ID: 1061067156

View in Genome Browser
Species Human (GRCh38)
Location 9:128285697-128285719
Sequence GGTGGGGTTGCCAGCCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 314}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061067156_1061067159 -9 Left 1061067156 9:128285697-128285719 CCACTGTGGCTGGCAACCCCACC 0: 1
1: 0
2: 1
3: 25
4: 314
Right 1061067159 9:128285711-128285733 AACCCCACCCTAAGGAGACAGGG No data
1061067156_1061067165 4 Left 1061067156 9:128285697-128285719 CCACTGTGGCTGGCAACCCCACC 0: 1
1: 0
2: 1
3: 25
4: 314
Right 1061067165 9:128285724-128285746 GGAGACAGGGCACATTTGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 218
1061067156_1061067167 17 Left 1061067156 9:128285697-128285719 CCACTGTGGCTGGCAACCCCACC 0: 1
1: 0
2: 1
3: 25
4: 314
Right 1061067167 9:128285737-128285759 ATTTGCCAGGAGTGAGGACCTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1061067156_1061067166 11 Left 1061067156 9:128285697-128285719 CCACTGTGGCTGGCAACCCCACC 0: 1
1: 0
2: 1
3: 25
4: 314
Right 1061067166 9:128285731-128285753 GGGCACATTTGCCAGGAGTGAGG 0: 1
1: 0
2: 1
3: 15
4: 210
1061067156_1061067158 -10 Left 1061067156 9:128285697-128285719 CCACTGTGGCTGGCAACCCCACC 0: 1
1: 0
2: 1
3: 25
4: 314
Right 1061067158 9:128285710-128285732 CAACCCCACCCTAAGGAGACAGG No data
1061067156_1061067168 18 Left 1061067156 9:128285697-128285719 CCACTGTGGCTGGCAACCCCACC 0: 1
1: 0
2: 1
3: 25
4: 314
Right 1061067168 9:128285738-128285760 TTTGCCAGGAGTGAGGACCTGGG 0: 1
1: 0
2: 3
3: 13
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061067156 Original CRISPR GGTGGGGTTGCCAGCCACAG TGG (reversed) Intronic
900548687 1:3242678-3242700 GCTGGCGTTCCCAGTCACAGTGG - Intronic
900901292 1:5518086-5518108 ATGGGGGTTCCCAGCCACAGAGG + Intergenic
901073254 1:6534581-6534603 TGTGGGGTAGCCAGCAGCAGAGG + Intronic
902391854 1:16111581-16111603 AGAGGGGGTGCCAGACACAGTGG - Intergenic
902572724 1:17356971-17356993 GGTGGAGCTCTCAGCCACAGAGG - Intronic
903305072 1:22407658-22407680 GGGAGGGTTGCCAGCAGCAGAGG + Intergenic
903512375 1:23885900-23885922 GGGGGGGTGGCCAGGCACGGTGG + Intronic
903929777 1:26855527-26855549 GCTGGGAATGGCAGCCACAGAGG + Exonic
904839163 1:33360192-33360214 TGTTGGGTTGCCAGCTGCAGGGG + Intronic
905280601 1:36846649-36846671 GGTTGGATTTTCAGCCACAGTGG + Intronic
905309314 1:37038276-37038298 GGGGGGGTTGAGAGCCAGAGTGG - Intergenic
905596903 1:39215336-39215358 GGTGGGGTCAGCAGACACAGGGG + Intronic
906157531 1:43622530-43622552 GCTGGGGCTGCCAGCCTGAGCGG + Exonic
906648880 1:47496260-47496282 GGAGGGGGTGCCAGGCGCAGTGG - Intergenic
907491001 1:54808717-54808739 GGTGGGGGTGGCAGCGCCAGGGG + Intronic
909012072 1:70346117-70346139 AGTGGGGAAGCCAGGCACAGTGG - Intronic
911985427 1:104616512-104616534 GGGAGGGATACCAGCCACAGAGG - Intergenic
914194939 1:145442332-145442354 GGTGGTGTTTCCATCCACAGAGG - Intergenic
914476213 1:148024899-148024921 GATGGTGTTTCCATCCACAGAGG - Intergenic
917854121 1:179087796-179087818 GGTGGGGAACCCAGCCCCAGGGG + Intronic
919261388 1:195198866-195198888 GGTAGAGTGGCCAGGCACAGTGG - Intergenic
919642062 1:200055179-200055201 AGTAGGGCTGCCAGGCACAGTGG - Intronic
920223096 1:204418640-204418662 GGTGGGGGTGAAAGCCACATTGG - Intergenic
923353439 1:233130768-233130790 GGGGGGGGTGCCGGGCACAGTGG - Intronic
923538533 1:234871460-234871482 GCTGGGGTTTCCAGCTCCAGTGG - Intergenic
923786369 1:237072223-237072245 TGTGGGGATGCCAGCTGCAGCGG - Intronic
924632927 1:245759417-245759439 GGTGGGGATGGCAGCTTCAGAGG - Intronic
1065486373 10:26239915-26239937 GGGGAGGTTGCCAGCCACTGAGG + Intronic
1065773092 10:29095683-29095705 GGTGGTGCGGCCAGGCACAGTGG - Intergenic
1065850193 10:29781418-29781440 GCTGGGCTAGCCAGGCACAGTGG + Intergenic
1065897746 10:30179264-30179286 CTGGGGGTTGCCAGTCACAGTGG + Intergenic
1068333242 10:55600075-55600097 GTTGGGGTGGCCGGGCACAGTGG + Intronic
1069093489 10:64229887-64229909 TGTGGGGGTGGGAGCCACAGAGG + Intergenic
1069180221 10:65350094-65350116 AGTAGGGTTGCCGGGCACAGTGG + Intergenic
1069198347 10:65581956-65581978 GGGGGTGTTGCCAGCTGCAGAGG + Intergenic
1069871749 10:71537165-71537187 GTAGGGGTTGCCAGCCCCAAAGG - Intronic
1070245865 10:74730768-74730790 GGTGCGGAAGCCTGCCACAGGGG + Intergenic
1070587841 10:77779995-77780017 GGAGGGGTTGCCTGCCCCTGGGG + Intergenic
1071311319 10:84347306-84347328 GGGGTGGTGGCCAGGCACAGGGG + Intronic
1072789201 10:98305288-98305310 AGTGAGGTTGCCAATCACAGTGG - Intergenic
1073132891 10:101201763-101201785 GGTATGGTGGCCAGGCACAGTGG + Intergenic
1073305196 10:102497803-102497825 GATAGGGTTGCCAGGCACAGTGG + Intronic
1073426691 10:103459348-103459370 CGTGGGGATACTAGCCACAGAGG + Intergenic
1074323934 10:112429798-112429820 CTTTGGGCTGCCAGCCACAGAGG - Intergenic
1076188682 10:128468007-128468029 GGTGGGGTTCAGAGCCACACTGG - Intergenic
1076750384 10:132539196-132539218 GCTGGGGCTGACAGCCAGAGTGG - Intronic
1076911533 10:133392449-133392471 GGTGGGGCTGCTGGCTACAGAGG - Intronic
1077095106 11:795859-795881 GATGGGGGTGCCAGCCACAGGGG - Intronic
1077339476 11:2019616-2019638 GGTGGGGGTGCCAGGCCCCGGGG + Intergenic
1077483589 11:2828007-2828029 TGTGGGGAGGCCAGCAACAGAGG + Intronic
1077867956 11:6238913-6238935 GGTGGGGGTGCATGCCTCAGAGG - Intronic
1080528462 11:33150567-33150589 GGTAGGGGGGCCAGGCACAGTGG + Intronic
1081847579 11:46251906-46251928 GGTGGGGAGGCCAACCAGAGAGG - Intergenic
1082816403 11:57512740-57512762 GGTGGGGTTGGCAGCCAGGCTGG - Intronic
1083051221 11:59778488-59778510 AGTGGCATTGCCAGCCCCAGAGG - Intronic
1083302386 11:61745787-61745809 GGTAGGGTGGGCAGCCCCAGAGG - Exonic
1083855068 11:65389258-65389280 GGTGGGGGCTCCAGCCCCAGTGG + Intronic
1084117920 11:67052663-67052685 GGTGGGGCTCCCAGACAGAGGGG - Intergenic
1085508651 11:77074309-77074331 GCTGGGGATGCCAGGCAGAGGGG - Intronic
1085510098 11:77083828-77083850 GGTGTGAGTGCCAGCCCCAGTGG - Intronic
1086792798 11:91063529-91063551 AGGGCGGTTGCCAGGCACAGAGG - Intergenic
1089849973 11:121487454-121487476 AGTGAGCCTGCCAGCCACAGTGG + Intronic
1089852456 11:121511915-121511937 GTTGGGATTCCCAGCCAGAGGGG - Intronic
1090976123 11:131682346-131682368 GCTGTGGTTGCAGGCCACAGGGG + Intronic
1091220155 11:133925920-133925942 GGTGGGGTGACCAGCACCAGGGG + Exonic
1202822461 11_KI270721v1_random:74805-74827 GGTGGGGGTGCCAGGCCCCGGGG + Intergenic
1091645267 12:2268250-2268272 GGTGGGGTCGACAGCCAGAGGGG + Intronic
1095442072 12:42247359-42247381 GGTGTGATTGCCTGCCACAGTGG - Intronic
1096343415 12:50823333-50823355 GGAGGGGATGGCAGGCACAGTGG - Intergenic
1096744817 12:53719130-53719152 GGTGTGGAGGCCAGGCACAGTGG - Intronic
1097187653 12:57204323-57204345 GGTGGGGGTTCCAGGCTCAGAGG - Intronic
1097704546 12:62854263-62854285 GGTGGGGTGGCCATCCATTGCGG - Intronic
1099042772 12:77676526-77676548 GGTAGGCTTACCAGCCACACAGG - Intergenic
1100942439 12:99739203-99739225 AGTGGGGTTGAAGGCCACAGTGG - Intronic
1101482116 12:105108029-105108051 GGTTGGGGTCCCAGCCACGGCGG + Intronic
1102704554 12:114869815-114869837 GATGTGGGAGCCAGCCACAGAGG + Intergenic
1103713281 12:122928847-122928869 GATGGGGCTCCCAGACACAGGGG + Intronic
1104569148 12:129909732-129909754 GGTGGGGTTGACTGACACTGAGG + Intergenic
1105881375 13:24609133-24609155 AGAGCTGTTGCCAGCCACAGGGG - Intergenic
1107570314 13:41650680-41650702 GCTGGGGGTGCCAGCCTAAGTGG + Intronic
1107913657 13:45127916-45127938 GGCCGGGGTGCCAGGCACAGTGG - Intronic
1108247550 13:48532935-48532957 GGAGGGGTGGCCTGCCCCAGTGG + Intronic
1110282976 13:73717181-73717203 AGTGGGCTGGCCAGGCACAGTGG + Intronic
1110980510 13:81890623-81890645 AGAGGCGATGCCAGCCACAGAGG + Intergenic
1112394810 13:99019811-99019833 GGTGGGGAGGCCAAGCACAGTGG + Intronic
1115310722 14:31975252-31975274 TGTGGAGATGCCAGCTACAGTGG - Intergenic
1116961810 14:50974361-50974383 GAAGGCGCTGCCAGCCACAGAGG + Intergenic
1116999438 14:51357221-51357243 GGTGGGAGTCCCAGCCACACAGG - Intergenic
1119620793 14:76130642-76130664 GGTGGAGTGGGCAGCCTCAGTGG - Intergenic
1119829320 14:77686907-77686929 AATGGGGTGGCCAGGCACAGTGG - Intronic
1120017087 14:79486456-79486478 GTTGGGGTGGGCATCCACAGGGG - Intronic
1120734536 14:88038370-88038392 GGTTAGTTTGCCAGCCAAAGTGG + Intergenic
1122200316 14:100118688-100118710 GGTGAGGGGGCCAGCCACAGGGG - Intronic
1122257385 14:100488898-100488920 GTCGGGGATGCCAGGCACAGAGG - Intronic
1122375891 14:101257183-101257205 GGTGGAGTCACCAGCCAGAGGGG - Intergenic
1122580973 14:102771360-102771382 GTTGGGGTTGGGGGCCACAGAGG + Intergenic
1122837044 14:104435481-104435503 TGTGGGGTTGCCAGCACCACAGG + Intergenic
1123466514 15:20520325-20520347 GATGGGTGTGGCAGCCACAGAGG + Intergenic
1123651600 15:22480712-22480734 GATGGGTGTGGCAGCCACAGAGG - Intergenic
1123742021 15:23289576-23289598 GATGGGTGTGGCAGCCACAGAGG - Intergenic
1123744975 15:23312982-23313004 GATGGGTGTGGCAGCCACAGAGG + Intergenic
1124277245 15:28336304-28336326 GATGGGTGTGGCAGCCACAGAGG + Intergenic
1124305456 15:28575302-28575324 GATGGGTGTGGCAGCCACAGAGG - Intergenic
1125591774 15:40858785-40858807 GGTGGTGTTAGCAGACACAGGGG - Intergenic
1126295368 15:47132541-47132563 GGGGCGGTTGCCAGGCAGAGGGG - Intergenic
1127271669 15:57407371-57407393 GGGGGTTTTGCCAGGCACAGTGG + Intronic
1129372510 15:75106359-75106381 CGTGGGTCTCCCAGCCACAGGGG + Intronic
1131391201 15:92050278-92050300 TGAGGAGTCGCCAGCCACAGAGG + Intronic
1132518865 16:378344-378366 GGTGGGGATGGCAGTCAGAGTGG - Intronic
1132518899 16:378488-378510 GGTGGGGATGGCAGTCAGAGTGG - Intronic
1132669877 16:1098164-1098186 GGTGGAGGTGCCAGGCACTGGGG + Intergenic
1132856407 16:2047055-2047077 GGTGGTGATGCCAGCCAGGGTGG - Intronic
1133175566 16:4011442-4011464 GGTGGAAATGCCAGCCACAGCGG + Intronic
1133235440 16:4385334-4385356 GGTGGGGCTGCCGGCCACGCGGG + Intronic
1134113516 16:11531065-11531087 GTTGGGTTTGCCAGCGACTGGGG + Intergenic
1135957623 16:26969487-26969509 AGTGGTTTTGGCAGCCACAGAGG - Intergenic
1138065156 16:53933015-53933037 GGTGATGTTGCCAGACAAAGGGG + Intronic
1139364212 16:66423747-66423769 GGTGGTGTTGCCAGTCACCAAGG - Intergenic
1139635634 16:68256795-68256817 GGAGGGATGGCCAGGCACAGTGG - Intronic
1139657183 16:68396140-68396162 GGTGGCGGTGACAGCCACGGAGG - Intronic
1141636488 16:85316731-85316753 GCAGGGGTTACCATCCACAGTGG + Intergenic
1142417402 16:89949915-89949937 CCTGGGGATGCCGGCCACAGTGG - Intronic
1142702820 17:1674486-1674508 GATGGGGTGGGCAGCCTCAGTGG + Exonic
1142756353 17:2018639-2018661 GGTGGGCTTGACAGACAGAGCGG + Intronic
1143731005 17:8882727-8882749 GATGGTGCTGCCAGTCACAGAGG + Intronic
1144765603 17:17730888-17730910 TGTGGGTGTCCCAGCCACAGGGG + Intronic
1145053870 17:19685325-19685347 GATGGGGTGGCCAGGCACAGGGG - Intronic
1145272591 17:21412720-21412742 GGTGAGGTGGTCAGCCACAGCGG + Intronic
1145310801 17:21700183-21700205 GGTGAGGTGGTCAGCCACAGCGG + Intronic
1145394833 17:22486933-22486955 TGTGGGGGTGCCACCCCCAGAGG + Intergenic
1145836687 17:27959657-27959679 GGTGGTTTTGCCAGACAAAGAGG - Intergenic
1148094967 17:45046113-45046135 GTTGATGTTGCCAGGCACAGTGG - Intronic
1148768033 17:50050747-50050769 TGGGGTGTTACCAGCCACAGTGG + Intergenic
1148813203 17:50307975-50307997 GCCTGGGTTTCCAGCCACAGAGG - Intergenic
1148819218 17:50350876-50350898 GGAGGGTTTGCCAGGCACAGGGG + Intronic
1150269662 17:63855479-63855501 GGTGGCTTGGCCAGGCACAGTGG + Intergenic
1152049750 17:77963689-77963711 GTTGTGGTTTGCAGCCACAGAGG - Intergenic
1152619995 17:81358346-81358368 GGTGGGGTTGCGAGGCATGGGGG + Intergenic
1153034101 18:742329-742351 AGTGGGGAGGCCAGGCACAGTGG + Intronic
1153994236 18:10425959-10425981 GGTGGGGAAGGAAGCCACAGAGG + Intergenic
1154319074 18:13330247-13330269 GGAGGGGAGGCCAGGCACAGTGG - Intronic
1156407497 18:36796814-36796836 GGTGGGGTTTCCAGAGCCAGAGG + Intronic
1157046550 18:44107143-44107165 GGTGGGCTTGGCTGCCATAGGGG + Intergenic
1157786164 18:50484963-50484985 GGTGGTGTTGCCAGAGCCAGGGG + Intergenic
1158182126 18:54728319-54728341 GTTGGGGATGGCAGCCTCAGTGG + Intronic
1158426749 18:57347232-57347254 GGTGGGCTTTCCAGCCAGAGGGG + Intergenic
1160887281 19:1355699-1355721 GGTGGCGTTTCCAGCAAGAGAGG - Intronic
1160995039 19:1878572-1878594 GGTGGAGATGCCAGGCAGAGGGG - Intronic
1161035662 19:2083132-2083154 GCAGGGGTGGCCAGGCACAGTGG - Intronic
1161571225 19:5031827-5031849 AGTGGGGTTCCCAGCCACCAAGG - Intronic
1161773916 19:6247110-6247132 GATGGAGTTGGCAGCCTCAGAGG + Intronic
1162151164 19:8646630-8646652 GCAGGGCTTGCCGGCCACAGTGG - Intergenic
1162307008 19:9881182-9881204 CCTGGGGTTGCCGGGCACAGTGG - Intronic
1163277882 19:16296869-16296891 GGTGGGGTGGCCGTCCAGAGAGG - Intergenic
1163449112 19:17365264-17365286 GGTGGGCTTGCAGGCCCCAGAGG - Exonic
1164298523 19:23937429-23937451 GGGGCGGTTGCCAGGCAGAGGGG + Intronic
1164512779 19:28911321-28911343 GGTGGGCTTGTGAGCCACTGAGG - Intergenic
1164636715 19:29796781-29796803 CCTGGGGTGGCCAGGCACAGTGG + Intergenic
1165050555 19:33138967-33138989 TGTGGGGTGGCCGGGCACAGTGG - Intronic
1165163713 19:33834791-33834813 GTTGGGCTGGCCAGGCACAGTGG - Intergenic
1165304120 19:34993149-34993171 GGTGGGGGTGCCGGTCACTGTGG - Intergenic
1165850351 19:38846766-38846788 GGTGGGGTGGCCAGCGCCTGTGG + Intronic
1166307592 19:41943603-41943625 GGTGGGGGGGCCGGGCACAGTGG + Intergenic
1166706939 19:44913239-44913261 GGGGAGGTAGCCAGCCAAAGGGG + Intergenic
1166709113 19:44925794-44925816 GGGGAGGTAGCCAGCCAAAGGGG + Intergenic
1166866500 19:45841269-45841291 GGGGGAATTGCCAGGCACAGTGG - Intronic
1168563863 19:57406137-57406159 GATGGAGTGGCCAGGCACAGTGG - Intronic
1168636235 19:57999535-57999557 AGTGGGGCTGCCAGCCAAAAGGG + Intronic
925889169 2:8419896-8419918 TGTTGGGGTGGCAGCCACAGAGG + Intergenic
926110294 2:10178508-10178530 GGAGGGGTGGCCAGGCACAGTGG - Intronic
926768499 2:16346787-16346809 GGTGGGGTTGACACAAACAGAGG + Intergenic
927987026 2:27418783-27418805 GATGGGGAGGCCAGGCACAGTGG - Intergenic
928182832 2:29081325-29081347 TGTGGGGATGCCAGCTGCAGTGG - Intergenic
929092289 2:38230967-38230989 AGTGTGTTTGGCAGCCACAGAGG + Intergenic
929201764 2:39244059-39244081 GCTGGGGCTGCCAGCGCCAGGGG - Intergenic
931914608 2:66939979-66940001 CATGGTGTTGCCAGGCACAGAGG - Intergenic
932577626 2:72971526-72971548 GTTGGGGAGGCCAGCAACAGGGG - Intronic
934566189 2:95342895-95342917 GGTGTGGTCACCAGCCACACAGG + Intronic
936098418 2:109552596-109552618 GGTGGGCCTCACAGCCACAGTGG - Intronic
937152015 2:119692492-119692514 GCTGGGGTGGCCCTCCACAGAGG + Intergenic
937308264 2:120885434-120885456 GCTGGGGTGGCCAGGCTCAGGGG - Intronic
937359311 2:121217916-121217938 GGGGGGCTCGCCAGCCACACAGG + Exonic
938980490 2:136521674-136521696 GGTGAGGCTGTCAGCCACACAGG - Intergenic
939240482 2:139552482-139552504 TGTGGGACTGCCAGCCTCAGTGG + Intergenic
939417130 2:141914031-141914053 GGAGGGTTGGCCAGGCACAGTGG - Intronic
940422960 2:153500022-153500044 TGTGGGGATGCCAGCTGCAGTGG - Intergenic
940636651 2:156306060-156306082 GGTGGCTTGGCCAGGCACAGTGG + Intergenic
946832438 2:223740356-223740378 TGTGGGGTTTACAGCAACAGAGG + Intergenic
947917787 2:233845437-233845459 AGTGGGGCAGCCAGGCACAGTGG - Intronic
948897303 2:240933434-240933456 GGAGGGGTTGCCAGCCGGGGAGG + Intronic
1169222216 20:3831190-3831212 AGTGTGGTGGCCAGGCACAGTGG - Intergenic
1173000896 20:39105004-39105026 GCTGAGGTTTCCAGCCCCAGAGG - Intergenic
1174418054 20:50380491-50380513 GGTGGGGGTGCAGACCACAGAGG + Intergenic
1176070994 20:63226413-63226435 GGGAGGGTTGCCTGTCACAGGGG + Intergenic
1176150275 20:63587272-63587294 GGGGGGCTTGCAAGCAACAGAGG - Intergenic
1179227248 21:39465185-39465207 GGAGGGGATACCAGGCACAGTGG - Intronic
1179266939 21:39812273-39812295 CCTGGGGGTACCAGCCACAGGGG + Intergenic
1180024307 21:45150642-45150664 GGTGGGGCTGCCAGCCACTCTGG - Intronic
1180605152 22:17053255-17053277 AGTGGGTTGGCCAGCCACAAGGG + Intergenic
1180941976 22:19665670-19665692 GGGGGTGTTCCCAGGCACAGAGG + Intergenic
1181161791 22:20964139-20964161 GGTGGGGTGACCAGGCCCAGAGG - Intergenic
1181463317 22:23097832-23097854 GGTGGGTCTGCCAGTCACACGGG + Intronic
1181553119 22:23652373-23652395 GGTGGGGGTGCCAGGCCCTGGGG - Intergenic
1181829225 22:25546098-25546120 TGAGGGGTGGCCAGACACAGAGG - Intergenic
1182147857 22:28007999-28008021 GGTGGGGCTGCCAGTCTCACAGG + Intronic
1182476820 22:30581047-30581069 CGTGGTGGTGCCTGCCACAGAGG - Exonic
1184101758 22:42344570-42344592 GTGGGGGTGGCCATCCACAGAGG - Intergenic
1184160655 22:42695367-42695389 GGTGGGGTGGCAATCCACATAGG + Intronic
950885785 3:16361687-16361709 GGTGGGGAGGCCAGCCACTTAGG + Intronic
952498946 3:33941180-33941202 GATGCTGTTGCCAGTCACAGAGG + Intergenic
954814798 3:53272054-53272076 TGTGGAGGAGCCAGCCACAGTGG - Intergenic
954886859 3:53882249-53882271 GGTGGGGCTGCCCGGCGCAGGGG + Intergenic
955409946 3:58648994-58649016 TGTGGGGTTGTCAGAGACAGGGG + Intronic
956369118 3:68539111-68539133 AGTTGGGTTTCCAGCCAGAGTGG + Intronic
957156643 3:76552018-76552040 GAAGGTGCTGCCAGCCACAGAGG + Intronic
957979377 3:87489120-87489142 GGTGGGGTTCCCACAGACAGAGG - Intergenic
961889269 3:130116713-130116735 AGTGTTGTAGCCAGCCACAGTGG - Intergenic
962708753 3:138068284-138068306 GGTGGCCTTGCCATCCACACCGG - Exonic
963140901 3:141945414-141945436 GGTGGGTATGCCAGGCACAGTGG - Intergenic
964790179 3:160446704-160446726 GGTGGGCTTGCCCGCCACCATGG - Intronic
966726209 3:183111207-183111229 ATTGGGGTTCCCAGCCAAAGGGG - Intronic
968538459 4:1150000-1150022 GGTGAGGGAGCCAGCCACAGTGG + Intergenic
968944876 4:3658379-3658401 GGAGAGGCTGCCAGGCACAGGGG - Intergenic
969266507 4:6067458-6067480 GGTGGGGTTCTCATCCAGAGGGG - Intronic
970155498 4:13137554-13137576 GATGGGGAAGCCACCCACAGAGG - Intergenic
974332965 4:60504086-60504108 GATTGGGTTGCCAGGCGCAGTGG - Intergenic
975983758 4:80185024-80185046 CGCGGAGTTGCCAGCCACTGCGG - Intronic
976129534 4:81870382-81870404 TGTGGGGATGCCAGCTGCAGTGG + Intronic
978507678 4:109477611-109477633 GGTATGGTAGCCAGGCACAGTGG - Intronic
978704191 4:111685810-111685832 GGTGGGGTTGCAGGGCACAGAGG + Intergenic
978796267 4:112711142-112711164 GTTGGGGTCACCAGGCACAGTGG + Intergenic
979524362 4:121701844-121701866 GGTGGGGCTGCCTTCCTCAGTGG + Intergenic
981736924 4:147962946-147962968 GGAGTGGTGGCCAGGCACAGTGG - Intronic
983352061 4:166602419-166602441 CGGGGCCTTGCCAGCCACAGAGG + Intergenic
983505394 4:168547660-168547682 GGAGGCGTGGCCAGGCACAGTGG + Intronic
984820384 4:183876563-183876585 GGAGAGGTTGCCAGCGCCAGTGG + Intronic
987299105 5:16581059-16581081 CAAGGGGTTGACAGCCACAGTGG + Intronic
987976207 5:25018335-25018357 GGTAGGGGTGCCAGGCATAGTGG - Intergenic
988489779 5:31696587-31696609 GGAGAGGTGGCCAGGCACAGTGG - Intronic
989655734 5:43745739-43745761 GATGGGGTGGCCAGGCAGAGGGG + Intergenic
990639507 5:57765673-57765695 GTTGAGGTTGCCAGGCACTGTGG - Intergenic
991582940 5:68175241-68175263 GGGGGGATAGCCAGGCACAGTGG + Intergenic
992269642 5:75052508-75052530 GGTGGCGGTGCCTACCACAGCGG - Intergenic
994406418 5:99351688-99351710 GAAGGTGCTGCCAGCCACAGAGG - Intergenic
994449924 5:99929319-99929341 GGTGGGATGACCAGCCGCAGAGG - Intergenic
997254989 5:132421668-132421690 GGTGGTGTTTCCAGGCACACAGG + Intronic
997608088 5:135191221-135191243 GGTGGGGGTGCCAGCCCCGGGGG + Intronic
999326109 5:150644772-150644794 GGATGGGGTGCCAGCCACACTGG - Intronic
999394839 5:151220866-151220888 TGGGGAGTTGCCAGCCACAGTGG - Intronic
999396732 5:151234240-151234262 GGTGGGGTTGCTGGACAAAGTGG - Intronic
1000203438 5:159034484-159034506 GCTGGGGTTTCAAGCCAGAGAGG - Intronic
1001355972 5:171022886-171022908 GGTTGGGATGCTAGCCCCAGTGG + Intronic
1001774092 5:174315731-174315753 GGTGGAGGTGCCAGCTTCAGAGG + Intergenic
1002299529 5:178249332-178249354 GGTGAGGCTCCCAGCCACTGTGG - Intronic
1004190979 6:13463205-13463227 GGTGGGGCTGGCAGCCCCTGGGG + Intronic
1005008583 6:21314143-21314165 GGTGGGATGGCCAGGCACAGTGG - Intergenic
1006497552 6:34434786-34434808 GGCGGGGGGGCCAGGCACAGTGG - Intergenic
1006510582 6:34519111-34519133 GGAGGAGGGGCCAGCCACAGAGG + Intronic
1006803576 6:36774683-36774705 AGTGGGGATGCCAGACAGAGGGG + Intronic
1007474061 6:42107367-42107389 GGTGGGGGTTCCAGCAGCAGGGG + Exonic
1007742464 6:44021256-44021278 GGTGGGGTGGACAGTGACAGAGG - Intergenic
1008288428 6:49682869-49682891 GTTGAGGTTACCAGGCACAGTGG + Intergenic
1013123017 6:107157514-107157536 GGTGGGGGAGACAGCCCCAGGGG - Intronic
1014384586 6:120785568-120785590 TGTGAGGATGCCAGCTACAGTGG + Intergenic
1016092108 6:139992724-139992746 ACTGGGCTTGCCAGGCACAGGGG + Intergenic
1018854169 6:167663529-167663551 GGTGGGGTTTCCACCAGCAGTGG + Intergenic
1019128964 6:169859771-169859793 GATGGGGCCGGCAGCCACAGAGG - Intergenic
1019391513 7:789903-789925 GCTGTTGTTGCCAGGCACAGTGG + Intergenic
1020666565 7:11051301-11051323 GGTGGTTTTGCCAGCTGCAGTGG - Intronic
1021411179 7:20331137-20331159 GCTCGGGATGCCAGCAACAGGGG - Exonic
1021698704 7:23297531-23297553 GGTGAGGTTGCCAGGCATGGTGG + Intergenic
1021777123 7:24064964-24064986 GGTGGGGTTGCTTATCACAGAGG - Intergenic
1021900501 7:25280341-25280363 GGTGGGTTTGCTAAGCACAGTGG + Intergenic
1022535733 7:31097119-31097141 TGTGGCGTAGCCAGCCCCAGAGG + Intronic
1023176214 7:37438114-37438136 GGTGGGGTTGGCAGGGAAAGAGG - Intronic
1023934624 7:44730486-44730508 AAGGGGGTTGCCAACCACAGAGG + Intergenic
1025115747 7:56256447-56256469 AGAGGTGCTGCCAGCCACAGAGG + Intergenic
1025246205 7:57319447-57319469 GGTGGGGCATCCAGCCAGAGGGG + Intergenic
1026868676 7:73837830-73837852 GGGGGGGTGGGCAGGCACAGTGG - Intronic
1027268863 7:76509501-76509523 GGCGGGGGTGCCAGGCACGGTGG + Intergenic
1027387175 7:77670328-77670350 AGGTGGGGTGCCAGCCACAGTGG + Intergenic
1028177978 7:87679675-87679697 GTTGGGGTGGCCAGGCACAGTGG - Intronic
1028909924 7:96196397-96196419 GATGGGGTTGCCAGAGAAAGCGG - Intronic
1029216786 7:98956304-98956326 GGTAGGGGTGTCAGCCTCAGGGG + Exonic
1029474955 7:100777647-100777669 GGAGGGGTGGCCAGGCACAGTGG - Intronic
1029569169 7:101359164-101359186 GGTGGGGGTGTCAGCCACGTCGG - Intergenic
1029668145 7:102009056-102009078 GCTCGGCCTGCCAGCCACAGCGG + Intronic
1030359609 7:108580675-108580697 GAAGGGGCTGCCGGCCACAGAGG + Intergenic
1030717977 7:112833061-112833083 GGTGGGGGAGCCAGGCTCAGTGG - Intronic
1031126903 7:117784387-117784409 GGTGGGCCTGCCAGCCAGGGGGG + Exonic
1032477770 7:132224099-132224121 GGTGGGGTTGCCAACCATGGAGG - Intronic
1033206081 7:139424208-139424230 TGTGGGGCTGCGTGCCACAGCGG + Intergenic
1033220948 7:139525821-139525843 GGTGGGCAGCCCAGCCACAGTGG - Intronic
1033545106 7:142392482-142392504 GGGAGGGCTGCCAGCCAGAGGGG + Intergenic
1034424773 7:151008817-151008839 TGGGGGGTTGGCAGCCCCAGTGG - Intronic
1034519653 7:151609993-151610015 GGTGGTGTTGGCAGCCTCCGGGG - Intronic
1034569041 7:151940588-151940610 GATGAGGCTGCCAGCAACAGAGG + Intergenic
1035420299 7:158724176-158724198 GTGGGGGTAGCCAGGCACAGTGG + Intergenic
1035635767 8:1143057-1143079 TGTGGGACTGCCGGCCACAGCGG + Intergenic
1036482982 8:9154131-9154153 GGGGCGGTTGCCAGGCAGAGGGG + Intronic
1036647821 8:10623124-10623146 CGAGGGGGTGCGAGCCACAGAGG + Exonic
1038662695 8:29510860-29510882 AGTGGGTTGGCCAGGCACAGTGG - Intergenic
1038831707 8:31069262-31069284 GGAGGGCCTGCCACCCACAGAGG - Intronic
1039433837 8:37546066-37546088 GCAGGGGTGGCCAGCCACTGAGG + Intergenic
1040042664 8:42932025-42932047 AATGGGGTGGCCAGGCACAGTGG - Intronic
1041763354 8:61391425-61391447 GGTGGGTAAGCCAGACACAGGGG + Intronic
1044689568 8:94863162-94863184 TGGGGGGTTGGCAGCCACAGTGG + Intronic
1048011866 8:130463930-130463952 AGTGGGGTTGCCAGAGACAAAGG - Intergenic
1048063511 8:130944962-130944984 TGGGGGGTGACCAGCCACAGAGG + Intronic
1049026240 8:139990979-139991001 GGTGGGGCTGCCTTCCCCAGAGG + Intronic
1049319074 8:141986385-141986407 GAAGGGGTTGCAAGCCTCAGAGG + Intergenic
1049368524 8:142252462-142252484 GGTGGTGCTGCCGGCGACAGTGG + Intronic
1049787373 8:144457468-144457490 CCTGGGGTTGGCAGCCCCAGGGG - Intronic
1050441230 9:5666044-5666066 GGTGGGGTAGGCTGCCACACTGG - Intronic
1051141824 9:13987014-13987036 CGTGGTGGTGCCTGCCACAGAGG + Intergenic
1052931067 9:34055963-34055985 GGTGGGGTTGCTTGGCGCAGTGG - Intergenic
1053181552 9:35976085-35976107 GATGGTGTTGCCAGCTGCAGTGG + Intergenic
1056938183 9:90933661-90933683 GATGTGGGTGCCAGCCACAAAGG + Intergenic
1057550232 9:96046990-96047012 GGTGGTGGTGCCCGCAACAGAGG + Intergenic
1059267762 9:113051740-113051762 GGTGGTCTGGCCAGGCACAGTGG - Intronic
1059486875 9:114633833-114633855 GCTGGGGGTGACAGACACAGTGG + Exonic
1060636682 9:125204852-125204874 GCCTGGGTGGCCAGCCACAGAGG - Intronic
1060847612 9:126849661-126849683 GGAGGGGCTGCCAACCACAAAGG - Intergenic
1061067156 9:128285697-128285719 GGTGGGGTTGCCAGCCACAGTGG - Intronic
1061182654 9:129034230-129034252 AGTGGGGTTGTCTGGCACAGGGG - Intergenic
1061222957 9:129262873-129262895 TGTGGGGAGGCCAGGCACAGTGG - Intergenic
1061514465 9:131080733-131080755 GGTGAGGTTGCCAGGAAGAGAGG + Intronic
1061520198 9:131113208-131113230 GGTGGGGAGGCCAGGCACGGTGG + Intronic
1062036370 9:134384395-134384417 GCTGGGGTCGCCAGCGACTGAGG + Intronic
1062171778 9:135138715-135138737 GGAGCGGTTTCCAGGCACAGAGG - Intergenic
1062374535 9:136255962-136255984 GGTGGGGCTGCCACTCCCAGGGG + Intergenic
1062693245 9:137856583-137856605 GGTGGGGTTTCCAGTGGCAGTGG + Intronic
1185446318 X:259656-259678 GGTGGGGTAGCTAGAGACAGTGG + Intergenic
1185799766 X:2999750-2999772 GCTGGGCTGGCCAGGCACAGTGG + Intergenic
1190719171 X:53133078-53133100 GGTGGAATTGCCAGTCACGGTGG + Intergenic
1192325398 X:70127974-70127996 AGGGGCATTGCCAGCCACAGAGG - Intergenic
1193417332 X:81240824-81240846 TGTGGGGATGCCAGCTACAGTGG + Intronic
1195313997 X:103659986-103660008 GGTGGGCTTGGCTGCCACATGGG + Intergenic
1195872624 X:109501783-109501805 GGTGGTTCTGCCAGCCACTGTGG + Intergenic
1196416979 X:115481705-115481727 CTTGGGCTTGCCAGGCACAGCGG + Intergenic
1198744051 X:139871494-139871516 GCGGGGGTGGCCAGGCACAGTGG - Intronic