ID: 1061067151

View in Genome Browser
Species Human (GRCh38)
Location 9:128285669-128285691
Sequence TGTGACCCTGGCCACAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061067151_1061067157 11 Left 1061067151 9:128285669-128285691 CCTCAGCTGTGGCCAGGGTCACA 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1061067157 9:128285703-128285725 TGGCTGGCAACCCCACCCTAAGG No data
1061067151_1061067155 -5 Left 1061067151 9:128285669-128285691 CCTCAGCTGTGGCCAGGGTCACA 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1061067155 9:128285687-128285709 TCACATGGTACCACTGTGGCTGG No data
1061067151_1061067158 18 Left 1061067151 9:128285669-128285691 CCTCAGCTGTGGCCAGGGTCACA 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1061067158 9:128285710-128285732 CAACCCCACCCTAAGGAGACAGG No data
1061067151_1061067154 -9 Left 1061067151 9:128285669-128285691 CCTCAGCTGTGGCCAGGGTCACA 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1061067154 9:128285683-128285705 AGGGTCACATGGTACCACTGTGG No data
1061067151_1061067159 19 Left 1061067151 9:128285669-128285691 CCTCAGCTGTGGCCAGGGTCACA 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1061067159 9:128285711-128285733 AACCCCACCCTAAGGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061067151 Original CRISPR TGTGACCCTGGCCACAGCTG AGG (reversed) Intronic
901197026 1:7445965-7445987 CGTGACCTTGGACACAGCTGTGG + Intronic
901503899 1:9671932-9671954 GGTGACCTTGGCCACAGCAGTGG + Intronic
901755570 1:11439599-11439621 TGTTACCCTGGGCCAAGCTGTGG + Intergenic
902163949 1:14554294-14554316 AGTGAACCTGGGCAGAGCTGGGG + Intergenic
902541812 1:17161157-17161179 TGTGACACTAGCCAAATCTGTGG - Intergenic
902992249 1:20196453-20196475 TGAGGCCCAGGCCTCAGCTGGGG - Intergenic
903440417 1:23383951-23383973 TTTGAACCTGGCCACAGCCAAGG - Intronic
904464461 1:30699683-30699705 TGTGACCCTTTCCTCACCTGGGG + Intergenic
905273441 1:36801839-36801861 TGTTCCCCTAGGCACAGCTGGGG - Exonic
905562388 1:38937796-38937818 TGTGACCCAGTATACAGCTGAGG + Intronic
905765298 1:40595453-40595475 TGGGTCCCTGCCCACAGTTGGGG - Intergenic
905905830 1:41617970-41617992 AGTGACCCTGGTCTCAGCTTAGG - Intronic
907911311 1:58829090-58829112 TATCACTCTGGCCACAGTTGAGG + Intergenic
912260970 1:108111395-108111417 GGAGAGGCTGGCCACAGCTGAGG - Intergenic
913093045 1:115492793-115492815 TGTGATCATGCCCACAGCAGTGG - Intergenic
913273012 1:117112424-117112446 TGTGTCCATGGCCACAGCCTAGG + Exonic
915725379 1:158013651-158013673 TGTGGCTCTGGTCACTGCTGTGG - Intronic
917680558 1:177361883-177361905 TGTGACCATGGACACAGTGGAGG + Intergenic
919177218 1:194033741-194033763 TGTGACCCAGGCTGCACCTGAGG + Intergenic
919817216 1:201449064-201449086 GGTGACCCTGGCCCCAGCACTGG + Intergenic
921075483 1:211697283-211697305 GGTTACCCTGTGCACAGCTGTGG - Intergenic
923335987 1:232970769-232970791 AGTCACACTGGCCACATCTGAGG + Intronic
924547781 1:245046464-245046486 TGGGATCCTGGCCACAGTGGAGG - Intronic
1063042726 10:2359531-2359553 TGTGACACAAGTCACAGCTGTGG - Intergenic
1064135449 10:12746765-12746787 GGTGAGCCACGCCACAGCTGGGG + Intronic
1069570356 10:69491108-69491130 TGTGACCCTGGCCAGGTCTGAGG + Intronic
1070951806 10:80437180-80437202 TGTGACCCTTGCCACTGCTAGGG - Intergenic
1071857116 10:89636831-89636853 TGTGGCTCAGGCCACAGCTTTGG - Intronic
1072548268 10:96457220-96457242 TGTGGTCCTGGCCACAGCCTAGG - Intronic
1072634822 10:97171147-97171169 TCTTACCCTGGCCAAGGCTGCGG + Intronic
1073205691 10:101768194-101768216 TGTGATCCTGGCCACAACGTGGG - Intergenic
1073347842 10:102798035-102798057 TGTGACACAGGACACTGCTGTGG + Exonic
1073989437 10:109245721-109245743 TGTGTCCCCGGCACCAGCTGAGG - Intergenic
1074281577 10:112056629-112056651 AGTGACCTTGGGCACAGCTGTGG - Intergenic
1076107663 10:127836033-127836055 TCTAACCCTGGGCACTGCTGAGG - Intergenic
1076149849 10:128153222-128153244 AGAGACCCTGGACACAGTTGAGG - Intergenic
1076324801 10:129612914-129612936 TGTGCTTCTGGTCACAGCTGCGG + Intronic
1076536665 10:131182352-131182374 TGTGCCCCTGTCCCTAGCTGGGG + Intronic
1076816410 10:132917161-132917183 TCTCACCCTGACCCCAGCTGAGG + Intronic
1076992894 11:284812-284834 TGAAGCCCTGGCCACAGCTCGGG + Intronic
1078277025 11:9858931-9858953 TGTGAGCCAGGCAACAGCTTTGG - Intronic
1078324648 11:10369636-10369658 TGTGACCCTGCCCCCACCTTGGG - Intronic
1078367617 11:10719831-10719853 TGTGAGGCTGGAGACAGCTGGGG - Intergenic
1078823813 11:14907443-14907465 TGTGACAGTGACCCCAGCTGGGG + Intronic
1080654114 11:34245268-34245290 TGCCACCCTGGCGAGAGCTGAGG + Intronic
1082030647 11:47601001-47601023 GCTGGCCCTGGCCCCAGCTGCGG + Intergenic
1083900562 11:65641350-65641372 TGGGACCCTGGCTTCAGCCGAGG + Exonic
1084196185 11:67524466-67524488 AGGGACCCAGGCCACACCTGTGG - Intergenic
1084795533 11:71502254-71502276 TGGGACACAGACCACAGCTGAGG + Intronic
1085665144 11:78408627-78408649 TGTGTCCCTGCCCAAATCTGAGG + Intronic
1085787866 11:79470884-79470906 TTTGTCCCTGCTCACAGCTGGGG - Intergenic
1086223211 11:84475394-84475416 TGTGACACTGGCCATATCTCTGG + Intronic
1087812430 11:102622975-102622997 AGTGTCCCTGCCCAGAGCTGAGG + Intronic
1088250080 11:107854942-107854964 TGGTTCCCTGGCCACAGGTGGGG + Intronic
1088267308 11:108000267-108000289 TGTGCCCCTGTCTACAACTGTGG - Intergenic
1088462597 11:110097421-110097443 TGTGACCCAGGCAAAAGGTGAGG - Intronic
1089281871 11:117380422-117380444 TGTGAACCTAGCCAAAGCTTGGG + Intronic
1090220666 11:125020897-125020919 TGTGAATCTGACCAAAGCTGTGG + Intronic
1090256729 11:125289688-125289710 TGTTACCCGGGCCAGAGCAGGGG + Intronic
1091251057 11:134144657-134144679 TGTGATCCTGGGAACAGCAGTGG + Intronic
1091310917 11:134574634-134574656 TGTGGCCCTGGCCCCCGCTGGGG + Intergenic
1092837561 12:12505292-12505314 TTTTAGCCTGGTCACAGCTGGGG - Intronic
1097167454 12:57093390-57093412 AGTGCCCATGCCCACAGCTGTGG + Exonic
1097234630 12:57530736-57530758 TGAAAACCTGGCCACAGTTGAGG - Exonic
1098707295 12:73706734-73706756 GGTTGCCCTGGCCAGAGCTGAGG - Intergenic
1102525441 12:113509274-113509296 TGCCACCCTGGCCTCAGCAGGGG + Intergenic
1102536117 12:113582811-113582833 CCTGACCCAGGTCACAGCTGAGG - Intergenic
1103440889 12:120962151-120962173 TGTGTCCCTGGCTACAGAAGGGG + Intergenic
1103949172 12:124541958-124541980 TGTGTTCCTGGCCACAGGAGGGG + Intronic
1104264933 12:127222779-127222801 TGAGACCCTGGCCAGGGCTTGGG + Intergenic
1104346088 12:128000377-128000399 TGGGATCCTTGCCACTGCTGGGG + Intergenic
1106094165 13:26628259-26628281 TGTGCCCCTGGCCAAGACTGTGG - Intronic
1106800494 13:33251445-33251467 TCTGATGATGGCCACAGCTGGGG - Intronic
1108422037 13:50260641-50260663 TCTAACCCTGGACACAGCTCAGG + Intronic
1109538911 13:63747014-63747036 TATGGCTCTGGCTACAGCTGTGG + Intergenic
1109544932 13:63832818-63832840 TATGGCTCTGGCTACAGCTGTGG - Intergenic
1112640843 13:101273297-101273319 AGTGACCCTTCCCACAGCTATGG + Intronic
1113092584 13:106630806-106630828 TTTGACCTTGGGCACAGCTGGGG + Intergenic
1116627022 14:47278399-47278421 TGTGAAGCTGGCTACAGCTCTGG + Intronic
1116788355 14:49312545-49312567 TCTGATCTTGGCCACAGCTATGG + Intergenic
1116973386 14:51092505-51092527 TCTGAGCAAGGCCACAGCTGAGG + Intronic
1117593186 14:57298021-57298043 TGTCAGACTGGCAACAGCTGAGG + Exonic
1117985158 14:61379762-61379784 TGTGACCCTGGCTGGAGATGGGG - Intronic
1118119506 14:62823122-62823144 TGTGACCCTGGACTCCTCTGTGG + Intronic
1118702667 14:68449580-68449602 TGTGATCTTGGGGACAGCTGGGG - Intronic
1118764107 14:68898756-68898778 TGTGACCTTGCCCTCAGGTGTGG + Intronic
1118844092 14:69533335-69533357 TGTAATCCTGGCAAAAGCTGTGG + Intergenic
1119032196 14:71201416-71201438 AGAGACCCTGGAAACAGCTGGGG + Intergenic
1119083356 14:71717771-71717793 TCTGTCTCTGGGCACAGCTGTGG - Intronic
1121640462 14:95481675-95481697 TGTGACCCAGGGCAGAGCAGAGG + Intergenic
1122836303 14:104432605-104432627 GGTGACCCTGGCCAGAGCCCTGG - Intergenic
1126777038 15:52109458-52109480 TTTAAACATGGCCACAGCTGGGG - Exonic
1128084692 15:64877739-64877761 CCTGGCGCTGGCCACAGCTGGGG - Intronic
1128234982 15:66061017-66061039 TGCTACCCTGGCCCTAGCTGGGG - Intronic
1128737305 15:70060442-70060464 GAAGACCCTGGCCACAGCTTGGG + Intronic
1129369200 15:75077742-75077764 TCTGATTCTGGCCACTGCTGAGG + Intronic
1129375018 15:75124460-75124482 TCTGATTCTGGCCACTGCTGAGG - Intergenic
1129786958 15:78315996-78316018 TGAGACCCTGGCCACTGCAGAGG - Intergenic
1129959885 15:79674708-79674730 TGTGAGTGTGGCCAAAGCTGAGG - Intergenic
1130952572 15:88604513-88604535 TGTGGCCATGGCAACAGCTTTGG - Intergenic
1131367893 15:91854625-91854647 TGTGGCCCTGGCCTGAGCCGGGG + Intronic
1134150407 16:11800402-11800424 TGTCACCCTGGCCAGAGTTTTGG + Intergenic
1136270683 16:29146536-29146558 TGTGGCCCTGGCCATCCCTGTGG + Intergenic
1140388838 16:74567317-74567339 TGTGAGCCAGGCCAGAGCTGAGG - Intronic
1141165784 16:81660101-81660123 AGTGAGCCGGACCACAGCTGGGG - Intronic
1142074262 16:88108317-88108339 TGTGGCCCTGGCCATCCCTGTGG + Intronic
1142177720 16:88652589-88652611 TGAGGCCCTGGCCCCACCTGGGG + Exonic
1142421046 16:89970309-89970331 TGTGACCCTTGCCAGAAATGTGG - Exonic
1142864843 17:2784611-2784633 TGATCCCCTGGCCACAGGTGAGG + Intronic
1143500233 17:7334668-7334690 TATGATAGTGGCCACAGCTGGGG - Intergenic
1143539119 17:7559012-7559034 GGGGACCCTGCCAACAGCTGTGG - Exonic
1144586097 17:16488746-16488768 TGCACCCCTGGCCACAGCTCAGG + Intronic
1146491626 17:33287531-33287553 TGTTTCCCTGGCATCAGCTGTGG - Intronic
1146729251 17:35180342-35180364 TGGCATCCTGGCCACAGCAGTGG - Intronic
1148786083 17:50146898-50146920 TGTGAGCCTGGACTCAGCAGTGG + Intronic
1150074227 17:62179048-62179070 TGTGACCTTGACACCAGCTGTGG - Intergenic
1150887410 17:69103776-69103798 TGTTACCCTGGGGACAACTGCGG - Intronic
1151685743 17:75645759-75645781 TCCAACCCTGGCCACACCTGGGG + Intronic
1152237989 17:79148386-79148408 TGTCACCCAGGCCCCAGCAGTGG - Intronic
1152278796 17:79373175-79373197 TGAGGCCTGGGCCACAGCTGGGG - Intronic
1152319679 17:79601380-79601402 TGTTCTCCCGGCCACAGCTGGGG - Intergenic
1152586099 17:81190174-81190196 TATGACCCTGGCCACACCTGGGG + Intronic
1152888546 17:82866795-82866817 TGTGGCTCTGTCCACAGCTGGGG + Intronic
1154950068 18:21201464-21201486 TGTATCCCAGGACACAGCTGTGG - Intergenic
1157166912 18:45366229-45366251 TGTGATCGTGGTGACAGCTGTGG - Intronic
1157914783 18:51654560-51654582 TGTCACCCTGCCCAGAACTGGGG + Intergenic
1158064255 18:53386661-53386683 TGAGGCCCTGGGCACTGCTGGGG - Intronic
1158165703 18:54537868-54537890 AGTGACCCTGGCTGCAGTTGTGG - Intergenic
1160272480 18:77399739-77399761 TGAGACCCTGATGACAGCTGAGG + Intergenic
1160605457 18:80046490-80046512 TCTTACCCCGGCCACTGCTGTGG - Intronic
1160797553 19:952949-952971 TGTGACCTTGGGCACTGCTGGGG + Intronic
1160945963 19:1644251-1644273 TGTGGCGCTGGCCCCAGGTGTGG - Intronic
1160980737 19:1815526-1815548 TGTGGCCCTGGCCCCCACTGGGG + Exonic
1161212061 19:3072019-3072041 TGTGTCCCAGGGCACAGCTTGGG + Intergenic
1161228958 19:3163015-3163037 TGTGACCCAGGCCCCACCTGGGG + Exonic
1161251962 19:3285426-3285448 TGTGACCCCGCCCTCTGCTGCGG + Intronic
1161539461 19:4841296-4841318 TCTGACCCAGGCCACAGCATGGG + Intronic
1161699706 19:5787911-5787933 TGACCCCCTGGCCTCAGCTGTGG - Intronic
1162111508 19:8402343-8402365 TGGGGCCCTGGCCACAGCCCTGG + Intronic
1162716893 19:12639958-12639980 TGTGATCCTGGCCCCAGCAGGGG + Intronic
1163281292 19:16319642-16319664 TGTCCCCCTGGGCCCAGCTGTGG - Intergenic
1163328094 19:16618207-16618229 TGTGACCCAGGCAAGAGCTGTGG - Intronic
1163782241 19:19256695-19256717 GGTCACCCTGGCGACAGCTTCGG + Exonic
1164203738 19:23040650-23040672 ATTGACCCTGGGCACAGGTGTGG + Intergenic
1164578187 19:29418325-29418347 TAAGAGCCTGGCCAGAGCTGGGG - Intergenic
1165168872 19:33876754-33876776 TGTGAAACTGGATACAGCTGGGG - Intergenic
1165245603 19:34496805-34496827 AGCGACCCTGCCGACAGCTGTGG + Intronic
1166282446 19:41803334-41803356 TGGTAGCCTGGACACAGCTGAGG + Intronic
1166385481 19:42378285-42378307 TGTGACCCTGGTCCCCGGTGAGG - Intronic
1166749859 19:45159551-45159573 TGCCACCCTGGCCCGAGCTGGGG - Intronic
1166919766 19:46221281-46221303 TGTGACCCTGGAAAGAGATGGGG + Intergenic
1168296408 19:55379142-55379164 GGTGGGCCTGGCCACACCTGAGG - Intergenic
1168414791 19:56161022-56161044 TGGGAGTCTGGGCACAGCTGTGG + Intergenic
925098074 2:1223516-1223538 AATGACTCTGGCCACAGCTGTGG - Intronic
926039490 2:9661534-9661556 TGTGGCCCTGGCCAAGGCTGTGG - Intergenic
926742392 2:16123571-16123593 TGCCACCCTGGTGACAGCTGCGG - Intergenic
926811007 2:16755400-16755422 TGTGGCCATGTCCACAGCTCAGG - Intergenic
927416707 2:22887726-22887748 TGTGACCCAGACCTCAGCAGAGG + Intergenic
928333081 2:30372594-30372616 TGTAACCCCAGCTACAGCTGAGG - Intergenic
928993759 2:37264140-37264162 TGTCAACCTGGCCACATCTAGGG - Intronic
932698816 2:73979134-73979156 TGTGGTCCTGTCCACAGCTGAGG + Intergenic
932776454 2:74530758-74530780 TGAGGCCGTGGTCACAGCTGTGG + Exonic
934249749 2:90340214-90340236 TGCAAACCTGGCCACTGCTGGGG - Intergenic
934259825 2:91463232-91463254 TGCGAACCTGGCCACTGCTGGGG + Intergenic
934864395 2:97792946-97792968 TGTGACCCCGGTCACAGTAGGGG - Exonic
935810335 2:106791241-106791263 GCTGACCCTGACCACAGCAGAGG - Intergenic
936152157 2:110027800-110027822 TGTCCCCCAGGCCACTGCTGCGG - Intergenic
936192521 2:110343613-110343635 TGTCCCCCAGGCCACTGCTGCGG + Intergenic
937809958 2:126188007-126188029 TGTGGTCCGGGCCACATCTGGGG - Intergenic
937885126 2:126894416-126894438 TGGGACCATGGATACAGCTGAGG - Intergenic
938137391 2:128770441-128770463 TGTGGGCCAGGCCAGAGCTGTGG + Intergenic
939816791 2:146906414-146906436 TCTGACCACAGCCACAGCTGTGG + Intergenic
941738319 2:169005229-169005251 TGTGGCCCTGCCCACTGCTTGGG - Intronic
942415590 2:175755854-175755876 TGAGTCCTTGGCCAGAGCTGTGG + Intergenic
943222479 2:185128050-185128072 TGGGACTCTTGCCACAGGTGTGG - Intergenic
945002113 2:205363025-205363047 TCTGCCCCTTGCCAAAGCTGTGG + Intronic
946177459 2:217930299-217930321 TGTGGTCCTGGGCAGAGCTGAGG - Intronic
946491391 2:220152457-220152479 TGTGGCCAAGGCAACAGCTGTGG - Intergenic
946781473 2:223196302-223196324 TCTGACCCTGGGGAAAGCTGAGG - Intronic
947529306 2:230898721-230898743 GGAGCCCCTGGCCCCAGCTGGGG - Intergenic
948835408 2:240623933-240623955 GGTGCCCCAGGCCACTGCTGGGG + Intronic
948946832 2:241224667-241224689 TGTGTCCCAGGCCACAGCAAAGG + Exonic
1168881521 20:1210178-1210200 GGTGATGCTGGCCTCAGCTGAGG + Intergenic
1169804362 20:9544183-9544205 TGGGAGCCTGGCCACCCCTGGGG - Intronic
1170399554 20:15966287-15966309 TGTGACCATGGAGAAAGCTGGGG - Intronic
1170813236 20:19691624-19691646 GGTGAACCTGGCCCCAGCGGAGG + Intronic
1171044689 20:21798774-21798796 TGTGTCACTGGCCAGAGGTGGGG + Intergenic
1172779720 20:37429063-37429085 TGTGACCCTGATCCCAGCTCTGG + Intergenic
1173895247 20:46545971-46545993 TGCCACCCTGGCCATTGCTGTGG - Exonic
1174361264 20:50030142-50030164 TGGGAGCCTGGCCAGAACTGTGG + Intergenic
1175258872 20:57662777-57662799 TGGGCCCCTGGAGACAGCTGGGG - Intronic
1175681456 20:60991825-60991847 TGTGTCTCCGGCCACAGCTCTGG - Intergenic
1175844123 20:62049700-62049722 AGTGACCCTGGTGGCAGCTGTGG - Intronic
1175988616 20:62776718-62776740 AGTGCCCTTGGCCACACCTGTGG + Intergenic
1176521018 21:7824397-7824419 TGTGAGACTGGGGACAGCTGAGG - Intronic
1178655039 21:34454409-34454431 TGTGAGACTGGGGACAGCTGAGG - Intergenic
1179580283 21:42339006-42339028 TGTGGCCCTGGCTAATGCTGTGG - Intergenic
1179981855 21:44899959-44899981 TGGGACCCTGGCCAGAGGCGGGG + Intronic
1180252179 21:46597080-46597102 TGTGTTCCTGGTCAAAGCTGGGG + Intergenic
1180521970 22:16217089-16217111 TGTGAATCTGGACAGAGCTGGGG + Intergenic
1180917476 22:19499186-19499208 TGTGCACCTGGCCACAGCACAGG - Intronic
1181689584 22:24551175-24551197 TGTGAACCTGCCCCCAGCTGGGG + Intronic
1182441421 22:30366519-30366541 AGAGACCGTGGTCACAGCTGTGG - Intronic
1182461291 22:30485767-30485789 TGTGAGCCAGGCCCAAGCTGAGG - Intergenic
1183031980 22:35113374-35113396 TGTGAGGCGGGCCACAGATGTGG - Intergenic
1183123574 22:35752437-35752459 TGTGACTGTGGGCACTGCTGAGG + Intronic
1183255065 22:36756758-36756780 GGTTACCAGGGCCACAGCTGTGG - Intergenic
1183256744 22:36767247-36767269 AGAGACCCTGGGCCCAGCTGGGG + Intronic
1183398814 22:37589029-37589051 TGTGGCCCAGGGCAGAGCTGGGG - Intergenic
1183740206 22:39664840-39664862 GGTGTCCCTGGCCTCAGCCGGGG + Exonic
1183766252 22:39878184-39878206 TGGGAGACTGGACACAGCTGAGG + Intronic
1184260076 22:43309926-43309948 TCTGACCCAGGCCACTGCAGTGG + Intronic
1184345197 22:43908857-43908879 TTTAACCCTGCCCAGAGCTGTGG - Intergenic
1185105110 22:48864337-48864359 GGCGACCCTGGACGCAGCTGGGG + Intergenic
1185159612 22:49215305-49215327 GGTCATCCTGCCCACAGCTGGGG + Intergenic
950545341 3:13634833-13634855 TGTGACCCTGGGCACATTTGTGG + Intronic
951548225 3:23850719-23850741 TGTCACCCATGCCAGAGCTGTGG + Intronic
953252591 3:41260330-41260352 TGAGACCCTGGCAGCAGCTCAGG - Intronic
953625708 3:44569138-44569160 TTTGGCCCAGGCCACAGCAGAGG + Intronic
953908242 3:46879110-46879132 TGTGGCCCCACCCACAGCTGTGG + Intronic
954129781 3:48554521-48554543 TGTGGCTCTGGCCTGAGCTGAGG - Intronic
954259549 3:49428779-49428801 TTTGTCCCTGGCCACAGTTGGGG - Intronic
954303213 3:49712250-49712272 TGTGACCCAGGCCAGAACTCTGG - Intronic
954441048 3:50522079-50522101 TGTGCCCCTGCCCCCAGCTTAGG - Intergenic
954656923 3:52199509-52199531 TGTGACCCTCACCACCACTGTGG - Intronic
954860034 3:53680244-53680266 TGTTTCCCTGGCAACAGCAGTGG + Intronic
955828596 3:62976555-62976577 TGTGACCCAGGCTACAGTGGAGG + Intergenic
959227452 3:103603640-103603662 TGTGACTCTGGACACCACTGAGG + Intergenic
959515654 3:107263869-107263891 TGGGACTCAGGCCTCAGCTGTGG - Intergenic
959582130 3:107992955-107992977 TGTCACCCTGGCCATACTTGGGG + Intergenic
961048772 3:123728665-123728687 TGTGCCCCTTGCCCCAGCTCTGG + Intronic
962273544 3:133995665-133995687 TGTCACCCAGGACACACCTGTGG + Intronic
962901743 3:139767593-139767615 TGTGACCCTTGCCAGGGGTGGGG - Intergenic
963072380 3:141315072-141315094 TGTGCCTATGGTCACAGCTGAGG + Intergenic
963121278 3:141778722-141778744 AGTGACGCTGGCCAAGGCTGAGG + Exonic
963173077 3:142270920-142270942 TGTTACCCTGTCCCCAGGTGTGG + Intergenic
968085524 3:195872297-195872319 AGTGACCCCCGCCACTGCTGGGG - Exonic
968624413 4:1620290-1620312 AGTGTGCCTGGACACAGCTGTGG + Intronic
968631053 4:1651738-1651760 TGTGTCCCTGTCCCCAGCTTTGG - Intronic
968890738 4:3367194-3367216 TGTGAGCCTGGAGGCAGCTGTGG - Intronic
969637809 4:8379450-8379472 GGTGACCCTGGGCTGAGCTGTGG - Intronic
970399891 4:15707078-15707100 TATTATCCTGGCCACAGCTCTGG + Intronic
975691426 4:76967986-76968008 TGTGAGCAGGCCCACAGCTGAGG + Intronic
975736807 4:77389178-77389200 AGTGACCCTAGCCAGAACTGGGG + Intronic
976595048 4:86887623-86887645 TGGGCCACTGCCCACAGCTGTGG - Exonic
985048747 4:185969395-185969417 TGTGACACTGGCCACAGGATGGG + Intergenic
985129697 4:186726878-186726900 TTTCACCCGCGCCACAGCTGCGG - Intergenic
985645960 5:1084892-1084914 TGTGGCCCTGGCTGCTGCTGGGG - Intronic
985763098 5:1761679-1761701 GGGGCACCTGGCCACAGCTGTGG + Intergenic
986439018 5:7762364-7762386 TCTGCCTCTGGCCACACCTGAGG + Intronic
986761243 5:10882059-10882081 TCTCACCCCGGACACAGCTGGGG - Intergenic
986833450 5:11608115-11608137 TGTGAACCTACCCACAGCAGTGG + Intronic
989434656 5:41397296-41397318 TGTAACCATGGCTAGAGCTGGGG - Intronic
992358064 5:76006252-76006274 TGTGACCATGTCCTCAGCTCTGG + Intergenic
994804617 5:104428343-104428365 TGCCATCCTGGTCACAGCTGTGG + Intergenic
994819682 5:104633407-104633429 TGTAACCCTGCCCAAAGCTGAGG + Intergenic
996889018 5:128395163-128395185 TGTGAGCCTGGCCGCTGCTGGGG - Exonic
996967676 5:129323632-129323654 TGTGATCCTAGCCACAGAAGAGG - Intergenic
997602593 5:135150560-135150582 TGTGCCCATGGCCACAGCCAGGG - Intronic
997609838 5:135208120-135208142 GCTGAGCCTGGCCACAGCTGGGG - Intronic
998274658 5:140741215-140741237 AGTGAGCCTAGACACAGCTGGGG + Intergenic
999282848 5:150376224-150376246 GGTGCCCCCAGCCACAGCTGGGG - Exonic
999642540 5:153686376-153686398 AGGGACTCTGGCCAGAGCTGAGG + Intronic
999882693 5:155884130-155884152 TGTCACCCGGGTCACAGCAGAGG - Intronic
1000790914 5:165606013-165606035 TGTGATAGTGGCCACAGTTGGGG + Intergenic
1001478013 5:172064696-172064718 TGAGTCCCTGGCCTCAGCTGGGG - Intronic
1001756395 5:174173693-174173715 TGAGACACTGGCCACCCCTGAGG + Intronic
1002644628 5:180647082-180647104 TGTGACCCAGGTCACAGCAAGGG + Intronic
1004635132 6:17460142-17460164 TGTCACCATTGCCACATCTGGGG + Intronic
1006473817 6:34242852-34242874 TGGCACCATGGCCACGGCTGTGG + Intronic
1008006489 6:46415144-46415166 GGTGACCCTGGCAACTGCGGAGG + Intronic
1009698505 6:67142686-67142708 TGGGACACTGGACACAGCTCAGG + Intergenic
1014145461 6:117993167-117993189 TGGGTGCCTGGCCAGAGCTGGGG + Intronic
1017718996 6:157232149-157232171 TGAGGGCCTGGCCAGAGCTGGGG + Intergenic
1018610254 6:165641656-165641678 TGAGACCCTGAGCACAGCTAAGG + Intronic
1019170762 6:170132084-170132106 TGAGACCCCAGCCTCAGCTGGGG - Intergenic
1019307348 7:342101-342123 TCTGTCCCTGGCCCCAGCTGTGG + Intergenic
1019388784 7:773813-773835 TGTGCCCCTGGCCTCTCCTGCGG - Intronic
1019444292 7:1063188-1063210 GCTGACCCCGGCCACATCTGGGG + Intronic
1019824563 7:3273067-3273089 TGTGACCCTGGCCATAAGAGTGG - Intergenic
1020257457 7:6510142-6510164 TGTGACCCTCACCTCAGCTGTGG - Intronic
1022965108 7:35465369-35465391 TTTGACCCTGGCCACACCTTTGG - Intergenic
1023050778 7:36249290-36249312 AGTGCCCCCGGCCACTGCTGGGG + Intronic
1023665996 7:42524125-42524147 TGTCACCTTGACCAAAGCTGAGG - Intergenic
1024974461 7:55100567-55100589 AGTGACCCTGCTCAAAGCTGTGG + Intronic
1025321303 7:58096645-58096667 TGTACACCTGGCCACTGCTGCGG + Intergenic
1025480473 7:60976689-60976711 TGTACACCTGGCCACTGCTGGGG + Intergenic
1026294873 7:69042421-69042443 TGTTACCCAGACCAGAGCTGGGG + Intergenic
1026831900 7:73615506-73615528 TGTGAAGCTGGGCACAGCAGAGG - Intronic
1029222450 7:99001120-99001142 TGCAACCCTGGTCACAGCTATGG - Intronic
1030266623 7:107628598-107628620 TGTGACACAGGACACTGCTGTGG + Intronic
1031402241 7:121339213-121339235 TGTAACCTCGGCCACAGCAGAGG - Exonic
1033367876 7:140685031-140685053 TGAGACCCTGGGCAGAGCTGAGG + Intronic
1033415582 7:141158634-141158656 AGTGACCCTGTCCACAGGTTCGG - Intronic
1033798425 7:144874275-144874297 TGTCACTATGGCCACATCTGTGG + Intergenic
1034270645 7:149802083-149802105 TGAGGCCCAGGCCACAGCTGCGG - Intergenic
1035295154 7:157863076-157863098 TGGGGCCCTGGACACACCTGGGG + Intronic
1035529723 8:341621-341643 ACAGAACCTGGCCACAGCTGTGG + Intergenic
1039826667 8:41180236-41180258 TATGACCCTAGCCACAGAAGAGG + Intergenic
1040358889 8:46645942-46645964 TGTGGATCTGGCCACAGGTGGGG + Intergenic
1042737442 8:72004986-72005008 TGTGACCCGGGGCCGAGCTGGGG + Intronic
1044776453 8:95693785-95693807 TGTGACCCTTGGTAGAGCTGAGG - Intergenic
1045036239 8:98178545-98178567 TGTGCCCATGGACACTGCTGTGG + Intergenic
1047174372 8:122526685-122526707 TGTGACCTTGGCCATGGGTGGGG - Intergenic
1048216947 8:132504919-132504941 TGTGTTACTGGCCACAGCTTCGG - Intergenic
1049225192 8:141447267-141447289 TGTGGCCCTGGCCATGGATGGGG + Intergenic
1049258859 8:141628112-141628134 TGGGGCGCTGGGCACAGCTGAGG + Intergenic
1049458620 8:142709467-142709489 AGTGACCCCTGCCACACCTGTGG + Intergenic
1049586803 8:143436121-143436143 ATTGACCATGGCCCCAGCTGAGG - Intergenic
1053104892 9:35400934-35400956 TGGGGCCCTGTGCACAGCTGAGG + Intronic
1055375903 9:75648168-75648190 TGGGGCCCTGGCAGCAGCTGCGG + Intergenic
1057398945 9:94705235-94705257 TGTGACCATGGCCAGCTCTGGGG - Intergenic
1057792380 9:98132739-98132761 TGACCCCCTGGCCAGAGCTGAGG + Intronic
1058360845 9:104144263-104144285 TGTGGCCATGGCCACAGCTTAGG - Intergenic
1059421129 9:114193130-114193152 TCTGACTCTGGGCCCAGCTGAGG + Intronic
1060553063 9:124494799-124494821 TGTGCCTCTGGCCCCAGGTGGGG - Intronic
1061067151 9:128285669-128285691 TGTGACCCTGGCCACAGCTGAGG - Intronic
1062579109 9:137221824-137221846 TCTGACCCTGACCTCAGCCGTGG + Intergenic
1189387027 X:40545492-40545514 TGCGGCCCTGGCCATAGCTAAGG - Intergenic
1192107760 X:68332488-68332510 TAAGAACCTGGCCACAGCCGAGG + Intronic
1192800640 X:74461931-74461953 TCTGACCCTGTCCCCTGCTGTGG + Intronic
1194820754 X:98504079-98504101 TGAGACCTTGGACACAGATGGGG + Intergenic
1199760651 X:150901804-150901826 TGCCACACTGGCCACAGCTTGGG - Intergenic
1200152486 X:153958079-153958101 GGTGACCCCGCCCACAACTGTGG + Exonic