ID: 1061067153

View in Genome Browser
Species Human (GRCh38)
Location 9:128285681-128285703
Sequence ACAGTGGTACCATGTGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061067153_1061067165 20 Left 1061067153 9:128285681-128285703 CCAGGGTCACATGGTACCACTGT 0: 1
1: 0
2: 3
3: 26
4: 238
Right 1061067165 9:128285724-128285746 GGAGACAGGGCACATTTGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 218
1061067153_1061067158 6 Left 1061067153 9:128285681-128285703 CCAGGGTCACATGGTACCACTGT 0: 1
1: 0
2: 3
3: 26
4: 238
Right 1061067158 9:128285710-128285732 CAACCCCACCCTAAGGAGACAGG No data
1061067153_1061067157 -1 Left 1061067153 9:128285681-128285703 CCAGGGTCACATGGTACCACTGT 0: 1
1: 0
2: 3
3: 26
4: 238
Right 1061067157 9:128285703-128285725 TGGCTGGCAACCCCACCCTAAGG No data
1061067153_1061067166 27 Left 1061067153 9:128285681-128285703 CCAGGGTCACATGGTACCACTGT 0: 1
1: 0
2: 3
3: 26
4: 238
Right 1061067166 9:128285731-128285753 GGGCACATTTGCCAGGAGTGAGG 0: 1
1: 0
2: 1
3: 15
4: 210
1061067153_1061067159 7 Left 1061067153 9:128285681-128285703 CCAGGGTCACATGGTACCACTGT 0: 1
1: 0
2: 3
3: 26
4: 238
Right 1061067159 9:128285711-128285733 AACCCCACCCTAAGGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061067153 Original CRISPR ACAGTGGTACCATGTGACCC TGG (reversed) Intronic
901571086 1:10161265-10161287 ACAGTGGGACCAGTTGCCCCGGG + Exonic
902100722 1:13986042-13986064 ACAGAGTTACCATATGACCCAGG - Intergenic
903217652 1:21852115-21852137 ACGCTTGTACCATGTGACCTGGG + Exonic
904876418 1:33658032-33658054 ACAGTGTTCCAGTGTGACCCTGG - Exonic
905364581 1:37443107-37443129 ACAGTGTTCCCTTGGGACCCTGG + Intergenic
905385352 1:37599580-37599602 AAAGTTTTACCATGTCACCCAGG - Intergenic
908243143 1:62204955-62204977 ACAGTTTCACCATGTTACCCAGG + Intronic
912019053 1:105081274-105081296 ACAGAACTACCATTTGACCCAGG - Intergenic
913675354 1:121135694-121135716 ACAGGTTTACCATGTTACCCTGG - Intergenic
914027247 1:143923635-143923657 ACAGGTTTACCATGTTACCCTGG - Intergenic
915094084 1:153446861-153446883 ACAGTCTTACTATGTCACCCAGG + Intergenic
916685573 1:167142568-167142590 ACAGTGAAACCATGTGGCCTGGG + Intergenic
916880404 1:169015112-169015134 GCAGAGGTCCCATGTGTCCCAGG - Intergenic
917279344 1:173366089-173366111 ATAGAGGTACCATGTGATCCAGG + Intergenic
918028974 1:180784235-180784257 ACAGTGGTATCATGTGGCAATGG - Intronic
918643161 1:186868637-186868659 ACAGTGAAACCATGTGAACATGG + Intronic
920462718 1:206154531-206154553 ACAGGTTTACCATGTTACCCTGG - Intergenic
921431001 1:215065937-215065959 ACAGTCTTACCATGTTGCCCAGG - Intronic
921998740 1:221451880-221451902 ATAGAGTTACCATATGACCCAGG - Intergenic
923535430 1:234846883-234846905 ACAGAACTACCATTTGACCCAGG - Intergenic
923673535 1:236062037-236062059 ATAGAGTTACCATATGACCCAGG + Intronic
1063500793 10:6551848-6551870 ACAGAGCTACCATTCGACCCAGG - Intronic
1063943020 10:11149989-11150011 AAATTGATACCATATGACCCTGG + Intronic
1064023282 10:11826405-11826427 ACAGAATTACCATATGACCCGGG - Intronic
1065714217 10:28549088-28549110 AGAGTTTTACCATGTTACCCAGG + Intronic
1066162422 10:32747825-32747847 ACAGAGCTACCATTTGACCCAGG + Intronic
1066670830 10:37837205-37837227 ACAGGAGAACCATGTGAACCTGG - Intronic
1067087444 10:43250395-43250417 ACAGTCGTCCCAGCTGACCCAGG + Intronic
1070978193 10:80622604-80622626 ACAGTGGTGGCAGGTGGCCCTGG + Intronic
1071776634 10:88796477-88796499 ACAGTTTTACCATGTTGCCCAGG - Intergenic
1072282794 10:93884357-93884379 ACAGTTTTACCATGTTTCCCAGG + Intergenic
1075488528 10:122847234-122847256 ACAGTCCTACGTTGTGACCCAGG + Intronic
1075552957 10:123406940-123406962 ATGGAGTTACCATGTGACCCAGG + Intergenic
1075872315 10:125779831-125779853 ACAGTCCTACACTGTGACCCAGG + Intergenic
1075904820 10:126072101-126072123 ACAGTGGAACCATGTGTCCTTGG - Intronic
1077647537 11:3938819-3938841 ACAGTCGTGCCCTGTCACCCAGG - Intronic
1078815028 11:14812073-14812095 ACAGTGGTCCCTTGTGACTATGG + Intronic
1082096123 11:48131101-48131123 ACAGTCTTACCCTGTCACCCAGG + Intronic
1084720104 11:70899913-70899935 AGACTGGTACTATGTGACACTGG + Intronic
1085642510 11:78201250-78201272 ACAGTGATAACATGTGACAGAGG - Intronic
1087811819 11:102616219-102616241 ACAGAGCTACCAAGTGGCCCAGG - Intronic
1087905909 11:103697271-103697293 ATAGAGATACCATGTGACCCAGG - Intergenic
1089249499 11:117147387-117147409 ACAGTTTCACCATGTTACCCAGG + Intronic
1089562575 11:119351776-119351798 AGAGTTTTACCATGTTACCCAGG + Intergenic
1090638165 11:128706400-128706422 ACAGTGCTCCCTTGTTACCCTGG - Intronic
1090883038 11:130851196-130851218 ACAGTGGCATCATGTGCCTCTGG + Intergenic
1091438947 12:497643-497665 ACAGAGTTACCACGGGACCCAGG - Intronic
1093361547 12:18235376-18235398 ACAGAAATACCATTTGACCCAGG - Intronic
1096071929 12:48780259-48780281 ACAGTGTCACCCAGTGACCCAGG - Intronic
1097892267 12:64789373-64789395 ACAGTTTCACCATGTTACCCAGG + Intronic
1098051650 12:66460396-66460418 ACAGTGGTTCCAGGTTGCCCTGG + Intronic
1100357654 12:93846743-93846765 AGAATGCAACCATGTGACCCAGG + Intronic
1101939402 12:109088901-109088923 ACAGTTTCACCATGTTACCCAGG + Intronic
1103314380 12:120040605-120040627 ACAGTTTTACCATGTTGCCCAGG + Intronic
1104365687 12:128174546-128174568 ACAGTGGTAGAGTGTGACCAGGG - Intergenic
1105844959 13:24286249-24286271 CCTGTGGGACCATGTGACCATGG + Exonic
1107645555 13:42491215-42491237 ACAGTGGCACCATGTCAGCCTGG + Intergenic
1109660015 13:65444975-65444997 ATAGTGGTACCATCTGGCCAGGG + Intergenic
1110557149 13:76872803-76872825 ATAGAAGTACCATATGACCCAGG + Intergenic
1112213444 13:97404530-97404552 ACAGTGGAATCAAGTAACCCAGG + Intergenic
1112756953 13:102646645-102646667 CCATTGGTGCCATCTGACCCAGG + Intronic
1113655018 13:112062708-112062730 ACAGTGGAACCAAGTTAGCCCGG + Intergenic
1120275643 14:82369896-82369918 ACTAGGGTGCCATGTGACCCAGG + Intergenic
1120412815 14:84178527-84178549 AGAGTGTTCCCATGTGACCTAGG - Intergenic
1120475090 14:84976975-84976997 ACGGAGGCACCATGTGACCAGGG - Intergenic
1120773435 14:88407144-88407166 CCAGAGATACCATTTGACCCAGG - Intronic
1121168237 14:91830155-91830177 ACAGAGCTACCATATGACCCAGG + Intronic
1122069285 14:99195269-99195291 ACAGTGGTCCACTCTGACCCAGG + Intronic
1125240738 15:37572597-37572619 ACAGAGTTACCATATGATCCAGG - Intergenic
1125388440 15:39164756-39164778 ACAATGTTACCATATGATCCAGG - Intergenic
1127003024 15:54532291-54532313 ACAGAAATACCATTTGACCCAGG + Intronic
1127076306 15:55329743-55329765 ACAGCAATACCATGTGAACCAGG - Exonic
1127447737 15:59082224-59082246 CCAGTTTTACCATATGACCCAGG + Intronic
1129036228 15:72650029-72650051 GCAGTGGTACCATTTGCCCAAGG - Intergenic
1129213661 15:74087195-74087217 GCAGTGGTACCATTTGCCCAAGG + Intergenic
1129396740 15:75253886-75253908 GCAGTGGTACCATTTGCCCAAGG - Intergenic
1129400352 15:75278167-75278189 GCAGTGGTACCATTTGCCCAAGG - Intronic
1129473968 15:75770869-75770891 GCAGTGGTACCATTTGCCCGAGG - Intergenic
1130535982 15:84785226-84785248 ACAGTCTTAGCATGTGACCAAGG + Intronic
1130786077 15:87098055-87098077 ACAGAACTACCATTTGACCCAGG - Intergenic
1130882855 15:88070076-88070098 TCAGTGCTACCATGTGATTCAGG + Intronic
1133124250 16:3634840-3634862 AGAGTGTTACTATGTGGCCCAGG + Intronic
1133356821 16:5142950-5142972 GCAGAGATACCATGTGCCCCAGG + Intergenic
1133584716 16:7181750-7181772 ACAGTCTTGCCATGTTACCCAGG + Intronic
1134231995 16:12436688-12436710 ACAGTGTTGCCCTGTGGCCCAGG + Intronic
1134292082 16:12909880-12909902 ACAGTCGTACTCTGTCACCCCGG + Intronic
1134403389 16:13933192-13933214 ACAGTCGTACTCTGTCACCCAGG - Intronic
1138548038 16:57730957-57730979 GCAGTGGTACCAGGAGAACCAGG + Exonic
1141198010 16:81876212-81876234 ACAGTTTCACCATGTTACCCAGG + Intronic
1141555390 16:84833816-84833838 ACAGAGGCACCACGTGACCCGGG + Intronic
1142116131 16:88357075-88357097 CCAGTTGTACCCTCTGACCCGGG + Intergenic
1145095895 17:20025738-20025760 ACAGAGTTACCGTATGACCCAGG - Intronic
1145931062 17:28686109-28686131 CCAGTGGTACCAGGTGCCACTGG - Intronic
1146623406 17:34417772-34417794 ATAGTGGTAACATGTGTGCCAGG - Intergenic
1148062324 17:44845438-44845460 ACAGTTTTACCATGTTACCCTGG - Intergenic
1148293524 17:46478436-46478458 ACAGTGGTAGCATATGAGCCAGG - Intergenic
1148315710 17:46696138-46696160 ACAGTGGTAGCATATGAGCCAGG - Intronic
1149388480 17:56166168-56166190 ACAATGTAACCATGTGACCTTGG + Intronic
1149719977 17:58833764-58833786 ACAGAACTACCATTTGACCCAGG - Intronic
1150696239 17:67408143-67408165 ACAGTTTTACCATGTTGCCCAGG + Intronic
1151047103 17:70933514-70933536 ACAGTTTCACCATGTTACCCAGG - Intergenic
1151548216 17:74806318-74806340 ATAGTGGTATACTGTGACCCCGG + Intronic
1152790349 17:82275266-82275288 ACAGTGGTACCCTGGAGCCCTGG + Intergenic
1153751421 18:8235183-8235205 ACAGTGAAACCATCTGAGCCTGG + Intronic
1157715645 18:49885093-49885115 ATAGAGTTGCCATGTGACCCAGG + Intronic
1158024285 18:52877515-52877537 ACAGTCTTACCATGTTGCCCAGG - Intronic
1158287136 18:55896130-55896152 CCAGTTTCACCATGTGACCCAGG - Intergenic
1161137438 19:2628008-2628030 ACACAGTTGCCATGTGACCCTGG + Intronic
1162419387 19:10557568-10557590 ACAGTGGTGCCCTGTGACTTTGG - Exonic
1163059517 19:14748683-14748705 ATAGAGCTACCATATGACCCAGG - Intronic
1163308573 19:16498177-16498199 ATAGAGTTACCATGTGATCCAGG - Intronic
1163361363 19:16848280-16848302 ACAGAATTAACATGTGACCCAGG - Intronic
1165491200 19:36123941-36123963 ACAGTGTTACCATGTGGCCCAGG - Intronic
1165615810 19:37199333-37199355 ACAGTTTCACCATGTTACCCAGG - Intronic
1166961677 19:46500543-46500565 ATAGAGTTACCATGTGCCCCGGG - Intronic
1168548272 19:57271964-57271986 ACAGTGGTGCCAGGAGACCATGG - Intergenic
925197860 2:1941524-1941546 ACACTGGTGCCTTGTGTCCCTGG + Intronic
926730918 2:16034725-16034747 ACAGTGGTGCCATGTGATCCGGG - Intergenic
927687303 2:25180148-25180170 ATAGAGTTACCATATGACCCAGG + Intergenic
927744630 2:25606242-25606264 AGTGTGGTACCCTGTGAGCCCGG - Intronic
927808409 2:26168329-26168351 ACAGTCTTACCATGTCACCCTGG - Intergenic
927839866 2:26433755-26433777 CCAGTGGTACCAGGTCTCCCAGG - Intronic
927872128 2:26630344-26630366 ACAGTGGTGCCCTGGGGCCCAGG + Intronic
929485419 2:42349074-42349096 ACAGAGTTACCATATGACCCAGG + Intronic
931376735 2:61714681-61714703 ACAGTCTCACCATGTCACCCAGG + Intergenic
931693336 2:64853621-64853643 ACAGAGTTACCAAATGACCCAGG + Intergenic
932512646 2:72310166-72310188 ACAGAATTACCATATGACCCAGG - Intronic
933076240 2:77931016-77931038 CCAGTGAAACCATGTGGCCCTGG - Intergenic
935213044 2:100954637-100954659 ACAGTTTTACTATGTCACCCAGG - Intronic
937160618 2:119758225-119758247 TCAGTGGGCCCATGTGAGCCTGG + Intergenic
940086792 2:149868460-149868482 ATAGTGCTACCATATGATCCAGG + Intergenic
940579453 2:155559193-155559215 ACAGAAATACCATTTGACCCAGG + Intergenic
941121319 2:161533434-161533456 ATAGTGGTACCATCTGACCAGGG + Intronic
944596093 2:201261915-201261937 ACAGTGGTAGAATGGGACTCTGG + Intronic
944708696 2:202316377-202316399 ACAGTTTCACCATGTTACCCAGG + Intergenic
947919695 2:233858806-233858828 ACAGTCTTGCCCTGTGACCCAGG + Intergenic
948714891 2:239854613-239854635 ACAGGGCCACCAGGTGACCCAGG - Intergenic
1168854542 20:999526-999548 CCAGTTGTATCATGTGACCTTGG - Intronic
1169653282 20:7893570-7893592 ACAGTGGTGCCAACTGATCCAGG - Intronic
1171726126 20:28622568-28622590 ACAGTGCTGCCCTTTGACCCAGG + Intergenic
1171752004 20:29060808-29060830 ACAGTGCTGCCCTTTGACCCAGG - Intergenic
1172437799 20:34942358-34942380 CCAGGGGCAACATGTGACCCGGG + Intronic
1173611905 20:44374653-44374675 ACAGTTTTACCATGTTAGCCAGG + Intronic
1174474089 20:50783641-50783663 ACAGTCTCACCATGTCACCCAGG + Intergenic
1174577448 20:51546645-51546667 ACATTGGTACTATTTGACCCTGG + Intronic
1174763444 20:53229308-53229330 AAAGTTGTACTAAGTGACCCAGG - Intronic
1177600378 21:23303057-23303079 ACAGTGGTAATATTTGCCCCGGG - Intergenic
1179023569 21:37660349-37660371 ATAGTGGCATCATGTGCCCCAGG + Intronic
1179975426 21:44862940-44862962 ACAGTGGTACCATGAGCCACAGG + Intronic
1180391031 22:12282176-12282198 ACAGTGCTGCCCTTTGACCCAGG + Intergenic
1180408711 22:12582581-12582603 ACAGTGCTGCCCTTTGACCCAGG - Intergenic
1181926834 22:26366500-26366522 ACAGTTTCACCATGTTACCCAGG - Intronic
1182110365 22:27718802-27718824 ACAGGGCTACCTGGTGACCCAGG + Intergenic
949376420 3:3394971-3394993 ACAGAGCTACCATTTGACCCAGG - Intergenic
950247653 3:11436430-11436452 ATAGAATTACCATGTGACCCAGG + Intronic
950427854 3:12934358-12934380 ATAGTGCTTCCATGTGTCCCAGG + Intronic
950725285 3:14913310-14913332 ACAGTTGTTCCATGGGACACAGG + Intronic
950725693 3:14915472-14915494 ACACTGGTGCCATGTGTCCAGGG + Intronic
951335661 3:21418622-21418644 ACAGTAATGCCTTGTGACCCAGG + Exonic
951511959 3:23512241-23512263 ACAGTCTTACCCTGTCACCCAGG + Intronic
952554014 3:34511518-34511540 ACAGTCTTGCCATGTTACCCAGG + Intergenic
954740944 3:52750060-52750082 ATAGAGTTACCATATGACCCAGG + Intronic
957993835 3:87662570-87662592 ACAGAACTACCATTTGACCCAGG + Intergenic
959213994 3:103425691-103425713 TCAGTGGTGCCAAGAGACCCAGG - Intergenic
960927203 3:122806565-122806587 ACAGTTTTACCATGTTGCCCAGG + Intronic
961211033 3:125126081-125126103 ACACTGTTACCATGTGACTTAGG + Intronic
961727335 3:128940359-128940381 ACAGAGTTCCCATATGACCCAGG - Intronic
965268560 3:166582235-166582257 ACAGAGCTTCCATTTGACCCAGG - Intergenic
965699762 3:171448637-171448659 ACAGAGTTACCATGTGACCCAGG - Intronic
967136744 3:186519128-186519150 AAAGTGGTGTCATGTGAGCCAGG - Intergenic
967437908 3:189472066-189472088 ATAGAGTTACCATATGACCCAGG - Intergenic
969085798 4:4655515-4655537 ACAGGGGTGCCATTTGACCTAGG + Intergenic
969808320 4:9627853-9627875 GCAGAGATACCATGTGCCCCAGG - Intergenic
972921040 4:43942084-43942106 ACAGAACTACCATTTGACCCAGG - Intergenic
973038319 4:45436966-45436988 ACAGAGCTATCATTTGACCCAGG + Intergenic
974122922 4:57661872-57661894 ACAGTGTTAGCTTGTGACACAGG + Intergenic
974353553 4:60782492-60782514 TCAGCTGTACCATGTGACCTTGG + Intergenic
975449982 4:74513571-74513593 ACAGAACTACCATTTGACCCAGG - Intergenic
976045031 4:80936252-80936274 ACAGAAATACCATTTGACCCAGG + Intronic
976166445 4:82260423-82260445 ATAGAGTTACCATGTGACCCAGG - Intergenic
977277419 4:94994905-94994927 ACAAAGTTGCCATGTGACCCTGG + Intronic
977741686 4:100491639-100491661 ATAGTGGTACCACTTGACCAAGG + Intronic
977767546 4:100817631-100817653 ACAGTTTTACTATGTTACCCAGG + Intronic
978985106 4:115002691-115002713 ACAGAAATACCATTTGACCCAGG + Intronic
979045638 4:115859058-115859080 GCAGAGCTACCATTTGACCCAGG + Intergenic
979128055 4:117002179-117002201 ACAGTGTTACTCTGTCACCCAGG + Intergenic
983985331 4:174052953-174052975 ACAGAACTACCATTTGACCCAGG + Intergenic
984106754 4:175557472-175557494 ACAGAACTACCATGTGACCCAGG - Intergenic
984354906 4:178645492-178645514 ACAGAGCTACCATATGATCCAGG - Intergenic
985434408 4:189915229-189915251 ACAGTGCTGCCCTGTGGCCCAGG - Intergenic
985661478 5:1159183-1159205 ACAGTGGCTGCATGTGTCCCGGG + Intergenic
986626723 5:9729492-9729514 GCAGTGGTAGCATGTCACCAAGG - Intergenic
986864444 5:11969067-11969089 ACAGAAATACCATTTGACCCAGG - Intergenic
987304765 5:16626997-16627019 ACAGTTTTTCCATGTGGCCCAGG - Intergenic
988487055 5:31675891-31675913 ACTGTTCTACCATGTGGCCCCGG + Intronic
990757943 5:59096481-59096503 ACAGTGGTCCCATCTGACCATGG - Intronic
992822160 5:80508302-80508324 ATATAGTTACCATGTGACCCAGG - Intronic
993071212 5:83166348-83166370 ACAGAAATACCATTTGACCCAGG - Intronic
995117534 5:108498805-108498827 ACAGAACTACCATTTGACCCAGG - Intergenic
997140681 5:131377018-131377040 ACAGAAGTATCATTTGACCCAGG - Intronic
997200848 5:132009366-132009388 GCCGTGGGACCATGGGACCCTGG + Intronic
998766102 5:145488960-145488982 AAAGAGGTAGCATGTGACCCAGG + Intronic
999464368 5:151788103-151788125 ACAGTTTTACCATGTTGCCCAGG + Intronic
999958723 5:156730752-156730774 ACAGAACTACCATTTGACCCAGG - Intronic
1000726782 5:164781963-164781985 ACAGTGAAGCCATGTGGCCCTGG + Intergenic
1001665600 5:173431301-173431323 ACACTGGCTCCAAGTGACCCAGG + Intergenic
1006755048 6:36408449-36408471 ACAGTCTTACCATGTTGCCCAGG + Intronic
1007238412 6:40407510-40407532 ATTGTGGTACCAGATGACCCAGG - Intronic
1007874795 6:45084577-45084599 ACAGAAGTATCATCTGACCCAGG + Intronic
1011616193 6:89200438-89200460 AGAGTTTTACCATGTTACCCAGG + Intronic
1012543115 6:100385498-100385520 ACAGTGATTACATGTGTCCCAGG + Exonic
1013469360 6:110448025-110448047 ATAGAGTTACCATATGACCCAGG - Intronic
1019291964 7:255121-255143 ACAGTGTTTCCACGTGACCCAGG - Intronic
1021249258 7:18304118-18304140 ACAATAGTACCATGTAACACAGG - Intronic
1022075799 7:26968715-26968737 ACAGAAATACCATTTGACCCAGG - Intronic
1023356774 7:39375222-39375244 ACTGTTGCACCATATGACCCGGG + Intronic
1025824587 7:65000009-65000031 ACAGAATTACCATTTGACCCAGG + Intronic
1026306991 7:69150943-69150965 TCAGTGGTACCCAGTGGCCCAGG + Intergenic
1029365566 7:100114005-100114027 ACATTGGGTCCATGTCACCCAGG - Intronic
1030629370 7:111878954-111878976 ACAAGGGTAGCATGTGACCTAGG + Intronic
1030762720 7:113370914-113370936 ACAGTGTTACTCTGTCACCCAGG - Intergenic
1031189062 7:118523147-118523169 ACAGAGCTACCATATGATCCAGG + Intergenic
1031249726 7:119364233-119364255 GCAGAAATACCATGTGACCCAGG - Intergenic
1031901023 7:127410852-127410874 ATAGAGTTACCATATGACCCAGG - Intronic
1032329527 7:130964897-130964919 TTAGTGGTCCCAGGTGACCCAGG - Intergenic
1032548697 7:132764556-132764578 GCACAGGTACCATGTGACCCAGG + Intergenic
1034231369 7:149531254-149531276 ACAGTTTTACCATGTTAGCCAGG - Intergenic
1037963274 8:23115666-23115688 ATAGGGGTACCAGGTGACTCAGG - Intronic
1038235335 8:25747243-25747265 ACAGAACTACCATTTGACCCAGG - Intergenic
1039192813 8:34996173-34996195 ACAGAGCTACGATTTGACCCAGG - Intergenic
1041692672 8:60704277-60704299 ACAGTTATACCATGTGCCCAAGG + Intronic
1042694575 8:71542591-71542613 ACAGAAATACCATTTGACCCAGG - Intronic
1043066367 8:75576130-75576152 CCAGAAGTACCATTTGACCCAGG - Intergenic
1043554529 8:81415743-81415765 ACAGAAATACCATTTGACCCAGG + Intergenic
1049047903 8:140167088-140167110 ACAATGGTACCAGGTCACACAGG + Intronic
1049732981 8:144188423-144188445 GCAGTGGTAGCACCTGACCCAGG - Intronic
1051476526 9:17514984-17515006 ACAGGGCTACCATGTAGCCCTGG + Intergenic
1051840335 9:21389913-21389935 CCAGTGAAACCATGTGTCCCTGG - Intergenic
1052214618 9:25951111-25951133 ACAGTGCTCCCCTGTGGCCCAGG + Intergenic
1053191484 9:36074102-36074124 AAAGTGGTACCATTTAAACCAGG - Intronic
1053424199 9:38000424-38000446 ACCATGGTACCAACTGACCCTGG + Intronic
1054340500 9:63857716-63857738 AAAGAGTTACCATATGACCCAGG + Intergenic
1055774923 9:79757195-79757217 ACACTGGTAACATGAGTCCCTGG + Intergenic
1055940886 9:81648245-81648267 ACAGTGTTACTCTGTAACCCAGG - Intronic
1057149663 9:92785080-92785102 ACCGTGTTACCATGTTAGCCAGG - Intergenic
1057862341 9:98651167-98651189 ACAGTGTTACTCTGTCACCCAGG + Intronic
1058441286 9:105010123-105010145 ACAGAACTACCATTTGACCCAGG - Intergenic
1059622630 9:116024370-116024392 ACAGAACTACCATTTGACCCAGG - Intergenic
1060203136 9:121663812-121663834 ACAGTGCTCCCAAGTGACTCAGG - Intronic
1061067153 9:128285681-128285703 ACAGTGGTACCATGTGACCCTGG - Intronic
1061870266 9:133516684-133516706 ACAGCTGGACCGTGTGACCCTGG + Intronic
1061906156 9:133699832-133699854 ACAGAGATACCACTTGACCCAGG + Intronic
1186392420 X:9174341-9174363 ACAGAATTACCATTTGACCCAGG + Intergenic
1187845371 X:23531029-23531051 ATGGAGCTACCATGTGACCCAGG + Intergenic
1187946904 X:24434801-24434823 ACAGAGGTACTATATGACCCAGG + Intergenic
1188304055 X:28540865-28540887 ATAGAGCTACCATGTGATCCAGG + Intergenic
1189628657 X:42927492-42927514 ACAGAGCTACCATGTGATTCAGG + Intergenic
1190905819 X:54726895-54726917 ACAGAAATACCATTTGACCCAGG + Intergenic
1192613983 X:72598463-72598485 ACATAGTTACCATATGACCCAGG + Intronic
1193920247 X:87416098-87416120 ACAGAGCTATCATTTGACCCAGG - Intergenic
1194199710 X:90939444-90939466 GCAGAAGTACCATTTGACCCAGG - Intergenic
1195458397 X:105096296-105096318 AGAGTGTTATCATATGACCCTGG + Intronic
1196105549 X:111891244-111891266 ACAGAAATACCATTTGACCCAGG - Intronic
1197196778 X:123710315-123710337 ATAGTGTAACCATGTGACTCTGG - Intronic
1198711983 X:139514305-139514327 ACAGAGTTACCTTGTGACCCAGG - Intergenic
1198788472 X:140316522-140316544 ACAGAATTACCATATGACCCAGG + Intergenic
1200545699 Y:4515861-4515883 GCAGAAGTACCATTTGACCCAGG - Intergenic
1200758134 Y:7010903-7010925 ACAGTGTTACCCTGTTACCCAGG - Intronic