTCAGATAAAGG - Intronic
1056543504 9:87594362-87594384 GGGACCCTGGCTCCAGCTAAAGG - Intronic
1057230625 9:93319428-93319450 GGGGCCCAGGCCACAGCTGGCGG - Intronic
1059500944 9:114753646-114753668 GTGCCCCTGGCCCCTGCTGTTGG - Intergenic
1059910812 9:119041799-119041821 GTGAAGCTAGCCATAGCTGAAGG + Intergenic
1060027878 9:120188296-120188318 GTGACCCTGGAGAGAGATGATGG - Intergenic
1061067150 9:128285668-128285690 GTGACCCTGGCCACAGCTGAGGG - Intronic
1061117952 9:128626542-128626564 GTCAGCCTGGGCAGAGCTGAGGG - Exonic
1061312759 9:129774899-129774921 ACCACCATGGCCACAGCTGATGG + Intergenic
1061534635 9:131239894-131239916 GAGACCCAGGCCCCAGCAGACGG + Intergenic
1061715108 9:132514058-132514080 GTGTCCCTGACCACAGGTGATGG + Intronic
1061766288 9:132883627-132883649 GAAACTCTGTCCACAGCTGAGGG + Intronic
1062339757 9:136088748-136088770 GGTCCCCTGGCCACAGATGAGGG + Intronic
1062573155 9:137194685-137194707 GAGCCCCGGGCCCCAGCTGAGGG - Intronic
1187981750 X:24764848-24764870 GTGATCCTGGCCAGAGATGATGG - Intronic
1189387026 X:40545491-40545513 GCGGCCCTGGCCATAGCTAAGGG - Intergenic
1189639320 X:43050847-43050869 CTAACCCTGCCCACACCTGATGG - Intergenic
1190305573 X:49079807-49079829 CTGACCCGGGCCCCAGCTGTCGG + Exonic
1192107761 X:68332489-68332511 AAGAACCTGGCCACAGCCGAGGG + Intronic
1196899285 X:120367356-120367378 GTGTCCCTGGCCCCAGCTTGTGG + Intronic
1197648564 X:129041918-129041940 GTGACCTGGGCCACAGCAGCAGG + Intergenic
1199913730 X:152315877-152315899 CTAACCCTGCCCCCAGCTGATGG + Intronic
1200300495 X:154969706-154969728 GTGACCTTGGCAAGAGCTGTTGG - Intronic
1201993588 Y:20057393-20057415 TTGACTCTGGACACATCTGAAGG - Intergenic
1201994085 Y:20064121-20064143 GAAACCCTGGACACATCTGAAGG + Intergenic
1201994277 Y:20066883-20066905 GAAACTCTGGCCACATCTGAAGG + Intergenic
1201996388 Y:20095175-20095197 GAAACTCTGGCCACATCTGAAGG - Intergenic
1201996457 Y:20096179-20096201 GAAACTCTGGCCACATCTGAAGG - Intergenic
1201996546 Y:20097303-20097325 GAAACTCTGGCCACATCTGAAGG - Intergenic
1201996588 Y:20097802-20097824 GAAACTCTGGCCACATCTGAAGG - Intergenic
1201998201 Y:20119125-20119147 GAAACTCTGGCCACATCTGAAGG - Intergenic
1201998769 Y:20126357-20126379 GAAACTCTGGCCACATCTGAAGG - Intergenic
1201998908 Y:20128234-20128256 GAAACCCTGGACACATCTGAAGG - Intergenic
1201999085 Y:20130730-20130752 GAAACCCTGGACACATCTGAAGG - Intergenic
1201999500 Y:20136486-20136508 GTAACTCTGGACACAACTGAAGG - Intergenic
1202000876 Y:20154952-20154974 GAAACTCTGGCCACATCTGAAGG - Intergenic
1202001087 Y:20157841-20157863 GAAACTCTGGCCACATCTGAAGG - Intergenic
1202001311 Y:20160708-20160730 GAAACCCTGGACACATCTGAAGG - Intergenic
1202002399 Y:20175331-20175353 GAAACCCTGGACACATCTGAAGG - Intergenic
1202002703 Y:20179465-20179487 GAAACCCTGGACACATCTGAAGG - Intergenic
1202002837 Y:20181223-20181245 GAAACCCTGGACACATCTGAAGG - Intergenic
1202002918 Y:20182344-20182366 GAAACCCTGGACACATCTGAAGG - Intergenic
1202003032 Y:20183847-20183869 GAAACCCTGGACACATCTGAAGG - Intergenic
1202003122 Y:20184970-20184992 GAAACCCTGGACACATCTGAAGG - Intergenic
1202003455 Y:20189359-20189381 GAAACCCTGGACACAACTGAAGG - Intergenic
1202003581 Y:20191109-20191131 GAAACCCTGGACACATCTGAAGG - Intergenic
1202003737 Y:20193114-20193136 GAAACCCTGGACACATCTGAAGG - Intergenic
1202003747 Y:20193239-20193261 GAAACCCTGGACACATCTGAAGG - Intergenic
1202003917 Y:20195502-20195524 GAAACCCTGGACACATCTGAAGG - Intergenic
1202003947 Y:20195877-20195899 GAAACCCTGGACACATCTGAAGG - Intergenic
1202003999 Y:20196501-20196523 GAAACCCTGGACACATCTGAAGG - Intergenic
1202004052 Y:20197126-20197148 GAAACCCTGGACACATCTGAAGG - Intergenic
1202004117 Y:20198001-20198023 GAAACCCTGGACACATCTGAAGG - Intergenic
1202004140 Y:20198252-20198274 GAAACCCTGGACACATCTGAAGG - Intergenic
1202004208 Y:20199127-20199149 GAAACCCTGGACACATCTGAAGG - Intergenic
1202004219 Y:20199253-20199275 GAAACCCTGGACACATCTGAAGG - Intergenic
1202004251 Y:20199629-20199651 GAAACCCTGGACACATCTGAAGG - Intergenic
1202004323 Y:20200629-20200651 GTAACTCTGGACACATCTGAAGG - Intergenic
1202004354 Y:20201004-20201026 GAAACCCTGGACACATCTGAAGG - Intergenic
1202004404 Y:20201629-20201651 GAAACCCTGGACACATCTGAAGG - Intergenic
1202004454 Y:20202254-20202276 GAAACCCTGGACACAGGTGAAGG - Intergenic
1202004591 Y:20204129-20204151 GAAACCCTGGACACATCTGAAGG - Intergenic
1202004683 Y:20205379-20205401 GAAACCCTGGACACAGGTGAAGG - Intergenic
1202004820 Y:20207254-20207276 GAAACCCTGGACACATCTGAAGG - Intergenic
1202004858 Y:20207754-20207776 GAAACCCTGGACACATCTGAAGG - Intergenic
1202004881 Y:20258096-20258118 GTAACTCTGGACACATCTGAAGG - Intergenic
1202005925 Y:20271671-20271693 GAAACCCTGGACACATCTGAAGG - Intergenic
1202006905 Y:20284891-20284913 GAAACCCTGGACACATCTGAAGG - Intergenic
1202006948 Y:20285391-20285413 GAAACCCTGGACACATCTGACGG - Intergenic
1202007086 Y:20287267-20287289 GTAACTCTGGACACATCTGAAGG - Intergenic
1202007116 Y:20287642-20287664 GAAACCCTGGACACATCTGAAGG - Intergenic
1202007339 Y:20290643-20290665 GTAACTCTGGACACATCTGAAGG - Intergenic
1202007369 Y:20291018-20291040 GAAACCCTGGACACATCTGAAGG - Intergenic
1202007448 Y:20292018-20292040 GAAACCCTGGACACACCTGAAGG - Intergenic
1202007489 Y:20292518-20292540 GAAACCCTGGACACATCTGAAGG - Intergenic
1202007516 Y:20292892-20292914 GAAACCCTGGACACATCTGAAGG - Intergenic
1202007626 Y:20294391-20294413 GAAACCCTGGACACATCTGAAGG - Intergenic
1202008332 Y:20303863-20303885 GAAACCCTGGACACATCTGAAGG - Intergenic
1202009197 Y:20315082-20315104 GAAACCCTGGACACATCTGAAGG - Intergenic
1202009301 Y:20316456-20316478 GAAACCCTGGACACATCTGAAGG - Intergenic
1202009313 Y:20316581-20316603 GAAACCCTGGACACATCTGAAGG - Intergenic
1202009362 Y:20317206-20317228 GAAACCCTGGACACATCTGAAGG - Intergenic
1202009633 Y:20320836-20320858 GAAACCCTGGACACATCTGAAGG - Intergenic
1202009671 Y:20321336-20321358 GAAACCCTGGACACATCTGAAGG - Intergenic
1202009757 Y:20322461-20322483 GAAACCCTGGACACATCTGAAGG - Intergenic
1202009776 Y:20322711-20322733 GAAACCCTGGACACATCTGAAGG - Intergenic
1202009827 Y:20323336-20323358 GAAACCCTGGACACATCTGAAGG - Intergenic
1202009884 Y:20324086-20324108 GAAACCCTGGACACATCTGAAGG - Intergenic
1202009924 Y:20324586-20324608 GAAACCCTGGACACATCTGAGGG - Intergenic
1202009956 Y:20324961-20324983 GAAACCCTGGACACATCTGAAGG - Intergenic
1202010076 Y:20326586-20326608 GAAACCCTGGACACATCTGAAGG - Intergenic
1202010132 Y:20327336-20327358 GAAACCCTGGACACATCTGAAGG - Intergenic
1202010166 Y:20327836-20327858 GTAACTCTGGACACATCTGAAGG - Intergenic
1202010197 Y:20328211-20328233 GAAACCCTGGACACATCTGAAGG - Intergenic
1202010248 Y:20328836-20328858 GAAACCCTGGACACATCTGAAGG - Intergenic
1202010299 Y:20329461-20329483 GAAACCCTGGACACATCTGAAGG - Intergenic
1202010379 Y:20330461-20330483 GAAACCCTGGACACACCTGAAGG - Intergenic
1202010420 Y:20330961-20330983 GAAACCCTGGACACATCTGAAGG - Intergenic
1202010447 Y:20331335-20331357 GAAACCCTGGACACATCTGAAGG - Intergenic
1202010557 Y:20332834-20332856 GAAACCCTGGACACATCTGAAGG - Intergenic
1202010817 Y:20336334-20336356 GTAACTCTGGACACATCTGAAGG - Intergenic
1202010847 Y:20336709-20336731 GAAACCCTGGACACATCTGAAGG - Intergenic
1202010927 Y:20337709-20337731 GAAACCCTGGACACACCTGAAGG - Intergenic
1202010965 Y:20338209-20338231 GTAACTCTGGACACATCTGAAGG - Intergenic
1202010996 Y:20338584-20338606 GAAACCCTGGACACATCTGAAGG - Intergenic
1202011046 Y:20339209-20339231 GAAACCCTGGACACATCTGAAGG - Intergenic
1202011096 Y:20339834-20339856 GAAACCCTGGACACAGGTGAAGG - Intergenic
1202011195 Y:20341208-20341230 GAAACCCTGGACACATCTGAAGG - Intergenic
1202011260 Y:20342083-20342105 GAAACCCTGGACACATCTGAAGG - Intergenic
1202011292 Y:20342459-20342481 GAAACCCTGGACACATCTGAAGG - Intergenic
1202011364 Y:20343460-20343482 GAAACCCTGGACACATCTGAAGG - Intergenic
1202011418 Y:20344210-20344232 GAAACCCTGGACACATCTGAAGG - Intergenic
1202011524 Y:20345584-20345606 GAAACCCTGGACACATCTGAAGG - Intergenic
1202011638 Y:20347084-20347106 GAAACCCTGGACACATCTGAAGG - Intergenic
1202011766 Y:20348709-20348731 GAAACCCTGGACACATCTGAAGG - Intergenic
1202037218 Y:20647337-20647359 GGGGCCCTGGCCAAGGCTGATGG + Intergenic
1203336230 Y_KI270740v1_random:3459-3481 TTGACTCTGGACACATCTGAAGG - Intergenic
1203337251 Y_KI270740v1_random:17227-17249 GAAACTCTGGCCACATCTGAAGG - Intergenic
1203337742 Y_KI270740v1_random:23751-23773 GAAACTCTGGCCACATCTGAAGG - Intergenic
1203338113 Y_KI270740v1_random:28766-28788 GAAACTCTGGCCACATCTGAAGG - Intergenic
1203338155 Y_KI270740v1_random:29265-29287 GAAACTCTGGCCACATCTGAAGG - Intergenic
1203338525 Y_KI270740v1_random:34154-34176 GAAACTCTGGCCACATCTGAAGG - Intergenic